methylation pattern of mgmt gene in relation to age, smoking

1 Genetic Engineering and Biotechnology Journal, Volume 2010: GEBJ-8

http://astonjournals.com/gebj

Methylation Pattern Of MGMT Gene In Relation To Age, Smoking, Drinking And Dietary Habits As Epigenetic Biomarker In Prostate Cancer Patients

Sukhjeet Sidhu1, *Jagdeep S Deep2, R C Sobti3, V L Sharma3, Hitender Thakur3

1Head, Department of Biotechnology, SUSCET, Tangori, Mohali (Pb), India 2Indian Institute of Science Education & Research (IISER), Mohali (Pb), MGSIPA Complex, Sector-26, Chandigarh, India

3Department of Biotechnology, Panjab University, Chandigarh, India

*Correspondence to: Jagdeep S Deep, [email protected], [email protected] Published online: June 13, 2010

Abstract

Epigenetic control of gene transcription is an important step for normal human development and cellular differentiation. Although alterations in DNA methylation pattern is a well-defined epigenetic change linked to human cancers and other diseases., inter-individual epigenetic variations in normal and cancer tissues due to ageing, smoking, drinking and meat-eating are poorly characterized. Population based studies are required to improve our understanding of epigenetic changes leading to progression of cancer. In this study, the methylation pattern of MGMT gene was studied in 100 tissue samples of prostate cancer patients along with 50 tissue samples of Benign Prostatic Hyperplasia cases and 100 blood samples from healthy individuals as controls. The results establish that the methylation pattern increases with age in BPH and healthy individuals whereas the maximum probability of developing prostate cancer is in the age group of 51-60 yrs. It is again proved in the study that smoking, drinking and non-vegetarian diet has a significant contribution in hypermethylation of MGMT gene, thus signifying that the methylation pattern can be designated as epigenetic biomarker in prostate cancer patients where the diagnosis is not well defined in the early stages of tumorigenesis.

Keywords: Methylation; MGMT gene; Epigenetic biomarker.

1. Introduction

Silencing of tumor suppressor and tumor-related genes by hypermethylation at promoter CpG islands [1,2,3,4,5] is one of the major

events in human tumorigenesis. The DNA repair protein O6-methylguanine DNA methyltransferase (MGMT) removes alkyl adducts from the O6 position of guanine. MGMT expression is decreased in some tumor tissues, and lack of activity has been observed in some cell lines. Loss of expression is rarely due to deletion, mutation, or rearrangement of the MGMT gene, but methylation of

discrete regions of the CpG islands of MGMT [6,7] has been associated with the silencing of the gene in cell lines [4]. In tumorigenesis, the normal functioning of the epigenetic-regulatory system is disrupted leading to inappropriate CpG island hypermethylation and aberrant expression of a variety of genes involved in critical cellular processes. Cancer-dependent epigenetic regulation of genes involved in DNA damage repair, hormone response, cell cycle control, tumor-cell adhesion/metastasis can contribute significantly to tumor initiation, progression, and metastasis, thereby increasing prostate cancer susceptibility, and risk

[2]. O6-methylguanine-DNA methyltransferase (MGMT) plays a crucial role in the defence against alkylating agents that generate 06-

alkylguanine in DNA, a major trigger of genotoxicity and apoptosis. Therefore, screening individual MGMT expression levels in

tumors and normal tissue should predict efficacy of methylation based cancer therapies [8,9,10]..Among the more than 500 primary

tumors studied, MGMT hypermethylation was reported in a subset of specific type of cancer [11]. In gliomas and colorectal

carcinomas, aberrant methylation has been detected in 40% of the tumors [12], whereas in non-small cell lung carcinomas,

lymphomas, and head and neck carcinomas, this alteration has been found in 25% of the tumors [13]. MGMT methylation has not

been reported in other carcinomas [14]. This study concluded that epigenetic inactivation of MGMT plays an important role in

development of prostate carcinoma. It is the first study to correlate the development of prostate carcinoma with age, smoking, drinking and food habits in North Indian population. We studied the methylation pattern of MGMT gene in 100 tissue samples of prostate cancer patients along with 50 tissue samples of Benign Prostatic Hyperplasia cases and 100 blood samples from healthy

individuals as controls. The results signify that the methylation pattern can be designated as epigenetic biomarker [15] in prostate

2 Research Article


cancer patients [5], where the diagnosis is not well defined in the early stages of tumorigenesis. Detection of Prostate cancer at early

stages could potentially increase survival rates. The purpose of this study is to determine the prevalence of aberrant promoter

methylation of MGMT gene [16] in prostate cancer patients [8,9,10]; with a view to designate methylation as prognostic biomarker

[17] for prostate cancer patients.

