long-range chromatin interactions drive mutant tert...

Long-range chromatin interactions drive mutant Tert promoter activation

Semih Can Akıncılar1,2, Ekta Khattar1, Priscilla Li Shan Boon 3, Bilal Unal1,2, Melissa

Jane Fullwood3, Vinay Tergaonkar1,2,4*

1Division of Cancer Genetics and Therapeutics, Laboratory of NFκB Signaling, Institute of Molecular and Cell Biology (IMCB), A*STAR (Agency for Science, Technology and Research), Singapore 138673. 2Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore (NUS), Singapore 117597, Singapore 3 Cancer Science Institute, National University of Singapore, Singapore 4 Centre for Cancer Biology, University of South Australia and SA Pathology, Adelaide, Australia. Running Title: Telomerase re-activation by long-range interaction Key words: Telomerase re-activation, long-range interaction, Tert promoter mutation *Correspondence

Vinay TERGAONKAR, [email protected], Institute of Molecular and Cell Biology (A*STAR), Proteos, 61, Biopolis Drive, 138673, Singapore. Ph +65-65869836; Fax +65-67791117. Email: [email protected] Disclosure of Potential Conflicts of Interest No potential conflicts of interest to be disclosed.

Research. on June 20, 2018. © 2016 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on September 20, 2016; DOI: 10.1158/2159-8290.CD-16-0177

http://cancerdiscovery.aacrjournals.org/

1

Abstract

Cancer-specific Tert promoter mutations (-146C>T and -124C>T) have been linked to

reactivation of epigenetically silenced telomerase reverse transcriptase gene (Tert).

Understanding how these single nucleotide alterations drive Tert reactivation is a

fundamental unanswered question and is key for making successful therapeutics. We

show that unlike on wild-type promoter, recruitment of transcription-factor GABPA

specifically to mutant Tert promoters mediates long-range chromatin interaction,

enrichment of active histone marks and hence drives Tert transcription. CRISPR

mediated reversal of mutant Tert promoters, or deletion of its long-range interacting

chromatin, abrogates GABPA binding, long-range interactions, leading to depletion

of active histone marks, loss of Pol2 recruitment and suppression of Tert

transcription. In contrast, de-novo introduction of Tert promoter mutation enables

GABPA binding and upregulation of Tert via long-range interactions, acquisition of

active histone marks and subsequent Pol2 recruitment. This study provides a unifying

mechanistic insight into activation of mutant Tert promoters across various human

cancers.

Significance statement

This study identifies a key mechanism by which cancer specific mutant Tert

promoters cause reactivation of Telomerase reverse transcriptase (Tert). Since the

mechanism uncovered here is not utilized by promoters that drive Tert in normal

cells, this mechanism could be exploited to make inhibitors which have the potential

to block telomerase function and hence the progression of up to 90% of human

cancers.




2

Introduction

Telomerase is a reverse transcriptase that elongates telomeres and thus

maintains genomic integrity (1-3). It is minimally composed of the catalytic protein

component TERT and a template forming RNA component Terc. Although Terc is

ubiquitously expressed (4), Tert is epigenetically silenced in most adult somatic cells

limiting their replicative lifespan. Up to 90% of human cancers reactivate Tert

expression transcriptionally to reconstitute telomerase enzyme activity, which

subsequently enables replicative immortality (5).

Recently, two cancer-specific somatic mutations in the Tert promoter were

identified (6, 7). These mutations are particularly common in a subset of cancers

including melanoma (74%), glioblastoma (83%), hepatocellular carcinoma (44%) and

urothelial bladder carcinomas (53.5%) (6-10). These mutations cause a Cytosine (C)

to Thymidine (T) transition at -124bp (-124C>T) and -146bp (-146C>T) upstream of

ATG start site resulting in the creation of novel E-Twenty-Six (Ets) transcription

factor binding motifs (6). The Ets family includes 27 members amongst which,

GABPA has been shown to specifically associate with the de novo motif created by

mutations in several cancer cell types (11).

Because the mechanisms of activating transcription from wild type (WT) Tert

promoter in stem cells could be vastly different from those employed by mutant Tert

promoters, understanding how these promoters function is of critical importance.

Chromatin remodeling and epigenetic mechanisms, particularly histone modifications

and DNA methylations, have been shown to regulate Tert transcription (12). -146C>T

and -124C>T mutations are located close to the transcription start site (TSS) of the

Tert gene. It is intriguing to speculate that these promoter mutations may affect

recruitment of epigenetic regulators, which modulate the chromatin structure in order




3

to drive Tert expression. These mutations are majorly heterozygous wherein only

mutant allele specifically recruits of GABPA/B1 and RNA polymerase 2 to drive

transcription and also display active histone marks (13). But what initiates these

epigenetic changes and the nature of these epigenetic changes that eventually convert

the inactive Tert promoter to an active one are not understood at all. In this study, we

addressed these questions and observed that binding of the transcription factor

GABPA to proximal mutant Tert promoter, specifically, initiates and mediates long-

range chromatin interactions and enrichment of active histone marks on these

promoters and hence drives its transcription. The specificity of these events at mutant

Tert promoter provides insights into telomerase reactivation and suggests therapeutic

opportunities for cancer therapy for a wide range of cancers.

Results

Mutant Tert promoters display active histone marks and long-range chromatin

interactions

Cancer-specific mutations in the Tert promoter (-146C>T and -124C>T) create

consensus-binding sites for Ets transcription factors (14). Ets transcription factors are

auto-inhibited and binding of these factors alone is not sufficient to drive

transcriptional activation and it is known that they need to heterodimerize with other

factors for activating transcription (15-17). GABPA and Ets1 have been reported to

specifically interact with the proximal mutant Tert promoters (11, 18) but the

mechanism(s) by which they activate the mutant promoters is not completely

understood. It is known that levels of these factors do not dramatically differ between

normal and cancer cells. Furthermore, there are several Ets/GABPA binding sites on

the wild type promoter which remains dormant in most cell types. Clearly, just




4

creating one more binding of Ets/GABPA on the mutant Tert promoters is not the

entire picture that could explain the mechanism of Tert reactivation by these single

nucleotide changes. Are there uncharacterized events specifically initiated by the

mutant sites and their chromatin context which drives Tert transcription from mutant

Tert promoters? To address these issues, we first asked if cancer specific point

mutations alone are associated with activating epigenetic changes on the mutant Tert

promoters. Figure 1A shows the cell lines used in the study along with Tert promoter

mutation status. Figure 1B shows the schematic outline of Tert promoter. In this study

we divide the promoter in 3 distinct regions; proximal promoter (up to -1 kb), distal

promoter (up to -5kb) and long distance elements (beyond -5kb), upstream of

transcription start site (TSS). The most common Tert promoter mutations are shown

at the -146C>T and -124C>T positions with respect to the ATG translation start site.

We examined the active histone marks H3K4Me3 and H3K9Ac in BLM, A375, T98G

(bearing -146C>T mutation in Tert promoter) and U251 (bearing -124C>T mutation

in Tert promoter) cell lines up to -5kb upstream of Tert gene. Interestingly, we

observed enrichment of both H3K4Me3 and H3K9Ac in the proximal Tert promoter

region of these mutant cell lines (Fig. 1C. Sup. Fig. 1A). We next performed similar

experiments in primary melanocytes with WT Tert promoter (Fig. 1D) and

additionally, we investigated multiple cancer cells including PC3 (prostate cancer),

Fadu (head and neck cancer) and HCT116 colon cancer cell line (Fig. 1D and Sup.

Fig. 1B) wherein Tert is driven by a WT promoter. We observed a trend of lower

enrichment of the active histone marks in active WT Tert promoter from primary

melanocytes and other cancer cells (Fig. 1D). It must be noted that average Tert

expression levels from a panel of cells with mutant and active WT Tert promoter are

not correlative with the mutational status of the promoter as reported previously (Sup.




5

Fig. 1C) (13, 19). These results suggest that comparing Tert levels and epigenetic

marks across cancer cell types is not ideal and the mechanistic insights regarding the

functioning of the mutant and wild type Tert promoters could only be inferred using a

set of isogenic lines wherein cause and effect of making these alterations can be

evaluated.

