mitochondrial nucleases endog and exog participate in

Mitochondrial nucleases ENDOG and EXOG participate in mitochondrial DNA 1

depletion initiated by herpes simplex virus type 1 UL12.5 2

3

Brett A. Duguay and James R. Smiley# 4

5

Li Ka Shing Institute of Virology, Department of Medical Microbiology and 6

Immunology, 632 Heritage Medical Research Centre, University of Alberta, Edmonton, 7

Alberta, Canada, T6G 2S2. 8

9

Running title: ENDOG/EXOG facilitate UL12.5-mediated mtDNA depletion 10

11

Abstract word count: 131 12

Text word count: 5646 13

14

Corresponding author: Mailing address: Li Ka Shing Institute of Virology, Department of 15

Medical Microbiology & Immunology, 632 Heritage Medical Research Center, 16

University of Alberta, Edmonton, Alberta T6G 2S2, Canada. 17

Phone: (780) 492-4070 18

Fax: (780) 492-7521 19

E-mail: [email protected] 20

21

22

23

JVI Accepts, published online ahead of print on 28 August 2013J. Virol. doi:10.1128/JVI.02306-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.

on March 27, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ABSTRACT 24

Herpes simplex virus type 1 (HSV-1) rapidly eliminates mitochondrial DNA 25

(mtDNA) from infected cells, an effect that is mediated by UL12.5, a mitochondrial 26

isoform of the viral alkaline nuclease UL12. Our initial hypothesis was that UL12.5 27

directly degrades mtDNA via its nuclease activity. However, we show here that the 28

nuclease activities of UL12.5 are not required for mtDNA loss. This observation led us to 29

examine whether cellular nucleases mediate the mtDNA loss provoked by UL12.5. We 30

provide evidence that the mitochondrial nucleases endonuclease G (ENDOG) and 31

endonuclease G-like 1 (EXOG) play key redundant roles in UL12.5-mediated mtDNA 32

depletion. Overall, our data indicate that UL12.5 deploys cellular proteins including 33

ENDOG and EXOG to destroy mtDNA, and contribute to a growing body of literature 34

highlighting roles for ENDOG and EXOG in mtDNA maintenance. 35

36

INTRODUCTION 37

Many viruses, including herpesviruses, encode proteins that disrupt mitochondrial 38

functions (reviewed in 1). Mitochondria are important targets for viral proteins due to 39

their roles as key regulators of cellular energy production, apoptosis, anti-viral signalling, 40

intermediary metabolism, and calcium homeostasis (reviewed in 2). To perform these 41

vital functions mitochondria rely on imported proteins encoded by the nuclear genome as 42

well as a smaller set of proteins encoded by the mitochondrial genome. The 16.6 kb 43

mitochondrial DNA (mtDNA) genome is present in hundreds to thousands of copies per 44

cell (3, 4) and encodes thirteen mitochondrial proteins involved in oxidative 45

phosphorylation as well as twenty-two mitochondrial transfer RNAs and two 46


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

mitochondrial ribosomal RNAs which are required for mitochondrial protein synthesis 47

(5). Mutations of proteins encoded by the nuclear genome involved in mtDNA replication 48

or nucleotide metabolism can cause mutations, deletions, or depletion of mtDNA, 49

resulting in the collapse of oxidative phosphorylation and numerous debilitating or lethal 50

diseases (reviewed in 6, 7). Therefore, it is important to understand what impact viral 51

infection has on mtDNA and mitochondrial functions. 52

The only viruses known to directly cause a reduction in mtDNA levels during 53

infection are Epstein-Barr virus (EBV) and herpes simplex virus types 1 and 2 (HSV-1 54

and HSV-2) (8, 9). During EBV lytic infection Zta associates with the mitochondrial 55

single-stranded DNA binding protein (mtSSB), preventing mtSSB localization to 56

mitochondria, and leading to an inhibition of mtDNA replication (9). In the case of HSV-57

1, mtDNA is rapidly depleted from infected cells through the action of a mitochondrially-58

targeted viral nuclease, UL12.5 (8, 10). UL12.5 is an amino-terminally truncated isoform 59

of the HSV-1 alkaline nuclease, UL12. Both proteins are encoded by the UL12 gene but 60

arise from distinct 3’ co-terminal mRNAs (11, 12). The larger mRNA yields the full 61

length UL12 protein (11) which possesses strong exonuclease and much weaker 62

endonuclease activity (13-16). UL12 translocates to the nucleus using an N-terminal 63

nuclear localization signal (17) where it is proposed to process complex viral DNA 64

structures into linear genomes suitable for packaging into mature viral particles (18, 19). 65

Although not essential for viral replication in cell culture, alkaline nuclease-null viruses 66

are severely impaired (20, 21). The smaller mRNA encodes an in-frame, N-terminally 67

truncated version of UL12 called UL12.5 which initiates at UL12 codon M127 (22). 68

While UL12.5 displays enzymatic properties similar to UL12, it cannot functionally 69


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

replace UL12 during viral replication (17, 22, 23). This lack of redundancy has been 70

attributed to two factors: UL12 is much more abundant than UL12.5 (22), and UL12 and 71

UL12.5 have distinct subcellular locations (17). Although a fraction of total UL12.5 is 72

found in the nucleus, much of the protein is targeted to mitochondria using an N-73

proximal mitochondrial localization signal (MLS) (8, 10). 74

We recently mapped the UL12.5 MLS to residues M185-R245 (of full-length 75

UL12) and showed that an N-terminally truncated form initiating at residue M185 76

(UL12M185) localizes to mitochondria and depletes mtDNA (10). Intriguingly, a previous 77

study had shown that two mutations in the N-terminal regions of UL12 and UL12.5 that 78

are absent from UL12M185 inactivate detectable nuclease activity in vitro (23). Taken 79

together, these data raised the possibility that UL12M185 lacks enzymatic activity, and by 80

extension, that the nuclease activity of UL12.5 is not required for mtDNA depletion. Here 81

we present data which support this hypothesis. We demonstrate that several nuclease-82

deficient mutants of UL12.5 retain the ability to deplete cells of mtDNA. Furthermore, 83

we provide evidence that the mitochondrial proteins endonuclease G (ENDOG) and 84

endonuclease G-like 1 (EXOG) contribute to the degradation of mtDNA following 85

UL12.5 expression. 86

87

MATERIALS AND METHODS 88

Cells and transfections 89

HeLa cells were maintained at 37°C with 5% CO2 in Dulbecco's modified Eagle's 90

medium supplemented with 10% fetal bovine serum (complete medium). All plasmid 91

transfections were performed using Lipofectamine 2000 (Invitrogen) unless otherwise 92