2. Methods

The patients of prostate cancer/BPH were selected from the outpatient departments of PGIMER, Chandigarh, Government Medical College and Hospital, Sector 32, Chandigarh and Government Rajindra Medical College and Hospital, Patiala.. Histopathological confirmation of the Prostate cancer was done by Pathologists of the respective institutes.. Samples were collected by the clinical staff of these institutes. A detailed questionnaire designed by Indian Council of Medical Research (ICMR), containing all the information about the disease outcome, family history, age, smoking , drinking and food habits was entered at the time of collection of samples. The study proposal and ethics procedure were approved by the ethics review committee of PGIMER, Chandigarh. DNA was extracted from 100 tissue samples of Prostate cancer patients, 50 tissue samples of Benign Prostatic Hyperplasia and 100 blood samples of healthy individuals as controls, using proteinase K digestion followed by standard phenol-chloroform extraction method. In the case of cancer tissue samples, the DNA extraction was done using Sigma GenElute mammalian Genomic DNA Miniprep Kit

(G1N70). DNA concentration was measured by running Hind III digested λ marker on 0.8% agarose gel.

2.1 Bisulfite conversion of DNA using Promega Wizard Kit

DNA (2 ug) in a volume of 50 ul was denatured by NaOH (final concentration, 0.2 M) for 10 min at 37ºC. 30 microliters of 10 mM hydroquinone (Sigma) and 520 ul of 3 M sodium bisulfite (Sigma) at pH 5, both freshly prepared, were added and mixed, and

samples were incubated under mineral oil at 50ºC for 16 hr. Modified DNA was purified using the Wizard DNA purification resin

according to the manufacturer's (Promega) prescribed protocol and was eluted into 50 ul of water. Modification was completed by NaOH (final concentration, 0.3 M) treatment for 5 min at room temperature, and was followed by ethanol precipitation. DNA was

resuspended in water and was stored at -20ºC.

2.2 Bisulfite conversion of DNA using Sigma Kit (Imprint DNA Modification Kit - MOD50-1KT) DNA samples were modified and then eluted using the prescribed protocol by the manufacturer.

2.3 Methylation specific PCR (MSP)

Methylation specific PCR [18] for MGMT gene using specific primers, Methylated with 98 bp and methylation in relation to food

Unmethylated with 108 bp) was done. Taq polymerase was added after 5 minutes. (Hot start) and the programme was run for 95º C-

45 seconds, 58º C for 45 seconds and 72º C for 45 seconds. PCR was run for 35 cycles. After keeping the PCR products at 4ºC for 1

hour, the methylated as well as unmethylated product was run on 3% Agarose Gel. After successful run, the photograph was taken in the Gel Doc.

3. Results and Discussion

In the present study the methylation pattern of MGMT gene was studied in 100 tissue samples of prostate cancer patients along with 50 tissue samples of Benign Prostatic Hyperplasia cases and 100 blood samples from healthy individuals as controls performing methylation specific PCR (MSP).

3.1 Quality and quantity of genomic DNA DNA extracted from tissues of Prostate cancer and BPH patients and from blood of healthy controls was checked for their quantity and concentration in solution by electrophoresis on an ethidium bromide stained 1% agarose gel. The sample DNA showed presence of good quality high molecular weight DNA, which was evident from the presence of a single intact band without smearing or degradation. The comparison of band intensities of DNA from blood of lung cancer patients to that of standard 1ug Hind digested lambda DNA molecular weight marker showed almost similar concentrations of DNA in different samples.