A recent study by Barutcu et al. suggested that GABP was specifically

enriched in Topologically Associated Domains (TADs) in breast cancer cells,

suggesting that it may also mediate interactions between domains at long distances

(20). To investigate if GABPA bound to mutant Tert promoter could engage in long-

range chromatin interactions, we performed Circular Chromosome Conformation

Capture (4C) assay (21). Figure 1E depicts the intra-chromosomal interactions of the

Tert promoter (chromosome 5) in BLM and A375 cell lines as brought forth by the

4C assay. Y-axis indicates the read counts and x axis indicates distance upstream and

downstream of the Tert promoter which are aligned with respect to the dashed red

line. The top panel (Fig. 1E) indicates the Refseq genes on chromosome 5. Significant

interactions are represented in different shades of red and blue dots for A375 and

BLM cells respectively. Darker dots indicate more significant interactions, indicated

as q values in the color-coded legends. We observed multiple significant interactions

occurring along chromosome 5 upstream and downstream of -146C>T Tert promoter.

Taken together, these findings suggest that mutant Tert promoter displays active

histone marks and long-range chromatin interaction.

Reversing the -146C>T mutant Tert promoter site to WT specifically reverses the

proximal histone marks and alters long-range chromatin interactions




6

To address if the histone marks and chromatin interactions observed on the

mutant promoters are specifically driven by the point mutation in proximal mutant

promoters, we reversed the mutated nucleotide to the WT residue by genome editing

of promoter using CRISPR/Cas9 system (Fig. 2A). Mutant Tert promoter (-146C>T –

labeled as red color) was targeted by single guide-RNA adjacent to the mutant region.

Wild type nucleotide was introduced using a repair template containing homology

regions as shown in Fig. 2A. We generated isogenic lines with mutant Tert promoter

(-146C>T) hereafter referred as BLM6 and with WT Tert promoter (-146C) hereafter

referred as BLM14. Genetic status was confirmed by Sanger sequencing as shown in

Fig.2B (top left panel). As compared to the BLM6, Tert expression was dramatically

reduced in the BLM14 cells (Sup. Fig.2A). Reversal of mutant to WT Tert promoter

also leads to reduced telomerase activity (Sup. Fig. 2B). Early passage cells did not

show significant differences in telomere length however upon long-term culture,

significant telomere attrition was observed in engineered cells (Sup. Fig. 2C-D),

suggesting the functionality of this mutation reversal. We also analyzed BLM14 cells

for Alternative Lengthening Telomeres (ALT) phenotype. There was no co-

localization between TRF2 and PML in BLM6 or BLM14 cells (Sup. Fig. 2E). U2OS

was used as the positive control where we observed very strong co-localization as

reported previously for ALT cell lines (22). We performed RNA-sequencing from

BLM6 and BLM14 cells in order to eliminate possible off-target effects of

CRISPR/Cas9 method. No significant differences were detected in genes that were

predicted to have off-target effects for guide RNA used in CRISPR/Cas9 editing by

RNA sequencing (Sup. Table1). Next, we investigated the epigenetic status of the

proximal Tert promoter in these cell lines. Interestingly, we observed that the




7

proximal active histone marks were significantly reduced upon single nucleotide

reversal (Fig. 2B).

Next, we mapped the long-range intra-chromosomal interactions in these cell

lines using the 4C assay. Fig. 2C-E shows differential intra-chromosomal interactions

of the Tert promoter between BLM6 and BLM14 cells. Red dots indicate significant

and black dots indicate non-significant interactions between mutant and WT Tert

promoter. The intra-chromosomal interactions were dramatically reduced in BLM14

(Fig. 2D) as compared to BLM6 cells (Fig. 2C). Fold interaction differences are

indicated as log2 scale that is shown in lower panel together with Refseq genes that

are located on chromosome 5 (Fig. 2E). As 4C is a semi-quantitative method, to

accurately quantify the differences of these chromatin interactions, we selected 12 of

the interactions that were obtained from 4C analysis and performed 3C-qPCR assays.

Figure 2F shows the strongest five regions interacting with the mutant Tert promoter.

The x-axis indicates the distance of the regions from -146C>T site of the Tert

promoter, which is represented as ‘0’ along with its coordinates below, and y-axis

indicates the binding strength in log10 scale. The strongest interaction was observed

between the Tert promoter and a region 300kb upstream of promoter (chr5:1,556,087-

1,558,758), hereafter referred to as T-INT1 (Fig. 2F). 3C-qPCR assay verified that the

mutant -146C>T mutant Tert promoter in BLM6 cells showed significantly higher

interaction with the T-INT1 intergenic region when compared with the -146C WT

Tert promoter in BLM14 cells (Fig. 2G). Supplementary Table 2 shows the list of

regions with genomic coordinates that were found to differentially interact with the

mutant Tert promoter in BLM6 cells. Since a GABPA binding site is the only

difference between WT and mutant Tert promoter, we speculated that histone marks




8

and long-range interactions uniquely apparent on the mutant promoters might be

initiated/mediated by GABPA binding to this site in the proximal promoter.

Silencing GABPA expression dampens the active chromatin marks as well as

long-range interactions in mutated Tert promoter

As the mutant Tert promoter creates a binding site for the Ets family member

GABPA transcription factor, we analyzed the GABPA recruitment in BLM6 and

BLM14 cells. As shown in figure 3A, GABPA was specifically enriched at the

proximal mutant Tert promoter in BLM6 cells. A similar enrichment pattern was

obtained for RNA polymerase 2 (Pol 2) (Fig. 3B). We next explored the possibility

that GABPA recruitment specifically drives the epigenetic marks in the proximal Tert

promoter region. We depleted GABPA by siRNA in BLM6 cells (Figure 3C). ChIP

performed in GABPA depleted cells which showed reduced recruitment of GABPA to

the mutant Tert promoter along with reduced Pol 2 recruitment (Fig. 3D). This was

associated with reduced Tert expression in GABPA depleted cells (Fig. 3E). Most

importantly, GABPA depletion was associated with reduced enrichment of active

histone marks in the proximal Tert promoter (Fig. 3F).

Mutant Tert promoter showed long-range interaction as observed using 4C

assays (Fig. 2C-E) and GABP has been shown to have the potential for mediating

long-range interactions (20). To investigate if GABPA is a key mediator, we

performed 3C-qPCR assay with GABPA depleted BLM6 cells. We observed

significant reduction of intra-chromosomal interaction between the Tert promoter and

the T-INT1 region upon GABPA depletion (Fig. 3G). To understand the molecular

basis of how GABPA could mediate this long-range interaction, we analyzed the T-

INT1 region for the presence of potential GABPA motifs using the transcription




9

factor motif finder database Jaspar (23). We found multiple GABPA motifs in this

region (Sup. Fig.3A). It is well known that GABPA factors work as tetramers (15-17).

As this region is about 2.5kb long and GABPA sites are spread along the whole

sequence we designed ChIP qPCR primers specific to the 5’ region, central region

and 3’ region. GABPA was specifically enriched at the 5’ region (data not shown).

We examined the GABPA binding to this region in BLM6 and BLM14 cells and

found that it was significantly increased in BLM6 cells (Sup. Fig.3B). Overall, these

results suggest that GAPBA dimers/tetramers bound at long distance, T-INT1 region

(particularly GABPA sites located in 130 to 290bp region according to

chr5:1,556,087) and -146C>T mutant site in Tert promoter provide the stable binding

required for GABPA mediated transcription and this might be the molecular basis of

the specific interaction of the mutant Tert promoter with the 300kb region upstream of

its TSS. Indeed the presence of several GABPA sites in 5’ of the T-INT1 region may

explain why this region might specifically interact with the mutant Tert promoter.

Since the WT Tert promoter does not possess the GABPA motif at -146 position, such

long-range interaction do not take place and the chromatin interaction around the Tert

promoter does not get stabilized for further modification by epigenetic factors. To our

knowledge, this is the first report showing GABPA can indeed function as a mediator

of long distance interactions.

Active histone marks are known to recruit chromatin remodelers such as

BRD4 (24), so we analyzed whether BRD4 is associated with active Tert promoter in

BLM6 cells. We observed strong enrichment of BRD4 at the Tert promoter in BLM6

cells as compared to BLM14 cells (Fig. 3H). Similar patterns of BRD4 recruitment

was observed upon reducing GABPA expression suggesting the essential role for




10

GABPA in initiating the establishment of the chromatin marks on this promoter (Fig.

3I).