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

stated and followed by incubation in complete medium supplemented with 50 たg/mL 93

uridine and 1 mM sodium pyruvate. 94

Plasmids 95

HSV-1 UL12-SPA, UL12.5-SPA, and UL12.5-SPA mutants were generated in 96

the pMZS3F vector (24). Expression from this vector generates C-terminal sequential 97

peptide affinity (SPA) tagged proteins containing three FLAG epitopes. The UL12-SPA, 98

UL12.5-SPA, and UL12M185-SPA open reading frames (ORFs) were amplified by PCR 99

using DNA isolated from Vero cells infected with KOS37-SPA which is a mutant virus 100

that expresses C-terminal SPA-tagged UL12 and UL12.5 proteins (B. A. Duguay, H. A. 101

Saffran, A. Ponomarev, H. E. Eaton, and J. R. Smiley, manuscript in preparation). The 102

PCRs introduced a 5’ EcoRI restriction site, and either a 3’ XbaI or 3’ Bsu36I site to the 103

ORFs using primers F1 and R1 (UL12-SPA), F2 and R2 (UL12.5-SPA), F3 and R1 104

(UL12M185-SPA). Restriction digested PCR products were ligated into pMZS3F to create 105

pMZS3F UL12-SPA, pMZS3F UL12.5-SPA, and pMZS3F UL12M185-SPA. 106

Plasmids expressing untagged versions of UL12.5-L150K, UL12.5-ΔN, UL12.5-107

ΔMLS, and UL12.5-ΔC were first created in a pcDNA3.1 vector. Additional details 108

regarding the construction of these plasmids are available upon request. The L150K 109

mutation was introduced using a modified site-directed mutagenesis protocol (25) with 110

primers F4 and R3. The ΔN mutation (deletes residues W128-R148 (23)) and the ΔMLS 111

mutation (deletes residues R188-R212 (10)) were both introduced using the QuikChange 112

XL Site-Directed Mutagenesis Kit (Stratagene) with primers F5 and R4 or primers F6 113

and R5, respectively. The ΔC mutation (deletes residues P578-R626 (23)) was created by 114

PCR using primers F3 and R6. The pcDNA3.1(-) vectors encoding UL12.5-L150K, 115


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

UL12.5-ΔN, UL12.5-ΔMLS, and UL12.5-ΔC or pSAK vectors encoding UL12.5-D340E-116

mOrange (10) and UL12.5-G336A/S338A-mOrange (10) were used as templates for PCR 117

to add 5’ EcoRI and 3’ KpnI sites using the following primers: L150K, ΔMLS, UL12.5-118

D340E, UL12.5-G336A/S338A (F3 and R7), ΔN (F7 and R7), ΔC (F3 and R8), and 119

UL12M185-D340E or UL12M185-G336A/S338A (F8 and R7). All PCR products were 120

ligated into an EcoRI/KpnI digested intermediate vector (pcDNA3.1 UL12.5-SPA) 121

containing a KpnI site immediately upstream of the SPA tag coding sequence. This 122

intermediate vector was created by digesting pMZS3F UL12.5-SPA with Bsu36I, treating 123

with T4 DNA polymerase (Invitrogen), and then digesting with EcoRI. The UL12.5-SPA 124

ORF was ligated into an EcoRI/SmaI digested pcDNA3.1/myc-His(-) creating pcDNA3.1 125

UL12.5-SPA. All intermediate vectors encoding SPA-tagged proteins were digested with 126

EcoRI and Bsu36I and ligated into pMZS3F to generate: pMZS3F UL12.5-L150K-SPA, 127

pMZS3F UL12.5-D340E-SPA, pMZS3F UL12.5-G336A/S338A-SPA, pMZS3F 128

UL12.5-ΔN-SPA, pMZS3F UL12.5-ΔMLS-SPA, pMZS3F UL12.5-ΔC-SPA, pMZS3F 129

UL12M185-D340E-SPA, and pMZS3F UL12 M185-G336A/S338A-SPA. 130

Plasmids encoding C-terminally myc-tagged ENDOG and EXOG were generated 131

by PCR amplification of ENDOG cDNA (RG205089, OriGene) or EXOG cDNA 132

(RG224222, OriGene). These PCRs introduced a 5’ EcoRI site (ENDOG) or 5’ BamHI 133

site (EXOG), and 3’ HindIII sites to the ORFs. Amplification of the ENDOG ORF used 134

primers F9 and R9. Amplification of the EXOG ORF used primers F10 and R10. 135

Plasmids encoding nuclease-deficient versions of ENDOG (ENDOG-H141A (26)) and 136

EXOG (EXOG-H140A (27)) were generated using overlap PCR. Briefly, the ENDOG 137

ORF was amplified by PCR using primers F9 and R11 or F11 and R9. The resulting 138


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

overlapping PCR products were combined in eqimolar ratios and reamplified using 139

primers F9 and R9 to generate the ENDOG-H141A ORF. Similarly, the EXOG-H140A 140

ORF was amplified by PCR using primers F10 and R12 or F12 and R10 and the 141

overlapping PCR products were reamplified using primers F10 and R10. All ENDOG 142

and EXOG ORFs were ligated into pcDNA3.1/myc-His(-) to create pcDNA3.1-ENDOG-143

myc-His, pcDNA3.1-ENDOG-H141A-myc-His, pcDNA3.1-EXOG-myc-His, and 144

pcDNA3.1-EXOG-H140A-myc-His. For simplicity, no subsequent references to the His 145

epitope will be made in describing these plasmids or proteins. 146

A pcDNA3.1 plasmid expressing monomeric orange (mOrange) fluorescent 147

protein has been previously described (8). A pcDNA4 plasmid expressing a catalytically-148

inactive, myc-tagged version of sirtuin 3 (Sirt3-H248Y-myc) was obtained from Addgene 149

(Plasmid 24917) (28). All oligonucleotides (see Table 1) were synthesized by Integrated 150