3.2 Primers

Forward Primer Reverse Primer

M: TTTCGACGTTCGTAGGTTTTCGC M: GCACTCTTCCGAAAACGAAACG

U: 5’-TTTGTGTTTTGATGTTTGTAGGTTTTTGT U: 5’-AACTCCACACTCTTCCAAAAACAAAAGA

Hypermethylation of the MGMT promoter leads to the loss of its function in various carcinomas, Soejima et al. [19]; however, prostate cancer data are not clear. Indeed, some studies have reported a lack of significant MGMT methylation in prostate tumors,

Maruyama et al. [20]; Yamanaka et al. [21]; Yegnasubramanian et al. [22], whereas others have detected moderate to high levels,

75.7%; 22% , Kang et al. [23]; Konishi et al. [24].

In the present study, the overall frequency of methylation was found out to be 53%. The frequency of methylation was maximum in subjects in the age group of 41-50 years, declining in a systematic manner with the increase in age i.e. 60% in 51-60 yrs; 58 % in 61-70; 52% in 71-80 and touching the lowest percentile of 30 in age group of 81-90 yrs. In case of smokers, the percentage of methylation was 73 as compared to 30 in non-smokers. In the subjects who consumed alcohol, the methylation was 58% as compared to 42% in non-drinkers. In relation to food habits, non-vegetarians showed methylation in 60 % of the cases as compared to 20% in vegetarians.

In case of BPH patients, the age group of 61-70 showed maximum methylation of 22% whereas it was 20% in the age group of 51-60 years, whereas methylation was nil in the age groups of 41-50 yrs and 71-80 yrs. In smokers, methylation was observed in 37% of the cases as compared to just 5 % in non-smokers. Methylation was observed in 16 % of BPH patients who consumed alcohol as compared to nil in non-drinkers. In case of food habits, non-vegetarians showed methylation in 18 % of the cases as compared to 10 % in vegetarians.

In healthy controls, the frequency of methylation was zero in the age group of 31-40 years and showed a steady increase in methylation with age. It was 22% in age group of 41-50, 36% in age group of 51-60 years, 39% in the age group of 61-70 years and frequency of methylation was 42% in the age group of 71-80 years. Frequency of methylation was found to be more in smokers i.e. 42% as compared to 17% in non-smokers. Drinkers showed frequency of 63% as compared to 18 % in non-drinkers. The frequency of methylation was much more in non-vegetarians (49%) than in vegetarians (17%).

Figure 1. Estimation of quantity and quality of genomic DNA as visualized on an ethidium bromide-stained 1% agarose gel in comparison with Hind III-digested ƛ-DNA molecular weight marker.

4 Research Article


Figure 4. MGMT methylation (cancer patients) in different age groups.

010203040506070

41-50 51-60

U U M M U M L

M M M M M U U U U U L

Figure 3. Gel illustrating methylation-specific PCR in BPH cases. U =Unmethylated; M = Methylated; L = Ladder

Figure 2. Gel illustrating methylation-specific PCR in prostate cancer cases. U = Unmethylated; M = Methylated; L = Ladder

100bp 92bp U



Figure 5. Methylation in MGMT gene (cancer patients) in smokers and non-smokers.

Figure 6. Methylation in MGMT gene (cancer patients) in drinkers and non-drinkers.

Figure 7. Methylation in MGMT gene (cancer patients) in relation to food habits.

0

10

20

30

40

50

60

Smoke NS

Methyl%

Unmet%

0

10

20

30

40

50

60

Drink ND

Methyl%

Unmet%

0

10

20

30

40

50

60

Non-veg Veg

Methyl%

Unmet%

6 Research Article


Figure 8. Methylation in MGMT gene (BPH) in relation to different age groups.

Figure 9. Methylation in MGMT gene (BPH) in smokers/non-smokers.

Figure 10. Methylation in MGMT gene (BPH) in drinkers/non-drinkers.

0102030405060708090

100

31-40 41-50 51-60 61-70 71-80

Methyl%

Unmethy%

0102030405060708090

100

Smoker NS

Methyl%

Unmet%

0102030405060708090

100

Drinker ND

Methyl%

Unmet%



Figure 11. Methylation in MGMT gene (BPH) in relation to food habits.

Figure 12. Methylation in MGMT gene (control) in different age groups.

Figure 13. Methylation in MGMT gene (control) in smokers/non-smokers.

0102030405060708090

N-Veg Veg

Methyl%

Unmet%

0102030405060708090

100

31-40 41-50 51-60 61-70 71-80

Methyl%

Unmet%

0102030405060708090

Smoke NS

Methyl%

Unmet%

8 Research Article


Figure 14. Methylation in MGMT gene (control) in drinkers/non-drinkers.