The BET domain family inhibitor JQ1 has been shown to regulate GABPA

expression (25). Amongst BET family members, BRD4 has been shown to be the

most potent target of JQ1 inhibitor. Thus, to investigate whether BRD4 affects

GABPA expression, we knocked down BRD4 in BLM6 and BLM14 cells. Figure 3J

shows the knockdown efficiency in BLM6 and 14 cells. We observed significant

reduction in GABPA expression suggesting that BRD4 regulates GABPA expression

independent of Tert promoter status (Fig. 3K). Additionally, we assessed direct BRD4

recruitment to GABPA promoter and observed that it was highly enriched, suggesting

that BRD4 indeed directly regulates GABPA expression (Fig. 3L). However, reducing

BRD4 reduced Tert expression in BLM6 cells (Fig. 3M). This was corroborated with

reduction in telomerase activity upon knocking down GABPA or BRD4 in BLM6

cells (Sup. Fig. 4A). Since, there is no GABPA recruitment on Tert proximal

promoter of BLM14, GABPA reduction due to BRD4 knockdown had no effect in

BLM14 cells. Moreover, epigenetic status of Tert promoter affects the proliferation

rate in BLM6 but not the BLM14 cells with WT Tert promoter (Sup. Fig. 4B-C).

Furthermore, knocking down BRD4 led to significant reduction in active histone

marks in BLM6 cells (Fig. 3N). We also investigated the long-range interaction

changes in Tert promoter upon BRD4 knockdown. We observed significant reduction

in association of proximal Tert promoter with the T-INT1 region as measured by 3C-

qPCR assay, when BRD4 levels were reduced (Fig. 3O). As a control, we also

analyzed the effect of BRD4 knockdown on Tert expression in Fadu cancer cells

bearing active WT Tert promoter. Tert expression remained unaffected upon BRD4

knockdown in Fadu cells (Sup. Fig. 4D-E). There was no effect of knocking down




11

BRD4 or GABPA on alternate splicing of Tert mRNA (Sup. Fig. 4F). This suggests

that depletion of GABPA or BRD4 affects Tert transcription from mutant Tert

promoter. These results could be used to guide us towards therapeutic modalities.

Reversing -146C>T Tert promoter mutation to wild type in A375 melanoma and

T98G glioblastoma cells reduces the active chromatin marks and affects long-

range chromatin interactions

To further validate the novel molecular mechanism mediated by long-range

interactions observed in our assays, and to find the general significance of these

findings, we performed CRISPR mediated reversal of -146C>T mutation in A375

melanoma cells to generate mutant WT Tert promoter containing cells (A375 -146C).

Reversal of Tert promoter mutation in A375 cells reduced the Tert expression,

telomerase activity and significantly diminished the active histone marks (Fig. 4A-C).

ChIP-qPCR analysis showed that Pol 2 binding was significantly reduced in A375 -

146C cells (Fig. 4D). Furthermore, GABPA and BRD4 were significantly enriched in

A375 -146C>T cells as compared to A375 -146C cells (Fig. 4E-F). We performed

3C-qPCR assay in these cells and the A375 -146C cells showed significant reduction

in interaction with the T-INT1 region (Fig. 4G). We also generated WT Tert promoter

containing glioblastoma cell line T98G (T98G -146C) using CRISPR/Cas9 method

(18). T98G cells naturally contain a -146C>T mutation in Tert promoter. We found

that T98G -146C cells showed reduced active histone marks, Pol2, GABPA and

BRD4 in the proximal Tert promoter region (Fig. 4H-J). The 3C-qPCR assay revealed

that the WT Tert promoter in T98G -146C cells showed significant reduction in

interaction with the T-INT1 region as compared with mutant Tert promoter (Fig. 4K).

We conclude that the mechanism by which -146C>T mutation operates is most likely

conserved across cancer types.




12

Introduction of -146C>T mutant site in the wild type Tert promoter generates

long-range chromatin interactions and increases proximal histone marks

To investigate if the cancer-associated single point mutations are sufficient for

causing the changes described above, we next introduced the -146C>T mutation in

HCT116 colon cancer cells with WT Tert promoter to create isogenic lines (HCT116

-146C and HCT116 -146C>T) (Fig. 5A). Cell lines were verified by sequencing and

HCT116 -146C>T cell line was homozygous (data not shown). Introduction of Tert

promoter mutation in HCT116 cells increased the Tert expression, TRAP activity and

significantly enriched the active histone marks (Fig. 5B-D). ChIP analysis showed

that Pol 2 binding was significantly increased at the mutant Tert promoter (Fig. 5E).

Furthermore, GABPA and BRD4 were significantly enriched in mutant Tert promoter

as compared to WT Tert promoter (Fig. 5F-G). GABPA was also strongly associated

with T-INT1 region in HCT116 -146C>T cells (Sup. Fig. 5). We further investigated

whether HCT116 -146C and HCT116 -146C>T cells show differential long-range

interaction. 3C-qPCR assay revealed that mutant Tert promoter in HCT116 -146C>T

cells showed significant interaction with the T-INT1 region (Fig. 5H) which was also

the strongest interaction observed in 3C analysis of BLM cells (Fig. 2G).

As summarized in Fig. 5I, reversing -146C>T mutation to -146C wild type in

BLM, A375 and T98G cells causes reduction in GABPA recruitment and loss of

long-range interaction. This is concomitant with reduction in active histone marks,

Pol 2 recruitment, Tert expression and telomerase activity. In contrast, introduction of

-146C>T mutation in HCT116 cells causes increase in GABPA recruitment and

formation of long-range interaction. This is concomitant with increase in active




13

histone marks, Pol 2 recruitment, Tert expression and telomerase activity as compared

to wild type isogenic counterpart. We conclude that -146C>T Tert promoter mutation

could be sufficient to initiate long-range interaction of this promoter and it could also

be sufficient for activating this promoter via epigenetic modifications initiated and

promoted by stabilizing long-range interaction with T-INT1 region of Tert promoter

(Fig. 1B).

Deletion of T-INT1 region abrogates transcription from both -124C>T and -146

C>T mutant Tert promoters

To verify whether mutant Tert promoters are indeed activated via long-range

interaction with T-INT1 region, we created cells wherein we deleted the T-INT1

region while keeping the proximal mutant Tert promoter intact. We also investigated

the generality of our observations by also including a cell line with -124C>T mutation

in these assays. Figure 6A shows the location of mutation site (-146C>T or -124C>T)

on Tert promoter and the location of the T-INT1 region. Putative GABPA motifs in

T-INT1 region are shown as red dots. CRISPR mediated removal of the interacting

region from three cell lines (BLM and A375 cell lines which have -146C>T mutation

in Tert promoter and U251 cell line which has -124C>T mutation in Tert promoter)

led to the generation of respective isogenic lines that do have T-INT1 region (T-INT1

WT) or cells where the T-INT1 region is deleted (T-INT1 KO) (Figure 6A). Genetic

status was confirmed by genotyping PCR as shown in Sup. Fig. 6A. In BLM cells,

upon removal of T-INT1 region, Tert expression and telomerase activity reduced

dramatically (Fig. 6B-C) without any change in GABPA expression (Sup. Fig. 6B).

We observed a significant reduction in active histone mark H3K4Me3 in proximal

Tert promoter (Fig. 6D). Also Pol 2, GABPA and BRD4 recruitment to Tert promoter




14

was also reduced significantly (Fig. 6E-F and Sup. Fig. 6C). Removal of T-INT1

interaction region in A375 was also associated with reduced Tert expression and

telomerase activity (Fig. 6G-H). Active histone mark H3K4Me3 was reduced

significantly in the proximal Tert promoter of A375 (Fig. 6I). Pol 2 and GABPA

recruitment to Tert promoter was also reduced significantly (Fig. 6J-K).

Interestingly, we observed dramatic reduction in Tert expression and

telomerase activity in U251 T-INT1 KO cell line which harbors -124C>T mutation

(Fig. 6L-M). Similar to melanoma cells, deletion of T-INT1 region decreased the

enrichment of H3K4Me3, Pol2 and GABPA in the proximal Tert promoter of U251

cells (Fig. 6N-P)

These results demonstrate that GABPA recruitment to the mutant Tert

promoter enables long-range interaction of proximal Tert promoter with T-INT1

region and facilitates generation of associated epigenetic changes that drive its

transcription. These results also suggest that this is a general mechanism used by both

-124C>T and the -146C>T mutant promoters. Our results are presented in the form of

a model in figure 7.