DNA Technologies. All PCRs were performed using Platinum Pfx DNA polymerase 151

(Invitrogen) unless otherwise stated. Protein residue numbering of all UL12.5 mutants is 152

relative to that of the full-length HSV-1 UL12 protein. 153

Cell lysis and western blotting 154

Transfected cells were lysed in RIPA buffer (50 mM Tris-HCl (pH 8.0), 1% 155

IGEPAL CA-630, 150 mM NaCl, 1 mM EDTA, 0.1% sodium dodecyl sulfate (SDS), 156

0.5% sodium deoxycholate, Roche cOmplete (EDTA-free) protease inhibitor cocktail) for 157

20-30 min on ice. Lysates were cleared by centrifugation at 20800 x g for five minutes at 158

4°C. Lysate protein concentrations were determined using the Bicinchoninic Acid (BCA) 159

Protein Assay Kit (Pierce). 5X protein sample buffer (200 mM Tris-HCl (pH 6.8), 5% 160

SDS, 50% glycerol, 1.43 M く-mercaptoethanol) was added to each lysate. For 161


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

immunoprecipitations, transfected cells were harvested at 48 hours post transfection 162

(hpt), lysed using IP lysis buffer (50 mM Tris-HCl (pH 7.5), 1% IPEGAL CA-630, 163

0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EGTA, containing protease 164

inhibitors), and cleared by centrifugation at 20800 x g for 15 minutes. 165

All lysates were subjected to SDS-PAGE and transferred to nitrocellulose 166

membranes (Hybond ECL, GE Healthcare). Membranes for chemiluminescent detection 167

were blocked in PBS containing 5% skim milk for one hour at room temperature. Primary 168

antibodies mouse anti-FLAG M2 (Sigma) or rabbit anti-c-myc (Sigma) were incubated 169

with membranes overnight at 4°C and HRP-conjugated goat anti-mouse or goat anti-170

rabbit secondary antibodies (BIO-RAD) were incubated with membranes for one hour at 171

room temperature. All antibodies were diluted in PBS containing 1% skim milk. Proteins 172

were visualized using ECL Plus (GE Healthcare) or ECL2 (Pierce). Membranes for 173

infrared imaging were blocked in 1:1 Odyssey Blocking Buffer (LI-COR):Tris-buffered 174

saline containing 0.1% Tween-20 (OBBT) for one hour at room temperature. Primary 175

antibodies were incubated overnight at 4°C and secondary antibodies (Alexa Fluor 680 176

goat anti-rabbit (Invitrogen) and IRDye800 donkey anti-mouse (Rockland)) were 177

incubated for one hour at room temperature. All antibodies were diluted in OBBT. 178

Proteins were detected using the Odyssey Infrared Imaging System (LI-COR). 179

Immunofluorescence microscopy 180

HeLa cells were grown on coverslips, transfected for 48 hours, and processed for 181

immunofluorescence as previously described (17). Cells were co-stained with rabbit anti-182

FLAG (Sigma) and mouse anti-cytochrome c (556432, BD Biosciences) followed by 183

incubation with Alexa Fluor 555-conjugated goat anti-rabbit and Alexa Fluor 488-184


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

conjugated goat anti-mouse secondary antibodies (Invitrogen). Stained cells were 185

mounted onto slides using VECTASHIELD (Vector Laboratories) containing 1 mg/mL 186

4',6-diamidino-2-phenylindole (DAPI, Molecular Probes). Images were obtained using a 187

fluorescence microscope with a 63X oil immersion objective and an ApoTome optical 188

sectioning device (Zeiss). 189

Live cell imaging of mtDNA depletion 190

Chambered coverglass dishes (155383, Nunc) were used for all live cell imaging. 191

To quantitate mtDNA depletion by UL12.5 mutants, 200 ng of plasmid DNA was co-192

transfected with 100 ng pcDNA-Orange. To assess the effect of ENDOG and/or EXOG 193

overexpression on mtDNA depletion by UL12M185-G336A/S338A-SPA, 100 ng of 194

pMZS3F plasmid DNA (empty vector or UL12M185-G336A/S338A-SPA) was co-195

transfected with 200 ng pcDNA3.1 plasmid DNA (empty vector alone, empty vector and 196

ENDOG/EXOG/Sirt3 plasmid DNA, or ENDOG and EXOG plasmid DNA) and 100 ng 197

pcDNA-Orange. To determine if ENDOG and/or EXOG knockdown had an effect on 198

mtDNA depletion, HeLa cells were first seeded into 24-well plates and transfected with 199

10 nM total siRNA using DharmaFECT 1 (Thermo Scientific) for 48 hours. These cells 200

were trypsinized and reverse transfected into chambered coverglass dishes for an 201

additional 24 hours with the indicated siRNAs, 100 ng pcDNA-Orange, and 100 ng of 202

empty vector or a plasmid expressing UL12.5-SPA or UL12M185-G336A/S338A-SPA 203

using DharmaFECT Duo (Thermo Scientific). For all live cell imaging, mtDNA was 204

visualized in mOrange-positive cells using PicoGreen (Invitrogen) staining as previously 205

described (10). Images were obtained using a fluorescence microscope and a 40X oil 206

immersion objective (Zeiss). 207


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Immunoprecipitations 208

All incubations were carried out at 4°C. Mouse anti-FLAG M2 (Sigma)-protein 209

G-agarose conjugates were formed overnight in PBS and washed three times with IP lysis 210

buffer before use. Transfected cell lysates were incubated for 30 minutes with protein G-211

agarose (Roche) prior to incubating with the antibody-agarose conjugates for two hours. 212

The immunoprecipitates were washed three times in IP lysis buffer followed by three 213

washes with 50 mM Tris (pH 8.8). The agarose-conjugated protein complexes were 214

resuspended in 50 mM Tris (pH 8.8) containing protease inhibitors. Protein sample buffer 215

was added to an aliquot of each immunoprecipitate and subjected to infrared western 216

blotting using rabbit anti-FLAG (Sigma). 217

In vitro IP nuclease assays 218

Immunoprecipitates were incubated with EcoRI-linearized pUC19 DNA or uncut 219

pEGFP-C1 DNA (Clontech) in nuclease assay buffer (50 mM Tris-Cl (pH 8.8), 10 mM 220

MgCl2, 5 mM く-mercaptoethanol) for two hours at 37°C. The remaining pUC19 DNA 221

was resolved by agarose gel electrophoresis, stained with SYBR Gold (Invitrogen), and 222

visualized with a FLA-5100 imaging system (Fujifilm). Immunoprecipitates incubated 223

with circular pEGFP-C1 were processed by SYBR Gold staining to visualize DNA 224

quantity and migration or by nick translation to visualize endonuclease activity. For nick 225

translation the immunoprecipitates were removed by centrifugation and the supernatants 226

were incubated at room temperature for one hour in 33 mM Tris-Cl (pH 7.9), 10 mM 227