Figure 15. Methylation in MGMT gene (control) in relation to food habits.

4. Conclusion

It is evident from the study that the methylation increases with age in BPH and Control samples whereas in the cases of cancer patients, the maximum probability of prostate cancer is in the age group of 51-60 and it continues to decrease in a systematic

manner with the increase in age. In cases, control and BPH patients the methylation incidence is significantly high in smokers [25], drinkers and meat eaters as compared to non-smokers, non-drinkers and vegetarians. Therefore, we conclude that smoking, consumption of alcohol and non-vegetarian diet can trigger the onset of hypermethylation, which can result in development of carcinoma of prostate. This study clearly demonstrates that hypermethylation of MGMT gene can be designated as epigenetic

biomarker [26,27,28] for prognosis of prostate cancer. Although this a first study of its kind in the North Indian population, but the

results are in conformity of earlier records in other cancers in other parts of the world [29,30,31].

5. List of Abbreviations

BPH: Benign prostate hyperplasia; MSP: Methylation specific PCR; PCR: Polymerase chain reaction.

6. Competing Interests

The authors declare that they have no competing Interests.

7. Authors’ Contributions

SS and JSD have done the major work, which is a part of PhD project of SS. RCS and VLS both, supervised the PhD project. The manuscript was written and checked by JSD. HT helped in the conduct of experiments.

0102030405060708090

Drinker ND

Methyl%

Unmet%

0

10

20

30

40

50

60

N-Veg Veg

Methyl%

Unmet%



8. Acknowledgement

The authors are grateful to authorities of PGIMER, Chandigarh; Government Medical College & Hospital, Sector 32 Chandigarh; Government Rajindra Medical College and Hospital, Patiala; for helping us in the collection of samples. The positive approach and help rendered by the patients and their wards is deeply solicited.

References

1. Laird PW, 2003. The power and the promise of DNA methylation markers. Nature Reviews Cancer, 3(4): 253-266.

2. Li LC, Okino ST, Dahiya R, 2004. DNA methylation in prostate cancer. Biochimica et Biophysica Acta, 1704: 87-102.

3. Nakayama N, Gonzalgo ML, Yegnasubramanian S, Lin X, De Marzo AM, Nelson WG, 2004. GSTP1 CpG island hypermethylation as a molecular biomarker for prostate cancer. Journal of Cellular Biochemistry, 91: 540-552.

4. Antequera F, Boyes J, Bird A, 1990. High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines. Cell, 62: 503-514.

5. Esteller M, Corn PG, Baylin SB, Herman JG, 2001. A gene hypermethylation profile of human cancer. Cancer Research, 61: 3225-3229.

6. Bello MJ, Alonso ME, Amiñoso C, Anselmo NP, Arjona D, Gonzalez-Gomez P, Lopez-Marin I, de Campos JM, Gutierrez M, Isla A, Kusak ME, Lassaletta L, Sarasa JL, Vaquero J, Casartelli C, Rey JA, 2004. Hypermethylation of the DNA repair gene MGMT: association with TP 53 G:C to A:T transitions in a series of 469 nervous system tumors. Mutation Research, 554: 25-32.

7. Jacinto FV, Esteller M, 2007. MGMT hypermethylation: a progonostic foe, a predictive friend. DNA Repair, 6: 1155-1160.

8. Gerson SL, Trey JE, Miller K, Berger NA, 1986. Comparison of O6- alkylguanine-DNA-alkyltransferase activity based on cellular DNA content in human, rat and mouse tissues. Carcinogenesis, 7: 745-749.

9. Citron M, Graver M, Schoenhaus M, Chen S, Decker R, Kleynerman L, Kahn LB, White A, Fornace AJ, Yarosh D, 1992. Detection of messenger RNA from O6- methyltransferase gene MGMT in human normal and tumor tissues. Journal of the National Cancer Institute, 84: 337-340.

10. Costello JF, Futscher BW, Tano K, Graunke DM, Pieper RO, 1996. Graded methylation in the promoter and in the body of the O6

- methylguanine-DNA methyltransferase gene correlates with MGMT expression in human glioma cells. Cancer Research, 56: 13916-13924.

11. Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JP, 1998. Alterations in DNA methylation: a fundamental aspect of neoplasia. Advances in Cancer Research, 72: 141-196. 12. Silber JR, Bobola MS, Ghatan S, Blank A, Kolstoe DD, Berger MS, 1998. O6 - methylguanine-DNA methyltransferase activity in adult gliomas: relation to patient and tumor characteristics. Cancer Research, 58: 1068-73.

13. Estellar M, Hamilton SR, Burger PC, Baylin SB, Herman JG, 1999. Inactivation of the DNA repair gene 06-methylguanine-DNA methyltranferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Research, 59: 793-7.

14. Estellar M, Garcia-Fonutlas J, Andion E, Goodman SN, Hidalgo OF, Vanaclocha V, Baylin SB, Herman JG, 2000. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. New England Journal of Medicine, 343: 1350-4.

10 Research Article


15. Laird PW, 2010. Principles and challenges of genome wide DNA methylation analysis. Nature Reviews Genetics, 11(3): 191-203.

16. Esteller M, 2000. Epigenetic lesions causing genetic lesion, in human cancer: promoter hypermethylation of DNA repair genes. European Journal of Cancer, 36: 2294-300.

17. Jones PA, Laird PW, 1999. Cancer epigenetics comes of age. Nature Genetics, 2: 163-167.

18. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB, 1996. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proceedings of National Academy of Sciences USA, 93: 9821-9826.

19. Soejima H, Zhao W, Mukai T, 2005. Epigenetics silencing of the MGMT gene in cancer. Biochemistry and Cell Biology, 83: 429-37.

20. Maruyama R, Toyooka S, Toyooka KO, Virmani AK, Zöchbauer-Müller S, Farinas AJ, Minna JD, McConnell J, Frenkel EP, Gazdar AF, 2002. Aberrant promoter methylation profile of prostate cancers and its relationship to clinicopathological features. Clinical Cancer Research, 8: 514-9.

21. Yamanaka M, Watanabe M, Yamada Y, Takagi A, Murata T, Takahashi H, Suzuki H, Ito H, Tsukino H, Katoh T, Sugimura Y, Shiraishi T, 2003. Altered methylation of multiple genes in carcinogenesis of the prostate. International Journal of Cancer, 106: 382-7.

22. Yegnasubramanian S, Kowalski J, Gonzalgo ML, Zahurak M, Piantadosi S, Walsh PC, Bova GS, De Marzo AM, Isaacs WB, Nelson WG, 2004. Hypermethylation of CpG islands in primary and metastatic human prostate cancer. Cancer Research, 64: 1975-86.

23. Kang GH, Lee S, Lee HJ, Hwang KS, 2004. Aberrant CpG island hypermethylation of multiple genes in prostate cancer and prostatitic intraepithelial neoplasia. The Journal of Pathology, 202: 233-40.

24. Konishi N, Nakamura M, Kishi M, Nishimine M, Ishida E, Shimada K, 2002. DNA hypermethylation status of multiple genes in prostate adenocarcinomas. Japanese Journal of Cancer Research, 93: 767-73.

25. Dai WS, Gutani JP, Kuller LH, Cauley JA, 1998. Cigarette smoking and serum sex-hormones in men. American Journal of Epidemiology, 128 (4): 796-805.

26. Deep JS, Sidhu S, 2008. Methylation pattern of E-cadherin gene as epigenetic biomarker in lung cancer patients. Research Journal of Biotechnology. 3 (4): 32-34. 27. Deep JS, Sidhu S, 2008. Study of methylation pattern of apc gene as epigenetic biomarker in lung cancer patients. Proceedings of ISBT, 1: 435-437. 28. Deep JS, 2009. DNA Methylation - Epigenetics to Molecular Diagnostics. Research Journal of Biotechnology, 4 (4): 3-4.

29. Sim HG, Cheng CW, 2005. Changing demography of prostate cancer in Asia. European Journal of Cancer, 41: 834-45.

30. Sinha R, Anderson DE, McDonald SS, Greenwald P, 2003. Cancer risk and diet in India. Journal of Postgraduate Medicine, 49 (3): 222-228.

31. Sommer F, Klotz T, Schmitz-Drager BJ, 2004. Lifestyle issues and genitourinary tumors. World Journal of Urology, 21 (6): 402-413.

methylation pattern of mgmt gene in relation to age, smoking

Documents