Discussion

Cancer specific Tert promoter mutations offer an invaluable starting point to

understand the mechanistic basis of activation of the dormant Tert promoter in

cancers. Our study reveals a novel mechanism utilized by GABPA to activate Tert

transcription. Using 3C assay we have shown that GABPA mediates long-range

chromatin interaction to form a stable complex that drives Tert transcription. Reversal

of mutation in Tert promoter or removal of mutant Tert promoter interacting region

(T-INT1) using genome editing results in loss of GABPA binding, depletion of




15

epigenetic marks and reduction of Tert transcription. Interestingly, introduction of -

146C>T Tert promoter mutation in HCT116 cells could specifically enrich histone

marks and enable long-range interaction. Our findings suggest that GABPA binding

to mutant Tert promoter is an initiating and sufficient event to drive the epigenetic

status of Tert promoter.

Introduction of -146C>T and -124C>T Tert promoter mutations in human

embryonic stem cells and their differentiation them into fibroblasts and neural

progenitor cells revealed that these mutations were capable of overcoming epigenetic

silencing (26). Moreover the Tert expression in these cells was comparable to that

found in cancer cells and could significantly delay telomere shortening induced

senescence. Furthermore, the high frequency of mutations in Tert promoter majorly at

two nucleotide positions (-146C>T, -124C>T) strongly implicates them as driver

events, appearing upon tumor initiation or possibly later in tumor development (27,

28).

Human Tert promoter harbors G-rich region of 12 sequential G-tracts,

encompassing three Sp1 binding sites, and has the ability to form multiple G-

quadruplexes. Masking of the Sp1 binding sites by G quadruplex structure is

predicted to produce significant inhibition of Tert promoter activity (29). The G-

quadruplex structure may also have an important role in regulation of mutant Tert

promoter and it is suggested that Tert promoter mutations may have an impact on this

predicted secondary structure and that the complex relationship between secondary

structure and GABP recruitment could also play a role in regulating Tert expression

(11). The complex regulatory crosstalk between long-range interaction and G

quadruplex structure in regulating mutant versus WT Tert promoter needs further

investigation.




16

Furthermore, it would also be interesting to understand what co-factor(s)

cooperate with GABPA or other Ets family members on the -146C>T and the -

124C>T mutant sites. Clearly having the know-how and the ability to target distinct

mechanisms which operate in cancer cells which are driven by mutant Tert promoter

would be a step forward in designing therapeutics against telomerase in cancer.

Targeting mutant Tert promoter specific pathways that do not impinge on the WT

Tert promoter will help in designing drugs that are less toxic and can be taken over

longer term at a higher dose. With the realization that telomerase inhibition could

yield a magic bullet to treat most human cancers of any origin and carrying any

genetic alteration. Many pharma companies developed and tested various versions of

telomerase inhibitors for over the last decade. Many refinements were made and the

most successful inhibitor by Genron was believed to reach the clinic. But this

inhibitor which inhibits enzymatic function of telomerase, failed clinical trials early

last year. Based on the understanding of how mutant Tert promoters operate, a new

set of inhibitors that limit Tert transcription only in cancer cells with -124C>T and -

146C>T mutations could be designed rapidly. Since these new transcriptional

inhibitors will work to limit levels of TERT and hence telomerase (indirectly limiting

the activity) only in cells with mutation, namely the cancer cells, they may not cause

toxicity to stem cells or other normal somatic cells where continued telomerase

activity is necessary for physiology.




17

Material and methods Cell lines and reagents: A375 and HCT116 cell lines were originally purchased from

ATCC and were a gift from Dr. Shang Li (DUKE-NUS Medical School, Singapore).

Fadu cells were obtained from ATCC. BLM and primary melanocytes were a gift

from Dr. Birgitte Lane (Institute of Medical Biology, Singapore), T98G-WT

(CRISPR engineered wild type Tert promoter) was produced previously (18). PC3

was a gift from Dr. Ernesto Guccione (Institute of Molecular and Cell Biology,

Singapore). All cells were maintained in Dulbecco’s Modified Eagle’s Medium

(DMEM) except PC3 that was maintained in RPMI and supplemented with 10% FBS

(Hyclone), penicillin and streptomycin (Gibco) using standard tissue culture

techniques. Cell lines were not authenticated by us.

Genomic DNA isolation and Sanger Sequencing: Genomic DNAs of cell lines were

isolated with tail lysis buffer supplemented with Proteinase K. DNA was precipitated

with isopropanol and Tert promoter was sequenced as described previously (18) .

Reversal of the Tert promoter mutation by CRISPR/Cas9 editing: -146C>T Tert

promoter mutation in BLM, A375 cell lines were converted back to wild type

promoter sequence (-146C) and -146C was mutated to -146C>T in HCT116 cells as

described previously (18). Briefly, guide RNA specific to Tert promoter was cloned

into pX458 (GFP) plasmid and was co-transfected with repair template (130bp)

containing wild type (-146C) or mutant (-146C>T) Tert promoter sequence. GFP

positive cells were seeded into 96 well plates (1 cell/well) by FACS after 48h and

each clone was screened by PCR and Sanger sequencing.

Tert interaction region removal by CRISPR/Cas9 editing: pX458-GFP plasmid

was modified by removing Cas9 and GFP with EcorI-AgeI restriction enzymes and

inserted Ds-Red monomer in order to prevent off-target effect of excess Cas9 enzyme




18

in the cells (30) and also to be able to observe transfection efficiency of the both

plasmids. Guide-RNA-1 CACCGCCACAAGGAATGCCGTACAT and Guide-

RNA-2 CACCGCCGGCGTGGAGCAATTCCAC targeting Tert interaction region

(Chr5:1,556,087-1,558,758) were cloned into pX458 (GFP) and pX458 (Ds-Red)

plasmids respectively. Cells were transfected in 6-well plate by X-tremeGENE 9

transfection reagent (Roche). GFP and Ds-Red positive cells were sorted into 96 well

plates (1 cell/well) after 48h by FACS and each clone was genotyped by PCR with

primers surrounding T-INT1 region Forward: GTCTGCATGCAATGCTGTC

reverse: GGGGACATTTATGTCTTCTGC. T-INT1 WT PCR product was ~4530bp

and T-INT1 KO PCR product was 550bp.

RNA-Sequencing: RNA-sequencing library was prepared from two replicates of

BLM6 and BLM14 cell line by Illumina Truseq Total RNA sequencing kit according

to manufacturer’s instructions.

RNA-Sequencing Analysis: Raw reads were aligned to the human genome hg19 by

Tophat2. Differential gene expression was performed by Cufflinks and Cuffdiff with

default parameters.

RNA interference and gene expression: For siRNA treatment, cells were transfected

when they reached ~ 60% confluency with si-Control (Dharmacon; D001810-10), si-

Gabpa (Dharmacon; L011662) or si-BRD4 (Dharmacon; L-004937) using X-

tremeGENE siRNA transfection reagent (Roche) according to manufacturer’s

recommendations. Medium was replaced with fresh medium after 8h of incubation

and cells were harvested 24h-48h post-transfection. For gene expression analysis,

RNAs and cDNAs were prepared as described previously (31).

Chromatin Immunoprecipitation (ChIP) assays: ChIP was performed as described

previously (32). Anti-H3K4Me3 (Millipore; 04-745), anti-H3K9Ac (Millipore; 07-




19

352), anti-H3K14Ac (Millipore; 07-353), anti-Pol2 (Santa-Cruz; sc-899), anti-

GABPA (Santa-Cruz; sc-22810), anti-BRD4 (Bethyl; A301-985A) and IgG (Santa-

Cruz) antibodies were used for the immunoprecipitation. After elution, chip eluate

was used for ChIP-qPCR with primers (33) targeting TSS, 0.8kb, 1kb, 2.5kb and 5kb

upstream regions of Tert gene and/or Tert interaction region. Primers were indicated

in Sup. Table 3.

Circular Chromosome Capture Assay (4C): 4C was performed as described

previously (34). Briefly, 107 cells were fixed with 1% formaldehyde for 10 min and

nuclei pellets were isolated after cell lysis with cold lysis buffer (50mM Tris-Hcl pH

7.5, 150mM NaCl, 5mM EDTA, 0.5% NP-40, 1% Triton X-100) supplemented with

protease inhibitors. First step digestion was performed over-night at 37°C with 200

unit HindIII enzyme. Digestion efficiency was measured by RT-qPCR with HindIII

site specific primers. After phenol-chloroform extraction, DNA was ligated over-night

at 16°C by T4 DNA ligase (Fermentas). Following de-crosslinking, DNA was

processed for second digestion with 50 units of DpnII enzyme for over-night at 37°C.

After final ligation 4C template DNAs were quantified by Qubit dsDNA High

sensitivity kit (Thermo Fischer) and preceded for library preparation for sequencing

using Tert promoter specific primers (Sup. Table 3) with Illumina Nextera adapters.