MgCl2, 50 mM NaCl, 33 たM dATP/dGTP/dTTP with 5U E. coli DNA polymerase I 228

(NEB) and 20たCi 32

P-dCTP. DNA was isolated by phenol/chloroform extraction and 229

resolved by agarose gel electrophoresis. The agarose gel was dried overnight, exposed to 230


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

a phosphor screen, and radiolabeled DNA was visualized using a FLA-5100 imaging 231

system. 232

siRNA knockdown of EXOG and ENDOG 233

Small interfering RNAs (siRNAs) targeting ENDOG (s707), EXOG (s19298), or 234

a non-targeting control (4390847) were obtained from Ambion. Endogenous EXOG 235

knockdown was evaluated using HeLa cells transfected for 48 hours with 10 nM total 236

siRNA (10 nM negative control (N.C.) siRNA, 5 nM EXOG + 5 nM N.C. siRNAs, or 5 237

nM ENDOG + 5 nM N.C. siRNAs) using DharmaFECT 1. Total cell lysates were 238

prepared and processed for infrared western blotting using rabbit anti-EXOG (Invitrogen) 239

and mouse anti-actin (Sigma) primary antibodies. Alternatively, siRNA transfected cells 240

were lysed for 10 minutes on ice with digitonin lysis buffer (1 mM NaH2PO4, 8 mM 241

Na2HPO4, 75 mM NaCl, 250 mM sucrose, 190 µg/mL digitonin, containing protease 242

inhibitors) and centrifuged at 20800 x g for five minutes at 4°C. To the supernatants 243

(cytoplasmic fractions) 5X protein sample buffer was added. The pellets (mitochondrial 244

fractions) were resuspended in 25 mM Tris (pH 8.0), 0.1% Triton X-100 to which 5X 245

protein sample buffer was added. Lysates were processed for infrared western blotting 246

using rabbit anti-EXOG (Invitrogen), mouse anti-GAPDH (Biodesign International), 247

mouse anti-MnSOD (Stressgen), and mouse anti-cytochrome c (556433, BD 248

Biosciences). 249

SiRNAs were also evaluated for their ability to suppress overexpression of the 250

desired protein. HeLa cells were co-transfected with 10 nM total siRNA (10 nM negative 251

control (N.C.) siRNA, 5 nM EXOG + 5 nM N.C. siRNAs, or 5 nM ENDOG + 5 nM N.C. 252

siRNAs) and 1 µg plasmid DNA (pcDNA3.1-EXOG-myc or pcDNA3.1-ENDOG-myc) 253


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

using DharmaFECT Duo. Lysates were prepared at 48 hpt and processed for infrared 254

western blotting using mouse anti-c-myc (Sigma) and rabbit anti-actin (Sigma). 255

Image processing 256

All microscopy images were acquired with an Axiovert 200M fluorescence 257

microscope using the AxioVision 4.5 program (Zeiss). Image processing was performed 258

using Illustrator CS2 and Photoshop CS2 (Adobe). 259

260

RESULTS AND DISCUSSION 261

Construction, expression, and mitochondrial localization of nuclease-deficient 262

UL12.5-SPA mutants. 263

We previously demonstrated that HSV-1 UL12.5 is responsible for the rapid loss 264

of mtDNA following infection (8). To better understand the relationship between UL12.5 265

nuclease activity and UL12.5-mediated mtDNA depletion, we constructed a series of 266

plasmids containing known nuclease-inactivating mutations (Fig. 1A, 23, 29). These 267

included two well characterized mutations in invariant residues of conserved motif II 268

(29), which based on the structures of the Kaposi's sarcoma-associated herpesvirus 269

(KSHV) and EBV orthologs lie in the active site of the enzyme (30, 31). Mutational 270

analysis has demonstrated that the G336A/S338A double substitution mutation eliminates 271

detectable exo- and endonuclease activities of UL12 whereas the D340E substitution 272

mutation disrupts only exonuclease activity (29). Both mutations abolish the ability of 273

UL12 to complement the growth defect of a UL12-null mutant virus (29). Mutagenesis of 274

EBV, HCMV, and KSHV UL12 orthologs has also demonstrated that residues analogous 275

to UL12 G336, S338, and D340 are critical for nuclease activity (30, 32-34). We included 276


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

three additional mutations that have also been shown to eliminate detectable nuclease 277

activity in vitro and abolish complementing activity in vivo; 〉N, L150K, and 〉C (23). A 278

partial deletion of the UL12.5 MLS (〉MLS) adjacent to conserved motif I was also 279

included to assess the importance of mitochondrial localization during mtDNA depletion. 280

The mutant proteins were expressed in transfected HeLa cells and their steady-281

state levels were observed via western blotting (Fig. 1B). The largest protein product of 282

each expression vector migrated at the predicted mobility. The UL12-SPA expression 283

plasmid also expressed a low level of UL12.5-SPA from the native UL12.5 promoter 284

contained within the UL12 open reading frame (Fig. 1B, 35). To determine whether the 285

nuclease-inactivating mutations had an effect on mitochondrial targeting, we compared 286

the localization of SPA tagged proteins (shown in red) with that of the mitochondrial 287

protein cytochrome c (shown in green) using immunofluorescence microscopy. UL12-288

SPA demonstrated strong nuclear localization in most cells (Fig. 2); however, a minority 289

(ca. 20%) of cells also displayed a clear mitochondrial signal (data not shown), 290

presumably due to UL12.5 that is co-expressed from this plasmid using the native 291

UL12.5 promoter. In contrast, UL12.5-SPA was predominantly mitochondrial in all cells, 292

displaying a weaker nuclear signal than UL12 (Fig. 2) consistent with our previous 293

observations (8, 10). All but one of the UL12.5 mutants displayed nuclear/mitochondrial 294

localization similar to the wild-type UL12.5-SPA protein (Fig. 2). The exception was 295

UL12.5-〉MLS-SPA, which lacks a portion (R188-R212) of the MLS and was excluded 296

from mitochondria. This observation supports our previous data highlighting the 297

importance of N-proximal residues M185-R245 in targeting UL12.5 to mitochondria 298

(10). UL12M185-SPA and its mutant derivatives localized exclusively to mitochondria, as 299


