3O0

16 14 12 I0

i [

16 14 12 l o

16 14 12 i0

1 4/49 2 3/19 3/25 4 2/25 5 4/21

6 19/67 7 3/23 8 4/37 9 3/21 iO 4/23 ii 2/18 12 2/9

13 4/28 14 3/31 15 4/28 16 4/18 17 3/1118 3/8 X 1/3 Y 1/5

Mammalian Genome 8, Brief Data Reports

Fig. 1. Distribution of silver grains in 77 normal metaphases from pig leukocytes hybridized with the pig cDNA of NADPH oxidase-light (or c0 chain subunit (p22-phox) probe. A total number of 470 grains were counted, and of these 67 (14%) were found on Chr 6. Of the 67 grains, 42 (63% of grains on chromosome 6, or 9% of the total number of grains) were found in the region 6p15. Statistical evaluation of the number of silver grains per unit of chromosome length, assuming a Poisson distribution [9], indicated that the signal from the probe was highly significant (P < 0.01) for Chr region 6p15.

References 1. Lahbib-Mansais Y, Yerle M, Gellin J (1994) Cytogenet Cell Genet 67,

120--125 2. Zhou Y, Murtangh MP (1994) Gene 148, 363--367 3. Parkos CA, Allen R, Cochrane C, Jesaitis A (1987) J Clin Invest 80,

732-742 4. Segal AW (1989) J Clin Invest 83, 1785-1793 5. Klebanoff SJ (1985) Oxygen-dependent antimicrobial systems in mono-

nuclear phagocytes. In Macrophage Biology, S Reichard, M Kojima, eds (New York, NY: Alan R. Liss), pp 487-496

6. Dinauer MC, Pierce EA, Bruns GA, Cumutte JT, Orkin SH (1990) J Clin Invest 86, 1729-1737

7. Rettenberger G, Klet C, Zechner U, Kunz J, Vogel W, Hameister H (1995) Gene 26, 372-378

8. Fr6nicke L, Chowdhary BP, Scherthan H, Gustavsson I (1996) Mamm Genome 7, 285-290

9. Barnett V, Lewis T (1980) Outliers in Statistical Data (Chichester: John Wiley & Sons)

Linkage mapping of the Fc72 receptor gene to bovine Chromosome 18

Helge Klungland, Dag I. V~ge, Sigbjc~rn Lien

Department of Animal Science, Agricultural University of Norway, P.O. Box 5025, N-1432/~s, Norway

Received: 15 July 1996 / Accepted: 9 November 1996

Species: Bovine Locus name: Fragment crystallizable gamma 2 receptor (Fc'y2R) Locus symbol: FCG2R Map position: Relative recombination fractions between FCG2R and the three known markers used in the study were; D18S1- (0.0427), D18S8-(0.0271), EAC-(O. 1105). Methods of mapping: Two FCG2R alleles were identified in the Norwegian cattle population. Linkage between the FCG2R locus

Correspondence to: H. Klungland

and microsatellites previously assigned to bovine Chromosome (Chr) 18 [1-3] was calculated [4] in two paternal half sib families with a total of 103 sons. Database deposit information: The nucleotide sequence data re- ported in this paper will appear in the EMBL, GenBank, and DDBJ Nucleotide Sequence Databases under the accession numbers X98524 and X98525. Molecular reagents used for mapping: Primers for amplification and sequencing of the bovine Fc72 receptor gene were designed based on the bovine cDNA sequence [5] and from intron sequenc- ing.

a. Fc72R - exon 5' tca ctc agc aca aac ccc tac ct 3' (forward) b. Fc-,/2R - exon 5' agg ctg cga ggc cca tcc gga t 3 ' (reverse) c. Fc72R - intron 5' cgc ccc ttc ctc cct cac ca 3' (forward) d. Fc72R - intron 5' aga gcc ccg agc tgc tga 3' (reverse) e. Fc',/2R - intron 5 ' tc tgt aga gtt ggg ctc 3' (forward)