4C sequencing analysis: The quality of the fastq files were evaluated using FastQC

v0.11.3 (35). Illumina Nextera adaptor sequences were removed using scythe v0.991

(36). Tagdust2.3 was used to extract reads that were sandwiched between the bait

region (TERT-promoter + HindIII) and a DpnII cut site (37). The extracted reads

were aligned to the hg19 genome using bowtie2 (38) with very sensitive parameters in

unpaired mode. The aligned reads were filtered for mapping qualities of > 30. r3CSeq

(39) was used in batch mode to call interactions for A375, BLM cells. Plots were




20

generated by FourCSeq of the differential intra-chromosomal interactions of the Tert

promoter between replicates of BLM6 CRISPR mutant and BLM14 CRISPR wild

type (40). The green line shows the distance dependent fit and the blue dashed line

indicates the fit of z-score > 2. Interactions detected by z-score > 2 (p-adjusted value

< 0.05) for at least one replicate are shown as red dots. Fragments not called as

interactions and that do not show significant change between conditions are shown as

black dots. The calculated log2 fold change is shown above the Hg19 Refseq genes in

the regions 1 megabase from the Tert promoter.

Chromosome Conformation Capture Assay (3C): 3C was performed as described

previously (41). Cells were processed in the same way as described in 4C. Following

HindIII digestion and ligation, 3C template DNAs were quantified by Qubit dsDNA

High sensitivity kit (Thermo Fischer). In order to optimize real time PCRs and to

estimate minimal amount of 3C template for quantification in a linear range, we

prepared control template including equal amounts of target regions that we obtained

in 4C analysis. These regions were amplified by region specific primers and purified

from gel and mixed in equimolar amounts. After digestion of these fragments with

HindIII, fragments were ligated by T4 DNA ligase. 3C DNA templates were used for

normalization of 3C-qPCRs. 3C-qPCR reactions were performed by Sybr-Greener kit

(Invitrogen) and samples were normalized by the levels of Tert promoter region 3C-

qPCR primers were indicated in Sup. Table3.

Real Time telomeric repeat amplification protocol (TRAP): Real time TRAP

assay was performed as described previously (42) .

Colony formation assay: Colony formation assay was performed by crystal violet

BLM6 and BLM14 cells were transfected with siControl, siGABPA and siBRD4.

After 24h 500 cells were seeded into 6 well plate. Culture media was refreshed every




21

two days and after 7 days cells were fixed with 75% ethanol for 30 min and stained

with 0.2% crystal violet dye.

Immunofluorescence: ALT-associated PML bodies were visualized via TRF2 and

PML immunofluorescence staining. Cells were grown on chamber slides (Millipore

EZ slides) and fixed with 4% paraformaldehyde for 10 minutes at room temperature.

After washing with PBS, cells were permeabilized with 0.2% Triton X-100 solution

in PBS for 5 minutes at room temperature and were blocked with PBS supplemented

with 0.2% Triton X-100 and 1% BSA (blocking buffer) for 30 minutes at room

temperature. Following incubation, cells were incubated with primary antibodies

TRF2 (Millipore-05-521) and PML (Santa-Cruz-sc-5621), 1/200 and 1/150 dilutions

respectively, in blocking buffer over night at 4°C. Cells were washed 4 times with

blocking buffer for 8 minutes and incubated with secondary antibodies AF488 and

AF555 (1/2000 dilution) (Invitrogen A11001 and A21428) for 1h at room

temperature. After 4 times washing, image acquisition was performed with Zeiss

LSM800, Plan-Apochromat 63x/1.40 aperture of the objective lenses.

Statistical Analysis: Student’s t-test (two-tailed) was performed to determine the

significance of difference for ChIP-qPCR qPCR and RT-TRAP experiments. Results

of each ChIP, gene expression, 4C, 3C assays were obtained from at least two or three

independent experiments as indicated in the figure legends.

Accession Numbers: All data has been uploaded to GEO (GSE77265).

Acknowledgments

S.C.A and B.U. are supported by the SINGA scholarship. We thank the Agency for Science Technology and Research, Singapore (A*Star) for funding and support to the V.T. laboratory. We thank Phua Qian Hua for her help during the genotyping process and Dr. Shang Li (DUKE-NUS Medical School, Singapore) for the southern blot telomere length experiment.




22

Grant Support This work supported by the core budget from Institute of Molecular and Cell Biology (IMCB), Singapore. P.B. and M.J.F are supported by the National Research Foundation (NRF) Singapore through an NRF Fellowship awarded to M.J.F (NRF-NRFF2012-054), and NTU school of biological sciences start-up funds awarded to M.J.F., as well as by funding given to the Cancer Science Institute, NUS, by the NRF and the Ministry of Education, Singapore under the Research Center of Excellence funding, and the RNA Biology Center at the Cancer Science Institute of Singapore, NUS, as part of funding under the Singapore Ministry of Education’s Tier 3 grants. References 1. Moyzis RK, Buckingham JM, Cram LS, Dani M, Deaven LL, Jones MD, et al. A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proceedings of the National Academy of Sciences of the United States of America. 1988;85:6622-6. 2. Blackburn EH. The end of the (DNA) line. Nature structural biology. 2000;7:847-50. 3. O'Sullivan RJ, Karlseder J. Telomeres: protecting chromosomes against genome instability. Nat Rev Mol Cell Biol. 2010;11:171-81. 4. Yi X, Shay JW, Wright WE. Quantitation of telomerase components and hTERT mRNA splicing patterns in immortal human cells. Nucleic Acids Res. 2001;29:4818-25. 5. Shay JW, Wright WE. Senescence and immortalization: role of telomeres and telomerase. Carcinogenesis. 2005;26:867-74. 6. Horn S, Figl A, Rachakonda PS, Fischer C, Sucker A, Gast A, et al. TERT promoter mutations in familial and sporadic melanoma. Science. 2013;339:959-61. 7. Huang FW, Hodis E, Xu MJ, Kryukov GV, Chin L, Garraway LA. Highly recurrent TERT promoter mutations in human melanoma. Science. 2013;339:957-9. 8. Killela PJ, Reitman ZJ, Jiao Y, Bettegowda C, Agrawal N, Diaz LA, Jr., et al. TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal. Proc Natl Acad Sci U S A. 2013;110:6021-6. 9. Heidenreich B, Nagore E, Rachakonda PS, Garcia-Casado Z, Requena C, Traves V, et al. Telomerase reverse transcriptase promoter mutations in primary cutaneous melanoma. Nat Commun. 2014;5:3401. 10. Akincilar SC, Unal B, Tergaonkar V. Reactivation of telomerase in cancer. Cell Mol Life Sci. 2016;73:1659-70. 11. Bell RJ, Rube HT, Kreig A, Mancini A, Fouse SD, Nagarajan RP, et al. Cancer. The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer. Science. 2015;348:1036-9. 12. Sui X, Kong N, Wang Z, Pan H. Epigenetic regulation of the human telomerase reverse transciptase gene: A potential therapeutic target for the treatment of leukemia (Review). Oncol Lett. 2013;6:317-22.