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

did UL12.5-〉N-SPA (Fig. 2). The failure of these N-terminally truncated mutants of 300

UL12.5 to target the nucleus suggests that residues in the N-terminus of UL12.5 are 301

needed for the partial nuclear localization of wild-type UL12.5, consistent with our 302

previous data (10). 303

Some nuclease-inactivating mutations do not prevent mtDNA depletion. 304

We next determined if the nuclease-inactivating mutations eliminated mtDNA 305

depletion using a live cell imaging assay (10). HeLa cells were co-transfected with 306

plasmids expressing monomeric orange fluorescent protein (mOrange, to identify 307

transfected cells) and UL12-SPA, UL12.5-SPA, or UL12.5-SPA mutants and stained 308

with PicoGreen to determine the presence or absence of mtDNA. Consistent with our 309

previous observations (10), UL12.5-SPA and UL12M185-SPA depleted mtDNA from the 310

majority of transfected cells (Fig. 3). The UL12-SPA expression plasmid also caused 311

mtDNA depletion in a minority of cells, likely due to expression of UL12.5-SPA from 312

the UL12.5 promoter in a subset of transfected cells (see above). Surprisingly, although 313

two of the nuclease-inactivating mutations abrogated mtDNA depletion (D340E and 〉C), 314

the L150K, G336A/S338A, and 〉N mutants retained significant activity (Fig. 3). 315

Purified UL12 bearing the G336A/S338A double substitution has no detectable 316

nuclease activity (29). It is therefore striking that mutating these residues did not prevent 317

mtDNA depletion by UL12.5 or UL12M185 (Fig. 3): UL12.5-G336A/S338A-SPA caused 318

mtDNA depletion in approximately one third as many cells as UL12.5-SPA, while 319

UL12M185-G336A/S338A-SPA was as active as UL12M185-SPA. The enhanced ability of 320

UL12M185-G336A/S338A-SPA to cause mtDNA depletion relative to UL12.5-321

G336A/S338A-SPA may be due to its more efficient mitochondrial localization. Overall, 322


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

these data indicate that neither the exonuclease or endonuclease activities of UL12.5 are 323

required for mtDNA depletion in transfected cells. 324

The observation that the G336A/S338A mutations did not prevent mtDNA 325

depletion seemed to conflict with our previous finding that a UL12.5-G336A/S338A-326

mOrange mutant was inactive in this live cell imaging assay (10). We therefore 327

reassessed the activity of this construct and found that it caused mtDNA depletion in a 328

small percentage of transfected cells in some but not all experiments (data not shown). 329

The reduced activity of this construct may stem from the use of the larger mOrange tag 330

(236 residues versus 71 residues for the SPA tag used in this study). 331

Cellular endonuclease activity associates with some nuclease-deficient UL12.5 332

mutants. 333

The rapid depletion of mtDNA following infection (8) argues against a defect in 334

mtDNA replication being responsible for mtDNA loss and instead suggests that mtDNA 335

is actively degraded by one or more nucleases. The ability of several nuclease-deficient 336

mutants of UL12.5 to deplete mtDNA data implied that cellular nucleases are involved. 337

Indeed, UL12 and UL12 orthologs are known to harness cellular nucleases to assist in 338

their functions. HSV-1 UL12 directly interacts with components of the MRN complex, 339

including the exo/endonuclease Mre11, which may facilitate viral DNA recombination 340

during infection (36). Additionally, KSHV SOX facilitates mRNA turnover in part 341

through recruitment of the host 5's3' exoribonuclease 1 (XRN1) (37). Therefore, we 342

examined whether cellular nucleases contribute to mtDNA loss following UL12.5 343

expression. 344


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

As one test of this hypothesis, we expressed SPA-tagged UL12, UL12.5, and 345

UL12.5 mutants in HeLa cells and isolated the protein complexes containing these 346

proteins by immunoprecipitation (Figs. 4A and 4D). The resulting immunoprecipitates 347

were tested for their ability to degrade linearized plasmid DNA or to nick circular 348

plasmid DNA in vitro. These nuclease assays were performed under alkaline pH 349

conditions that were conducive to the detection of UL12/UL12.5 nuclease activity. 350

As expected, immunoprecipitates containing UL12-SPA and UL12.5-SPA were 351

capable of degrading linearized plasmid DNA consistent with their known nuclease 352

activity (Figs. 4B and 4E), while immunoprecipitates from cells transfected with empty 353

pMZS3F vector displayed no activity. The degradation of the linear DNA substrate could 354

be due to exo- and/or endonuclease activity; however, it is plausible that the much 355

stronger exonuclease activity (16) is the major contributor. In contrast, the 356

immunoprecipitates containing UL12M185 or the substitution/truncation mutants did not 357

detectably degrade the linearized DNA substrate (Figs. 4B and 4E). These data indicated 358

that none of these mutant proteins possessed, or associated with, detectable nuclease 359

activity against linear DNA substrates as measured in this assay. However it is important 360

to note that this assay would not detect low levels of endonuclease activity, as a large 361

number of nicks would be required to alter the mobility of the linear substrate in non-362

denaturing gels. 363

We also tested the same immunoprecipitates specifically for endonuclease activity 364

using a covalently closed circular plasmid DNA substrate. The outcome was visualized 365

by monitoring the overall loss of DNA and the generation of nicked circles using SYBR 366

Gold staining (Fig. 4C) or nick translation (Fig. 4F). With all immunoprecipitates, the 367


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

circular plasmid DNA migrated as a cluster of closely spaced bands (Fig. 4C). These 368

bands collapsed into a single linear species following digestion with a unique cutting 369

restriction enzyme (data not shown), suggesting the presence of contaminating 370

topoisomerase activity. Comparable topoisomerase activity was detected after incubating 371

HeLa cell lysate with protein G agarose beads in the absence of antibody (data not 372

shown). As expected, immunoprecipitates containing UL12-SPA and UL12.5-SPA 373

caused an appreciable decrease in the total amount of DNA by SYBR Gold staining (Fig. 374

4C), likely due to endonucleolytic nicking followed by exonuclease activity. However, 375

when these immunoprecipitates were scored for endonuclease activity using nick 376

translation, there was no increase compared to the controls (pMZS3F or DNA only, Fig. 377