Primers a and b were used to amplify the last intron, which were sequenced with primers a, b, c, d and e with USB' s Se- quenase TM PCR Product sequencing kit (product no. 70170). Prim- ers b and c were used to amplify the polymorphic part of the intron. PCR-amplification was carried out with 1.0 wt 10 • PCR buffer (500 mM KC1, 100 mM Tris-HC1, pH = 8.3, 2.5 mM MgClz, 0.01% gelatin), 200 IxM of each dNTP, 5 pmol of each primer, 0.2 U Taq polymerase, 50 ng genomic DNA, and H20 to a final volume of 10 I~1. Genomic DNA was denatured for 3 min at 95~ and PCR was run for 40 cycles at 95~ for t5 s, 63~ for 30 s, and 73~ for 1 min. Microsatellite analysis were performed as previously de- scribed [6].

Allele detection: The nucleotide change within the amplified Fc72R intron sequence was detected with restriction enzyme AvaI. Two out of six bull sires that were tested were heterozygous for the observed mutation. Allele frequencies: Allele frequencies were estimated in two pa- ternal balf-sib families of Norwegian cattle (NRF), exclusively utilizing alleles inherited from the dams of 56 informative sons. The allele frequencies of the two alleles were 0.14 (nondigested allele) and 0.86, respectively.

Mammalian Genome 8, Brief Data Reports 301

-EAC

11.05 I0,31 (~od 6.4) (Iod 9.6)

"D18S8 (Iod 9.2)

2.71 21.13 Ood 8.5) I ~ 7.8)

FCG2R 427 13.69

(,o~ 10.0)

-D18SI

Fig. 1. Map position for FCG2R on bovine Chro 18 relatively to EAC (bloodgroup C), D18S8 (BM2078; Bishop et al. 1994) and D18S1 (TGLA227; Barendse et al. 1994). Map distances between markers using Kosambi map function are given in cM, with Lod scores in brackets.

Previously idenafied homologs: No homologs are known, but the gene is related to the human Fco~R gene (IgA binding receptor) [7], which maps to 19q13.4 [8]. Discussion: Fc~/ receptors are expressed on the cell surface of lenkocytes, where they mediate immune responses following bind- ing to complexed IgG and play an important role in the transport of IgG. Bovine Fc-,/2 receptor cDNA was cloned from a cattle alveolar macrophage library and represents a novel class of mam- ma)ian Fc~Rs [5]. The bovine Fc72R gene is a member of the immunoglobulin superfamily and shows 56% identity to the hu- man Fco~R gene at the nucleotide level between the extracellular and transmembrane domains (Zhang et al. 1995). Using erythro- cytes sensitized with different immunoglobulins, we have shown that the receptor binds with IgG 2 but not with IgG 1 and, despite its relation to the human FcaR, the receptor has no affinity for IgA. Interestingly, the human Fco~R gene maps to Chr 19, which cor- responds to bovine Chr 18 [9, 10]. This mapping further supports the hypothesis that these genes probably have evolved from a common ancestor that is not shared by other Fc'yRs, and these results will be useful both for further studies on the bovine Fc~2 receptor gene, and for characterization and mapping of the corre- sponding gene in humans and other species.

References 1. Barendse W, Armitage SM, Kossarek LM, Shalom A, Kirkpatrick

BW, Ryan AM, Clayton D, Li L, Neibergs HL, Zhang N, Grosse WM, Weiss J, Creighton F, McCarthy F, Ron M, Teale AJ, Fries R, McGraw RA, Moore SS, Georges M, Soller M, Womack JE, Hetzel DJS (1994) Nature Genet 6, 227-235

2. Bishop MD, Kappes SM, Keele JW; Stone RT, Sunden SLF, Hawkins GA, Toldo SS, Fries R, Grosz MD, Yoo J, Beattie CW (1994) Genetics 136, 619-639