23

13. Stern JL, Theodorescu D, Vogelstein B, Papadopoulos N, Cech TR. Mutation of the TERT promoter, switch to active chromatin, and monoallelic TERT expression in multiple cancers. Genes Dev. 2015;29:2219-24. 14. Hollenhorst PC, McIntosh LP, Graves BJ. Genomic and biochemical insights into the specificity of ETS transcription factors. Annu Rev Biochem. 2011;80:437-71. 15. Skalicky JJ, Donaldson LW, Petersen JM, Graves BJ, McIntosh LP. Structural coupling of the inhibitory regions flanking the ETS domain of murine Ets-1. Protein Sci. 1996;5:296-309. 16. Cowley DO, Graves BJ. Phosphorylation represses Ets-1 DNA binding by reinforcing autoinhibition. Genes Dev. 2000;14:366-76. 17. Chinenov Y, Henzl M, Martin ME. The alpha and beta subunits of the GA-binding protein form a stable heterodimer in solution. Revised model of heterotetrameric complex assembly. J Biol Chem. 2000;275:7749-56. 18. Li Y, Zhou QL, Sun W, Chandrasekharan P, Cheng HS, Ying Z, et al. Non-canonical NF-kappaB signalling and ETS1/2 cooperatively drive C250T mutant TERT promoter activation. Nat Cell Biol. 2015;17:1327-38. 19. Nault JC, Mallet M, Pilati C, Calderaro J, Bioulac-Sage P, Laurent C, et al. High frequency of telomerase reverse-transcriptase promoter somatic mutations in hepatocellular carcinoma and preneoplastic lesions. Nat Commun. 2013;4:2218. 20. Barutcu AR, Lajoie BR, McCord RP, Tye CE, Hong D, Messier TL, et al. Chromatin interaction analysis reveals changes in small chromosome and telomere clustering between epithelial and breast cancer cells. Genome Biol. 2015;16:214. 21. Zhao Z, Tavoosidana G, Sjolinder M, Gondor A, Mariano P, Wang S, et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nat Genet. 2006;38:1341-7. 22. Bryan TM, Englezou A, Gupta J, Bacchetti S, Reddel RR. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J. 1995;14:4240-8. 23. Mathelier A, Fornes O, Arenillas DJ, Chen CY, Denay G, Lee J, et al. JASPAR 2016: a major expansion and update of the open-access database of transcription factor binding profiles. Nucleic acids research. 2016;44:D110-5. 24. Dey A, Chitsaz F, Abbasi A, Misteli T, Ozato K. The double bromodomain protein Brd4 binds to acetylated chromatin during interphase and mitosis. Proc Natl Acad Sci U S A. 2003;100:8758-63. 25. Bhadury J, Nilsson LM, Muralidharan SV, Green LC, Li Z, Gesner EM, et al. BET and HDAC inhibitors induce similar genes and biological effects and synergize to kill in Myc-induced murine lymphoma. Proceedings of the National Academy of Sciences of the United States of America. 2014;111:E2721-30. 26. Chiba K, Johnson JZ, Vogan JM, Wagner T, Boyle JM, Hockemeyer D. Cancer-associated TERT promoter mutations abrogate telomerase silencing. Elife. 2015;4. 27. Vinagre J, Almeida A, Populo H, Batista R, Lyra J, Pinto V, et al. Frequency of TERT promoter mutations in human cancers. Nat Commun. 2013;4:2185.




24

28. Bell RJ, Rube HT, Xavier-Magalhaes A, Costa BM, Mancini A, Song JS, et al. Understanding TERT Promoter Mutations: A Common Path to Immortality. Mol Cancer Res. 2016;14:315-23. 29. Palumbo SL, Ebbinghaus SW, Hurley LH. Formation of a unique end-to-end stacked pair of G-quadruplexes in the hTERT core promoter with implications for inhibition of telomerase by G-quadruplex-interactive ligands. J Am Chem Soc. 2009;131:10878-91. 30. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8:2281-308. 31. Koh CM, Khattar E, Leow SC, Liu CY, Muller J, Ang WX, et al. Telomerase regulates MYC-driven oncogenesis independent of its reverse transcriptase activity. J Clin Invest. 2015;125:2109-22. 32. Ghosh A, Saginc G, Leow SC, Khattar E, Shin EM, Yan TD, et al. Telomerase directly regulates NF-kappaB-dependent transcription. Nat Cell Biol. 2012;14:1270-81. 33. Zhao Y, Cheng D, Wang S, Zhu J. Dual roles of c-Myc in the regulation of hTERT gene. Nucleic acids research. 2014;42:10385-98. 34. Splinter E, de Wit E, van de Werken HJ, Klous P, de Laat W. Determining long-range chromatin interactions for selected genomic sites using 4C-seq technology: from fixation to computation. Methods. 2012;58:221-30. 35. Andrews S. FastQC: a quality control tool for high throughput sequence data. 2010; Available from: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ 36. Buffalo V. Scythe. 2012; Available from: https://github.com/vsbuffalo/scythe 37. Lassmann T. TagDust2: a generic method to extract reads from sequencing data. BMC Bioinformatics. 2015;16:24. 38. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9:357-9. 39. Thongjuea S, Stadhouders R, Grosveld FG, Soler E, Lenhard B. r3Cseq: an R/Bioconductor package for the discovery of long-range genomic interactions from chromosome conformation capture and next-generation sequencing data. Nucleic Acids Res. 2013;41:e132. 40. Klein FA, Pakozdi T, Anders S, Ghavi-Helm Y, Furlong EE, Huber W. FourCSeq: analysis of 4C sequencing data. Bioinformatics. 2015;31:3085-91. 41. Hagege H, Klous P, Braem C, Splinter E, Dekker J, Cathala G, et al. Quantitative analysis of chromosome conformation capture assays (3C-qPCR). Nat Protoc. 2007;2:1722-33. 42. Akincilar SC, Low KC, Liu CY, Yan TD, Oji A, Ikawa M, et al. Quantitative assessment of telomerase components in cancer cell lines. FEBS Lett. 2015;589:974-84.




25

Figure Legends Figure 1. Mutant Tert promoter displays active histone marks and distinct long-range interactions: (A) Cell lines that were used in the study with their origin and

Tert promoter status. WT refers to wild type Tert promoter; WT-ALT refers to wild

type Tert promoter with alternate lengthening of telomeres. (B) Schematic view of

Tert promoter. TSS represents the transcription start site. Tert promoter mutations

were indicated as -146C>T and -124C>T. Tert promoter is shown in three parts

including proximal promoter (up to -1kb), distal promoter (-1kb to -5kb) and long

distance elements. (C) ChIP was performed in A375 and BLM melanoma cells

against histone marks (H3K4Me3 and H3K9Ac). (D) ChIP was performed in primary

melanocytes, Fadu and PC3 cell lines against histone marks (H3K4Me3 and

H3K9Ac). Graph shows qPCR analysis with % Input obtained across various regions

of Tert promoter with the distances indicated in boxes below X-axis. Error bars

indicate the mean ± SD of the two independent experiments. (E) 4C sequencing for

long-range interactions of Tert promoter. Plot generated by r3CSeq of chromatin

interactions of the Tert promoter for A375 and BLM cell lines. The top panel shows

the Refseq genes in chromosome 5. The line plots show detected interactions 500 kb

upstream and downstream of the Tert promoter. X axis indicates the distance from

Tert promoter which was shown as ‘0’. Y axis was the read counts for each

interaction. Different shades of red and blue color dots indicate positive interactions

for A375 and BLM cells (average of two replicates) respectively. Darker color

indicates more significant interactions according to q values indicated in the legend. P

values were calculated by two tailed Student’s t test method.

Figure 2. Reversing the Tert promoter mutation to wild-type reverses the active chromatin marks and alters long-range chromatin interactions. (A) CRISPR/Cas9 mediated reversal strategy of mutated -146C>T residue (shown as red

color) to wild type -146C residue (shown as orange color) by repair template

harboring -146C residue. We obtained BLM cells which have undergone CRISPR

process and are mutant for -146C residue and are labeled as BLM6. BLM cells which

have undergone CRISPR process and mutated back to wild-type for -146T residue to -




26

146C residue are labeled as BLM14. (B) DNA chromatograms spanning the Tert

promoter region in BLM6 and BLM14 are shown. ChIP was performed in BLM6 and

BLM14 cells against histone marks (H3K4Me3 and H3K9Ac). Graph shows qPCR

analysis with % Input obtained across various regions of Tert promoter with distances

indicated in boxes below x-axis. Error bars indicate the mean ± SD of the two

independent experiments. P values were calculated by two tailed Student’s t test

method. (C-E) Plot generated by FourCSeq of the differential intra-chromosomal

interactions of the Tert promoter between replicates of BLM6 and BLM14. The green

line shows the distance dependent fit and the blue dashed line indicates the fit of z-

score > 2. Interactions detected by z-score > 2 (p-adjusted value < 0.05) for at least

one replicate are shown as red dots. Fragments not called as interactions and that do

not show significant change between conditions are shown as black dots. (E) The

calculated log2 fold change is shown above the hg 19 Refseq genes in the regions 1

megabase from the Tert promoter. (F) Quantifications of 5 interactions, obtained from

(C-E), were measured by 3C-qPCR in BLM6 cells. (G) Quantification of Tert

promoter interaction with 300kb upstream (chr5:1,556,087-1,558,758) DNA region

(T-INT1) measured by 3C-qPCR in BLM6 and BLM14 cells. Error bars indicate the

mean ± SD of the 3 independent experiments. P values were calculated by two tailed

Student’s t test method.