4F), suggesting that the nicked DNA is rapidly degraded by the powerful exonuclease 378

activity of UL12, as previously observed (16). Interestingly, immunoprecipitates 379

containing UL12.5-L150K-SPA, UL12.5-ΔN-SPA, UL12M185-SPA, and UL12M185-380

G336A/S338A-SPA yielded consistently higher levels of nick translation indicative of 381

the presence of endonuclease activity (Fig. 4F). Some of these immunoprecipitates also 382

generated higher levels of relaxed circles when assessed by the less sensitive SYBR Gold 383

detection method (UL12.5-L150K-SPA, UL12M185-SPA, and to a lesser extent UL12M185-384

G336A/S338A-SPA; Fig. 4C). A low level of endonuclease activity was observed in 385

immunoprecipitates containing the UL12.5-ΔMLS-SPA protein and no appreciable 386

endonuclease activity was observed by nick translation for immunoprecipitates 387

containing UL12.5-D340E-SPA, UL12.5-G336A/S338A-SPA, UL12.5-ΔC-SPA, or 388

UL12M185-D340E-SPA (Fig. 4F). 389


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

It might be argued that the enhanced nicking activity detected in the 390

immunoprecipitates of some mutant proteins is due to residual UL12.5 endonuclease 391

activity. However, the mutational sensitivity profile of the associated endonuclease 392

activity is incompatible with this suggestion: UL12M185-G336A/S338A-SPA 393

immunoprecipitates were amongst the most active in our assay, yet purified UL12 protein 394

bearing the G336A/S338A double substitution lacks detectable endo- and exonuclease 395

activity (29); conversely, UL12M185-D340E-SPA displayed only background levels of 396

nicking in our assay, yet the D340E substitution does not greatly impair the endonuclease 397

activity of purified UL12 (29). These considerations indicate that our 398

immunoprecipitation assay does not detect the weak endonuclease activity of UL12.5, 399

and strongly argue that the nicking activity that we observe is due to one or more 400

associated cellular endonucleases. 401

Interestingly, the nuclease-deficient UL12.5 mutants that associated with 402

presumably cellular endonuclease activity tended to be those capable of causing mtDNA 403

depletion (UL12.5-L105K-SPA, UL12.5-ΔN-SPA, UL12M185-SPA, and UL12M185-404

G336A/S338A-SPA; Fig. 3). The exceptions to this correlation were: 1) UL12.5-405

G336A/S338A-SPA which although capable of causing mtDNA depletion did not 406

associate with appreciable endonuclease activity, and 2) UL12.5-ΔMLS-SPA which 407

associated with some endonuclease activity but is unable to cause mtDNA loss (Figs. 3 408

and 4F). The observation that the UL12M185 double substitution mutant exhibits stronger 409

mitochondrial localization (Fig. 2), causes more mtDNA depletion (Fig. 3), and 410

associates with more endonuclease activity (Fig. 4F) than the UL12.5 double substitution 411

mutant is consistent with the possibility that the associated nuclease is mitochondrial. 412


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

The mitochondrial nucleases ENDOG and EXOG participate in mtDNA depletion 413

by UL12.5 414

Mammalian mitochondria contain a small number of endonucleases including: 415

ENDOG (38, 39), EXOG (27), apurinic-apyrimidinic endonucleases 1 and 2 (APEX1/2) 416

(40-42), flap endonuclease 1 (FEN1) (43, 44), DNA replication ATP-dependent 417

helicase/nuclease (DNA2) (45), and the recently described endo/exonuclease Ddk1 (46). 418

Of these, APEX1/2, FEN1, and DNA2 seemed unlikely to be involved in mtDNA loss 419

provoked by UL12.5 since they act on specialized DNA substrates, while Ddk1 had not 420

been discovered at the onset of our research. We therefore examined ENDOG and EXOG 421

as potential candidates. Unlike in Neurospora crassa and Saccharomyces cerevisiae 422

where a single ENDOG homolog possesses both endonuclease and exonuclease activity 423

(47-49), the majority of mammalian mitochondrial endonuclease and exonuclease 424

activities are thought to be due to the combined action of ENDOG and its highly related 425

paralog EXOG (27). For this reason we considered the possibility that ENDOG and 426

EXOG may play redundant roles in UL12.5-SPA mediated-mtDNA depletion. 427

ENDOG is a sugar non-specific, magnesium-dependent endonuclease which 428

preferentially introduces single-stranded nicks adjacent to guanine residues (50, 51). The 429

biochemical properties of ENDOG are remarkably similar to UL12.5 in that ENDOG 430

functions in the presence of magnesium, alkaline pH, and low ionic strength (22, 51). 431

Aside from its role in apoptosis, ENDOG is responsible for the majority of mammalian 432

mitochondrial nuclease activity and has been observed to associate with mtDNA via 433

chromatin immunoprecipitation (38, 39, 52). Interestingly, ENDOG has already been 434

shown to participate in HSV-1 biology from its proposed role in HSV-1 a sequence 435


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

recombination (53, 54). EXOG differs from ENDOG in that it possesses both 436

endonuclease and weak 5’s3’ exonuclease activity and exhibits a preference for ssDNA 437

(27). 438

As one approach to assessing the potential roles of ENDOG and EXOG in 439

UL12.5-mediated mtDNA depletion, we examined the effect of overexpressing mutant 440

forms of ENDOG and EXOG along with the mtDNA depletion-competent and nuclease-441

deficient mutant UL12M185-G336A/S338A-SPA in our live cell mtDNA depletion assay. 442

We created plasmids which express C-terminally epitope-tagged wild-type and 443

catalytically inactive forms (26, 27) of ENDOG and EXOG (Fig. 5A). The addition of a 444

C-terminal epitope tag does not interfere with the enzymatic activity of ENDOG or 445

EXOG (27, 51, 55), and we verified by co-immunoprecipitation that the catalytically 446

inactive mutants (ENDOG-H141A and EXOG-H140A) retained the ability to form 447

homomultimers with their wild-type counterparts (26, 27, 56, data not shown). As a 448

negative control we used a plasmid expressing an epitope-tagged, catalytically-inactive 449

version of the mitochondrial protein sirtuin 3 (Sirt3-H248Y) (28). The expression and 450

apparent molecular mass of all myc-tagged proteins was confirmed by western blotting 451

(Fig. 5A). The larger and smaller protein species observed following transfection of the 452

ENDOG and Sirt3 plasmids likely correspond to previously described precursor and 453

mature forms of the proteins, respectively (Fig. 5A, 57, 58). Wild-type and mutant 454