3. Eggen A, Fries R (1995) Anim Genet 26, 215-236

4. Haldane JBS, Smith CAB (1947) Ann Eugen 14, 10-31

5. Zhang G, Young JR, Tregaskes CR, Sopp P, Howard CJ (1995) J Immunol 155, 1534-1541

6. Klungland H, V~tge DI, Gomez-Raya L, Adalsteinsson S, Lien S (1995) Mamm Genome 6, 636-639

7. Maliszewski CR, March CJ, Schoenborn MA, Gimpel S, Shen L (1990) J Exp Med 172, 1665-1672

8. Kremer EJ, Kalatzis V, Baker E, Callen DF, Sutherland GR, Malisze- wski CR (1992) Hum Genet 89, 107-108

9. Solinas TS, Lengauer C, Fries R (1995) Genomics 27, 489-496

10. Chowdhary BP, Frrnicke L, Gustavsson I, Scherthan H (1996) Mamm Genome 7, 297-302

Physical and genetic localization of the bovine cannabinoid receptor (CNR1) gene to bovine Chromosome 9

M. Pf i s ter-Genskow, 1 G.D. Weesner , 2 H. Hayes, 3 A. Eggen, m M.D. Bishop l

1DNA Research & Testing Laboratory, ABS Global, Inc., DeForest, Wisconsin 53532, USA 2USDA, Agricultural Research Service and Purdue University, West Lafayette, Indiana 47907, USA 3Laboratoire de Grnrtique biochimique et de Cytogrnrtique, INRA-CRJ, 78350, Jouy-en-Josas, France

Received: 1 September 1996 / Accepted: 7 November 1996

Species: Bovine Locus name: Cannabinoid receptor (brain) Locus symbol: CNR1 Map position: CNR1 is located on bovine Chromosome (Chr) 9q22; D9S32 (ABS017) is located on bovine Chr 9 linked to D9S14 [1] with a recombination frequency (sex-averaged) of 0.11 and LOD score 4.23. Method of mapping: Fluorescence in situ hybridization (FISH), R banding; families of the International Bovine Reference Panel (IBRP) were genotyped for linkage analysis with the cattle geno- typic database to determine the location of the microsatellite, ABSO17, and to position the CNR1 gene relative to other linked loci. Database deposit information: GenBank accession number U77348 Molecular reagents: On the basis of bovine cannabinoid receptor (CNR1) cDNA sequence [G.D. Weesner, unpublished data] oligo- nuc leo t ide pr imers were designed: ( forward pr imer) 5 ' - GAGAACTTTATGGACATGGAGT and (reversal primer) 5 '- GCTGGAATGGAGGATGAC. PCR amplification was conducted in a reaction volume of 25 pL1 containing 30 ng of genomic DNA, 0.5 IXM each primer, 50 ~M each dNTP, 1.5 mM MgC12, l x PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mMKC1) and 0.5 units Am- pliTaq DNA Polymerase (Perkin Elmer). Cycling conditions were 3 min at 94~ (initial denaturation), followed by 30 cycles of 1 min at 94~ 1 min at 60~ and 1 min at 72~ and a final extension of 4 min at 72~ The primers amplified a 140-bp PCR product from bovine genomic DNA. A bovine YAC library containing 21,500 clones [2] was screened by PCR with the above primers, and three clones positive for the bovine cannabinoid receptor gene were isolated. For FISH mapping, approximately 2 Ixg of total yeast DNA of each clone was labeled (BioNick, Boehringer Man- nheim), applied to an R-banded chromosome spread after dena- turation at 100~ for 10 min, and prehybridized at 37~ for 30-40 min. In situ hybridization and detection of hybridization signals were performed as previously described [3]. The chromosomes were identified by R-banding according to Lemieux and associates [4] and numbered according to the standard RBG-banded karyo- types of ISCNDA [5]. Specific signals were observed on 30 meta- phases on the same region of bovine Chr 9 (Fig. 1). Allele detection: A (CA)it, dinucleotide repeat, D9S32, was iso- lated from a YAC clone possessing the CNR1 gene. To generate microsatellite markers directly from a positive YAC insert, a pro- tocol based on subtractive hybridization and PCR amplification described by Chen and colleagues [6] was followed. Flanking sequences on both sides of the dinucleotide repeat, D9S32, were used to design primers for PCR to amplify a product of predicted length (272 bp) (forward pr imer: 5' T C T G G T T C C T C T -

Correspondence to: M. Pfister-Genskow