Figure 3. Silencing GABPA expression dampens the active chromatin marks as well as long-range interactions in mutated Tert promoter. (A-B) ChIP was

performed in BLM6 and BLM14 cells against GABPA and Pol 2 followed by qPCR

with primers specific for Tert promoter region proximal to TSS. Graph shows qPCR

results with fold recruitment over IgG or % input method as indicated in y-axis. (C) GABPA expression analysis in BLM6 cells transfected siControl (siCont) and

siGABPA. (D) ChIP was performed in BLM6 cells transfected with siCont and

siGABPA against IgG, GABPA and Pol 2 followed by qPCR with primers specific

for Tert promoter region proximal to TSS. (E) Tert expression analysis in BLM6 cells

transfected with siCont and siGABPA. (F) ChIP was performed in BLM6 cells

transfected siCont and siGABPA against histone marks (H3K4Me3 and H3K9Ac)

followed by qPCR with primers specific for Tert promoter region indicated in boxes

below x-axis. (G) Quantification of Tert promoter interaction with 300kb upstream

(chr5:1,556,087-1,558,758) DNA region measured by 3C-qPCR in BLM6 cells upon




27

GABPA knockdown. (H) ChIP was performed in BLM6 and BLM14 cells against

BRD4 followed by qPCR with primers specific for Tert promoter region proximal to

TSS. (I) ChIP was performed in BLM6 cells transfected with siControl (siCont) and

siGABPA against BRD4 followed by qPCR with primers specific for Tert promoter

region proximal to TSS. (J) BRD4 expression analysis in BLM6 and BLM14 cells

transfected siCont and siBRD4. (K) GABPA expression analysis in BLM6 and 14

cells transfected with siCont and siBRD4. (L) ChIP was performed against IgG and

BRD4 in BLM6 cells followed by qPCR with primers specific for GABPA promoter.

(M) Tert expression analysis in BLM6 and BLM14 cells transfected with siCont and

siBRD4. (N) ChIP was performed against histone marks (H3K4Me3 and H3K9Ac)

followed by qPCR with primers specific for proximal Tert promoter region in BLM6

cells transfected with siCont and siBRD4. (O) Quantification of Tert promoter

interaction with 300kb upstream T-INT1 region measured by 3C-qPCR in BLM6 and

BLM14 cells with BRD4 knockdown. Error bars indicate the mean ± SD of the two

independent experiments. P values were calculated by two tailed Student’s t test

method.

Figure 4: Reversing the Tert promoter mutation to wild type in A375 melanoma and T98G glioblastoma cell lines reduces the active chromatin marks and affects long-range chromatin interactions. We obtained A375 cells which have undergone

CRISPR process and are mutant for -146C residue and are labeled as A375 -146C>T.

A375 cells which have undergone CRISPR process and mutated back to wild type for

-146T residue to -146C residue are labeled as A375 -146C . (A) Graph shows qPCR

analysis of Tert expression normalized to actin levels. (B) Graph shows telomerase

activity (TRAP) in A375 -146C>T and A375 -146C cells. (C-F) ChIP was performed

in A375 -146C>T and A375 -146C cells against histone marks (H3K4Me3 and

H3K9Ac), Pol2, GABPA and BRD4. Graph shows qPCR analysis with primers

specific to Tert promoter region proximal to TSS. Results were calculated with %

input or fold recruitment over IgG as indicated in y-axis. (G) 3C-qPCR assay was

performed in A375 -146C>T and A375 -146C cells. Quantification of Tert promoter

interaction with T-INT1 region is shown. (H-J) ChIP was performed in T98G -

146C>T and T98G -146C cells against histone marks (H3K4Me3 and H3K9Ac), Pol2

and GABPA. Graph shows qPCR analysis with % input obtained with primers

specific to Tert promoter region proximal to TSS. (K) 3C-qPCR assay was performed




28

in T98G -146C>T and T98G -146C cells. Quantification of Tert promoter interaction

with chr5:1,556,087-1,558,758 region (T-INT1) is shown. n=3 for all the

experiments, error bars indicate mean±SD of 3 independent experiments. P values

were calculated by student’s t test method.

Figure 5: Introducing -146C>T Tert promoter mutation in HCT116 cells increases the active chromatin marks and enables long-range chromatin interaction. (A) CRISPR/Cas9 mediated conversion of -146C residue (orange color)

to mutant -146C>T residue (red color) by repair template harboring -146T nucleotide

is shown. We obtained HCT116 -146C cells which have undergone CRISPR process

and are wild type for -146C residue and are labeled as HCT116 -146C. HCT116 cells

which have undergone CRISPR process and are mutated for -146C residue to -146T

residue and are labeled as HCT116 -146C>T. (B) Graph shows qPCR analysis of

Tert expression normalized to actin levels. (C) Graph shows telomerase activity

(TRAP) in HCT116 -146C and HCT116 -146C>T cells. (D-G) ChIP was performed

in HCT116 -146C and HCT116 -146C>T cells against histone mark H3K4Me3,

H3K9Ac, Pol 2, GABPA and BRD4. Graph shows qPCR analysis with % input

obtained with primers specific to Tert promoter region proximal to TSS. (H) 3C-

qPCR assay was performed in HCT116 -146C and HCT116 -146C>T cells.

Quantification of Tert promoter interaction with T-INT1 region is shown. n=3 for all

the experiments, error bars indicate mean±SD of 3 independent experiments. P values

were calculated by student’s t test method. (I) Figure summarizes the results of

GABPA enrichment, formation of long-range interaction, enrichment of active

histone marks and Pol2, Tert expression and telomerase activity that were obtained

from isogenic cell lines generated by CRISPR/Cas9 editing. “↑” indicates increase

and “↓” indicates decrease.

Figure 6: Removal of T-INT1 region in melanoma and glioblastoma cell lines reverses the active chromatin marks and decreases Tert expression and telomerase activity. (A) Removal of T-INT1 region strategy in -146C>T mutant cell

line is shown by CRISPR/Cas9 editing (left). Removal of T-INT1 region strategy in -

124C>T mutant cell line is shown by CRISPR/Cas9 editing (right). Red dots indicate

putative GABPA motifs in T-INT1 region. We obtained T-INT1 WT cells which have

undergone CRISPR process and are wild type for Chr5:1,556,087-1,558,758 region




29

(T-INT1) are labeled as T-INT1 WT. T-INT1 KO cells which have undergone

CRISPR process and interaction region Chr5:1,556,087-1,558,758 was removed are

labeled as T-INT1 KO. (B) Graph shows qPCR analysis of Tert expression

normalized to actin levels in BLM cells. (C) Graph shows telomerase activity (TRAP)

in BLM T-INT WT and BLM T-INT1 KO cells. (D-F) ChIP was performed in BLM

T-INT1 WT and BLM T-INT1 KO cells against H3K4Me3, Pol2 and GABPA

followed by qPCR with primers specific to Tert promoter region proximal to TSS.

Graph shows qPCR results with % input method. (G) Graph shows qPCR analysis of

Tert expression normalized to actin levels in A375 T-INT1 WT and A375 T-INT1

KO cells. (H) Graph shows telomerase activity (TRAP) in A375 T-INT1 WT and

A375 T-INT1 KO cells. (I-J) ChIP was performed in A375 T-INT1 WT and A375 T-

INT1 KO cells against H3K4Me3 and Pol2 followed by qPCR with primers specific

to Tert promoter region proximal to TSS. Graph shows qPCR results with % input

method. (K) ChIP was performed in A375 T-INT1 WT and A375 T-INT1 KO cells

against GABPA followed by qPCR with primers specific to Tert promoter region

proximal to TSS. Results were analyzed with fold recruitment over IgG with primers

specific to Tert promoter region proximal to TSS. (L) Graph shows qPCR analysis of

Tert expression normalized to actin levels in U251 T-INT1 WT and U251 T-INT1

KO cells. (M) Graph shows telomerase activity (TRAP) in U251 T-INT1 WT and

U251 T-INT1 KO cells. (N-O) ChIP was performed in U251 T-INT1 WT and U251

T-INT KO cells against H3K4Me3 and Pol2 followed by qPCR with primers specific

to Tert promoter region proximal to TSS. Results were analyzed with % input

method. (P) ChIP was performed in U251 T-INT1 WT and U251 T-INT1 KO cells

against GABPA followed by qPCR with primers specific to Tert promoter region

proximal to TSS and results were analyzed with fold recruitment over IgG. N=3 for

all the experiments, error bars indicate mean±SD of 3 independent experiments. P

values were calculated by student’s t-test method.