EXOG-myc proteins also appeared to migrate as doublets during SDS-PAGE. 455

Expression of EXOG, EXOG-H140A, or Sirt3-H248Y on their own had no 456

observable effect on mtDNA levels in our live cell mtDNA depletion assay. However, 457

expression of ENDOG or ENDOG-H141A caused mtDNA depletion in approximately 458


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

8% of transfected cells (Fig. 5B). In the case of wild-type ENDOG this effect was 459

eliminated by co-transfecting ENDOG siRNA (data not shown). The observation that 460

overexpression of wild-type or mutant ENDOG causes mtDNA depletion is novel and 461

very intriguing. Although it is currently the subject of debate, several studies support a 462

role of ENDOG in mtDNA maintenance (52, 59-62). These observations suggest that 463

although the nuclease activity of ENDOG is not responsible for mtDNA loss following 464

overexpression, ENDOG is involved in regulating mtDNA metabolism. 465

Expression of wild-type or mutant ENDOG or EXOG had no significant effects 466

on UL12M185-G336A/S338A-SPA-mediated mtDNA depletion (Fig. 5B). However, when 467

cells simultaneously expressed ENDOG-H141A and EXOG-H140A mtDNA depletion 468

was reduced by 38% (P = 0.029, Fig. 5B). In contrast, overexpression of the unrelated 469

mitochondrial protein Sirt3-H248Y had no effect on mtDNA depletion by UL12M185-470

G336A/S338A-SPA (Fig. 5B). Interestingly, overexpression of both mutant ENDOG and 471

mutant EXOG was needed to significantly impair mtDNA depletion by UL12M185-472

G336A/S338A-SPA. Therefore, ENDOG and EXOG likely play at least partially 473

redundant roles in the mtDNA degradation pathway that is stimulated following the 474

expression of UL12M185-G336A/S338A-SPA. The inhibitory effect of the combination of 475

ENDOG-H141A and EXOG-H140A appears to be dose dependent, as increasing the 476

amount of ENDOG-H141A/EXOG-H140A plasmid DNA 2.5-fold reduced mtDNA 477

depletion by ca. 68% (p=0.001) in a separate series of experiments (data not shown). 478

To complement the overexpression experiments above, we employed RNA 479

interference to reduce ENDOG and/or EXOG levels in HeLa cells prior to mtDNA 480

depletion. The siRNA targeting EXOG reduced total protein expression by 56% (Fig. 6A) 481


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

and reduced EXOG levels in mitochondria by 66% (Fig. 6B). We have not been able to 482

identify an antibody that reliably detects endogenous ENDOG and therefore tested our 483

ENDOG siRNA for its ability to prevent de novo expression of exogenous tagged 484

ENDOG. Using siRNA/plasmid DNA co-transfections, we observed that the ENDOG 485

siRNA reduced ENDOG-myc expression by 85% relative to treatment with a negative 486

control siRNA indicating that the siRNA targets the ENDOG transcript (Fig. 6C). Similar 487

suppression of EXOG-myc expression by the EXOG siRNA was also observed (68% 488

reduction, Fig. 6D). Importantly, the EXOG and ENDOG siRNAs specifically target their 489

respective transcripts (Figs. 6C and 6D). It therefore seems likely that the ENDOG 490

siRNA depletes endogenous ENDOG in a fashion similar to the effect of EXOG siRNA 491

on endogenous EXOG. 492

For the knockdown/mtDNA depletion experiments we pre-treated HeLa cells with 493

negative control (N.C.) siRNA, ENDOG siRNA, EXOG siRNA, or a mixture of ENDOG 494

and EXOG siRNAs for 48 hours. Cells were then trypsinized and reverse co-transfected 495

with additional siRNA and the indicated effector plasmids and mtDNA depletion was 496

evaluated 24 hours later using the PicoGreen live cell imaging assay. When tested 497

individually the ENDOG and EXOG siRNAs did not significantly affect mtDNA 498

depletion by UL12M185-G336A/S338A-SPA; however, concurrent knockdown of both 499

ENDOG and EXOG led to a 41% reduction of mtDNA depletion (P = 0.0001, Fig. 7). In 500

the case of nuclease-competent UL12.5-SPA, mtDNA depletion was significantly 501

inhibited by both ENDOG siRNA (27% reduction, P = 0.048) and EXOG siRNA (17% 502

reduction, P = 0.025), an effect that was enhanced by simultaneous knockdown of both 503

ENDOG and EXOG (47% reduction, P = 0.0015, Fig. 7). These data further implicate 504


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ENDOG and EXOG as playing key, and at least partially overlapping, roles in mediating 505

mtDNA loss triggered by UL12.5. It is important to note that the inhibition of mtDNA 506

depletion following ENDOG and EXOG knockdown is not complete, likely due at least 507

in part to incomplete loss of the target proteins. Additional studies using cells derived 508

from ENDOG/EXOG double knockout mice could address this possibility, if such mice 509

prove to be viable. 510

Possible mechanisms and outstanding questions 511

We have been unable to demonstrate a specific association between UL12.5-SPA 512

and ENDOG or EXOG by co-immunoprecipitation (data not shown). Therefore, we 513

cannot say with certainty that the endonuclease activity observed in our IP nuclease 514

assays is due to ENDOG or EXOG (Figs. 4C and 4F). It is possible that UL12.5 515

associates with these endogenous nucleases transiently or weakly thus precluding their 516

detection using western blotting. Alternatively, UL12.5 may indirectly enhance the 517

nuclease activity of ENDOG and EXOG against mtDNA. Recent studies on ENDOG and 518

EXOG have proposed that these enzymes have an important role in mtDNA maintenance 519

and repair (52, 61-63). In one particularly elegant study, ENDOG was demonstrated to be 520

the enzyme responsible for depleting Drosophila melanogaster mtDNA from developing 521

sperm which in turn promotes the maternal inheritance of mtDNA (61). This work 522

provides a clear example of the influence of ENDOG on mtDNA maintenance. 523

Mitochondria also contain DNA repair pathways similar to those found in the nucleus 524

which defend against genotoxic insults and oxidative damage (reviewed in 64). UL12 525

interacts with components of the host nuclear DNA repair MRN complex (36), therefore 526


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

it would be interesting to investigate if UL12.5 directly interacts with one or more 527

mtDNA repair proteins other than ENDOG and EXOG. 528

HSV infection also leads to rapid loss of mitochondrial mRNAs (mt-mRNAs) (8, 529

65), a process that is at least as rapid as mtDNA loss and depends on UL12 gene products 530