Figure 7: Molecular mechanism of Tert reactivation by cancer specific Tert promoter mutations. Cells with -146C>T and -124C>T mutations exhibit GABPA

motif that leads to enrichment of active histone marks in the Tert promoter and

formation of a novel intra-chromosomal long-range interaction, between Tert

promoter and chr5:1,556,087-1,558,758 (T-INT1) region, through GABPA

heterodimerization. These epigenetic features drive transcriptional activation of Tert




30

gene by recruitment of Pol2 to the promoter. CRISPR/Cas9 editing of mutant Tert

promoter to wild type, abrogates long range interaction, decreases active histone mark

occupancy in the proximal Tert promoter which causes dramatic reduction of Tert

gene expression. Telomerase active cells with wild type Tert promoter employs

moderate levels of active histone marks which is sufficient to drive transcription of

Tert. Introduction of promoter mutation to these cells increases enrichment of active

histone marks on the proximal Tert promoter and mediates long-range interaction that

enhances expression of Tert gene.




A

C -146C>T Tert promoter

E

Fig1

D -146C Tert promoter

Distal Tert promoter

ATG TSS

-146C>T -78 +1 -2500 -5000 -124C>T

Long Distance Elements

-1000 -800

Proximal Tert promoter

Cell Line Cancer Type Promoter Status

BLM Melanoma -146C>T

A375 Melanoma -146C>T

T98G Glioblastoma -146C>T

U251 Glioblastoma -124C>T

HCT116 Colon WT

Fadu Head and Neck WT

PC3 Prostate WT

HeLa Cervix WT

P.Melanocytes WT

U2OS Osteosarcoma WT-ALT

B




Fig2 A

ATG TSS -146C>T

-78 +1 -2500 -5000 -124


ATG TSS -146C -78 +1 -2500 -5000 -124


Repair Template

-1000 -800

-1000 -800

CRISPR/Cas9

Editing

BLM6 (-146C>T Tert Promoter)

BLM14 (-146C Tert Promoter)

G

C

D

E

F

T-I

NT

1

B




Fig3

Tert Expression E

A Anti-GABPA

Fo

ld r

ec

ruit

men

t C

GABPA Expression

Fo

ld C

ha

ng

e

F Tert Promoter

D Tert Promoter

G

Fo

ld In

tera

cti

on

Ch

an

ge

3C Assay

Anti-BRD4

Fo

ld r

ecru

itm

en

t

H Anti-BRD4 I Brd4 Expression

Fo

ld C

han

ge

Fo

ld In

tera

cti

on

Ch

an

ge

3C Assay O Tert Expression M

Fo

ld C

ha

ng

e

L GABPA promoter

% I

np

ut

GABPA Expression K F

old

Ch

an

ge

J

Anti-Pol2

Tert Promoter

B

N




A B C

D E F G

H I J K

Tert Expression

Fig4 Anti-H3K4Me3 – Anti-H3K9Ac

Anti-Pol2 Anti-GABPA Anti-BRD4 3C Assay

Anti-GABPA Anti-Pol2 3C Assay

TRAP Assay

A375

-146C>T

A375

-146C

T98G

-146C>T

T98G

-146C

α-H3K4Me3 α-H3K9Ac

Anti-H3K4Me3 – Anti-H3K9Ac

α-H3K4Me3 α-H3K9Ac

A375 -146C>T

A375 -146C

A375

-146C>T A375

-146C

A375

-146C>T A375

-146C

A375

-146C>T A375

-146C

T98G

-146C>T

T98G

-146C

T98G

-146C>T

T98G

-146C

A375

-146C>T

A375

-146C

A375

-146C>T

A375

-146C




Fig5

B C D

E F G H

Tert Expression TRAP Assay Anti-H3K4Me3 – Anti-H3K9Ac

Anti-Pol2 Anti-GABPA Anti-BRD4 3C Assay

HCT116

-146C>T

HCT116

-146C α-H3K4Me3 α-H3K9Ac

HCT116 -146C>T

HCT116 -146C

A ATG TSS -146C -78 +1 -2500 -5000 -124


ATG TSS -146C>T -78 +1 -2500 -5000 -124


Repair Template

-1000 -800

-1000 -800

HCT116

-146C>T

HCT116

-146C

HCT116

-146C>T

HCT116

-146C

HCT116

-146C>T

HCT116

-146C HCT116

-146C>T

HCT116

-146C

HCT116

-146C>T

HCT116

-146C

CRISPR/Cas9

Editing

Cell

Line

Cancer

Type

Promoter

Status

Genome

Editing

GABPA

Enrichment

Long Range

Interaction

Active

Histone

Marks

Pol2

Enrichment

Tert

Expression

Telomerase

Activity

BLM Melanoma -146C>T -146C ↓ ↓ ↓ ↓ ↓ ↓

A375 Melanoma -146C>T -146C ↓ ↓ ↓ ↓ ↓ ↓

T98G Glioblastoma -146C>T -146C ↓ ↓ ↓ ↓ ↓ ↓

HCT116 Colon -146C -146C>T ↑ ↑ ↑ ↑ ↑ ↑

I

Upon Genome Editing Research.

on June 20, 2018. © 2016 American Association for Cancercancerdiscovery.aacrjournals.org Downloaded from



Fig6

Tert Expression Anti-H3K4Me3 Anti-Pol2 Anti-GABPA

Tert Expression TRAP Assay Anti-H3K4Me3 Anti-Pol2 Anti-GABPA

A

B C D E F

G H I J K

L

TRAP Assay

Tert Expression

BLM

T-INT1

KO

BLM

T-INT1

WT

TRAP Assay Anti-H3K4Me3 Anti-Pol2 Anti-GABPA

M N O P

ATG TSS

-146C>T -78 +1 -2500 -5000

Long Distance

Elements

ATG TSS -146C>T -78 +1 -2500 -5000 -1000 -800

-1000 -800

Chr5:

1,556,087

Chr5:

1,558,858

T-INT1 region

Multiple

GABPA

motif

CRISPR/Cas9

Interaction

Region

Removal

ATG TSS

-124C>T -78 +1 -2500 -5000

Long Distance

Elements

ATG TSS -124C>T -78 +1 -2500 -5000

Long Distance

Elements

-1000 -800

-1000 -800

Chr5:

1,556,087

Chr5:

1,558,858

T-INT1 region

Multiple

GABPA

motif

CRISPR/Cas9

Interaction

Region

Removal

Long Distance

Elements

BLM

T-INT1

KO

BLM

T-INT1

WT

BLM

T-INT1

KO

BLM

T-INT1

WT

BLM

T-INT1

KO

BLM

T-INT1

WT

BLM

T-INT1

KO

BLM

T-INT1

WT

A375

T-INT1

KO

A375

T-INT1

WT

A375

T-INT1

KO

A375

T-INT1

WT

A375

T-INT1

KO

A375

T-INT1

WT

A375

T-INT1

KO

A375

T-INT1

WT

A375

T-INT1

KO

A375

T-INT1

WT

U251

T-INT1

KO

U251

T-INT1

WT

U251

T-INT1

KO

U251

T-INT1

WT

U251

T-INT1

KO

U251

T-INT1

WT

U251

T-INT1

KO

U251

T-INT1

WT

U251

T-INT1

KO

U251

T-INT1

WT




Fig7

1,556,087 1,558,858 1,295,250

Chr 5

Wild-Type Tert promoter

1,556,087 1,558,858 1,295,250

Chr 5

Wild-Type Tert promoter

GABPA

CRISPR Editing -146C>T to -146C

CRISPR Editing -146C to -146C>T

Reduced Recruitment

Active Histone Mark

GABPA GABPA

1,556,087

1,558,858

1,295,250

Chr 5

Mutant Tert promoter

GABPA GABPA

1,556,087

1,558,858

1,295,250

Chr 5

Mutant Tert promoter

GABPA




Published OnlineFirst September 20, 2016.Cancer Discov Semih Akincilar, Ekta Khattar, Priscilla Li Shan Boon, et al. activationLong-range chromatin interactions drive mutant Tert promoter

Updated version

10.1158/2159-8290.CD-16-0177doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerdiscovery.aacrjournals.org/content/suppl/2016/09/17/2159-8290.CD-16-0177.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerdiscovery.aacrjournals.org/content/early/2016/09/17/2159-8290.CD-16-0177To request permission to re-use all or part of this article, use this link



http://cancerdiscovery.aacrjournals.org/lookup/doi/10.1158/2159-8290.CD-16-0177

http://cancerdiscovery.aacrjournals.org/content/suppl/2016/09/17/2159-8290.CD-16-0177.DC1

http://cancerdiscovery.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerdiscovery.aacrjournals.org/content/early/2016/09/17/2159-8290.CD-16-0177


long-range chromatin interactions drive mutant tert...

Documents