(8). Although UL12 orthologs EBV BGLF5 and KSHV SOX have been shown to 531

mediate cytoplasmic mRNA turnover (34, 66), HSV-1 UL12 does not appear to possess 532

this activity (34). It is interesting to note that ENDOG and EXOG both possess low levels 533

of RNase activity (26, 27). Indeed, earlier work on ENDOG had suggested that its RNase 534

activity generates the RNA primers for mtDNA replication (59). Thus, it is possible that 535

ENDOG and or EXOG directly degrade mt-mRNAs during HSV infection. Further 536

studies are required to test this possibility. 537

At this time it is still unknown what roles mtDNA depletion serve during HSV-1 538

replication or pathogenesis. Unfortunately, this question cannot be cleanly addressed 539

using the mutant forms of UL12.5 that we have studied here because these mutations also 540

inactivate the nuclease activity of full-length UL12 and hence severely reduce viral yields 541

(23, 29). We therefore are currently exploring strategies for generating HSV-1 isolates 542

that retain the nuclear functions of UL12 yet fail to deplete mtDNA. 543

544

FIGURE LEGENDS 545

FIG. 1. Carboxy-terminally tagged UL12- and UL12.5-derived expression constructs. (A) 546

Schematic of SPA-tagged proteins used in this study. The location of point and deletion 547

mutations, the MLS, conserved alkaline nuclease motifs I-VII (29), and the carboxy-548

terminal sequential peptide affinity (SPA) tag are indicated. (B) Expression of SPA-549


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

tagged constructs in transfected HeLa cells. Cells were transfected with the indicated 550

plasmids and harvested 24 hpt. Lysates were assessed for protein expression by 551

immunoblotting with the mouse anti-FLAG M2 antibody and chemiluminescent 552

detection. 553

554

FIG. 2. Mutations that disrupt nuclease activity do not affect mitochondrial localization. 555

Transfected HeLa cells were co-stained with rabbit anti-FLAG (red) and mouse anti-556

cytochrome c (green) and visualized using fluorescence microscopy. Colocalization of 557

SPA-tagged (containing three FLAG epitopes) proteins with the mitochondrial protein 558

cytochrome c are indicated in yellow. For clarity the DAPI channel has been omitted. 559

Scale bars = 10 µm. 560

561

FIG. 3. Some UL12.5 nuclease-deficient mutants retain the ability to cause mtDNA 562

depletion. (A) HeLa cells were co-transfected with empty vector (pMZS3F), UL12-SPA, 563

UL12.5-SPA, or UL12.5-SPA mutants and a plasmid expressing mOrange to identify 564

transfected cells. PicoGreen staining was used to identify mtDNA foci in live cells using 565

fluorescence microscopy at 48 hpt. Scale bars = 10 µm. (B) The extent of mtDNA 566

depletion was determined by scoring for the presence (not depleted) or absence (depleted) 567

of cytoplasmic PicoGreen staining in >100 randomly selected mOrange-positive cells. 568

Data from three separate experiments was averaged and standard error is indicated. 569

570

FIG. 4. Some nuclease-deficient mutants associate with cellular endonuclease activity in 571

transfected cells. (A) and (D) SPA-tagged proteins were immunoprecipitated from 572


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

transfected HeLa cells and visualized by immunoblotting with the rabbit anti-FLAG 573

antibody followed by infrared detection. Immunoprecipitates from Fig. 4A were 574

incubated with 50 ng linearized pUC19 (B) or 50 ng pEGFP-C1 (C) to visualize nuclease 575

activity. Samples are labeled as indicated in Fig. 4A. Plasmid DNA incubated in the 576

absence of immunoprecipitate (DNA only) is indicated as “-”. DNA was visualized using 577

SYBR Gold staining. (E) Immunoprecipitates from Fig. 4D were incubated with 20 ng 578

linearized pUC19 to visualize nuclease activity. Samples are labeled as indicated in Fig. 579

4D. Linearized pUC19 DNA incubated in the absence of immunoprecipitate (DNA only) 580

is indicated as “-”. DNA was visualized using SYBR Gold staining. (F) 581

Immunoprecipitates from Fig. 4D were also incubated with 50 ng circular pEGFP-C1 and 582

the resulting nicked plasmid DNA was radiolabeled using nick translation, separated by 583

agarose gel electrophoresis, and visualized using a phosphorimager. Samples are labeled 584

as indicated in Fig. 4D. pEGFP-C1 DNA incubated in the absence of immunoprecipitate 585

(DNA only) is indicated as “-”. Circular pEGFP-C1 DNA incubated in the absence of 586

immunoprecipitate and processed for nick translation without E. coli DNA polymerase I 587

is indicated as “-Pol”. 588

589

FIG. 5. Concurrent overexpression of nuclease-deficient ENDOG and EXOG inhibits 590

mtDNA depletion by a mutant UL12.5-SPA protein. (A) Expression of myc-tagged 591

constructs in transfected HeLa cells was visualized at 24 hpt. Lysates were assessed for 592

protein expression by immunoblotting with the rabbit anti-c-myc antibody and 593

chemiluminescent detection. (B) HeLa cells were co-transfected for 48 hours with empty 594

vector (pcDNA3.1) or plasmids expressing myc-tagged ENDOG, nuclease-deficient 595


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ENDOG (ENDOG-H141A), EXOG, nuclease-deficient EXOG (EXOG-H140A), or 596

inactive sirtuin 3 (Sirt3-H248Y) along with an empty vector (pMZS3F) or a plasmid 597

expressing UL12M185-G336A/S338A-SPA. MtDNA depletion was measured as described 598

in Fig. 3. Data are from four separate experiments except those data including the Sirt3 599

mutant which are from three separate experiments. All data were averaged and standard 600

error is indicated. Data denoted with * indicate statistical significance (P < 0.05) when 601

compared to the control (UL12M185-G336A/S338A-SPA/pcDNA) using a two-tailed t-test 602

with equal variance. 603

604

FIG. 6. Knockdown of ENDOG and EXOG using siRNA. (A) Endogenous EXOG 605

knockdown was measured in HeLa cells transfected with the indicated siRNAs. (B) 606

Lysates from HeLa cells transfected with the indicated siRNAs were separated into 607

cytoplasmic and mitochondrial fractions to visualize knockdown of EXOG in the 608

mitochondrial fraction. Alternatively, HeLa cells were co-transfected with the indicated 609

siRNAs and ENDOG-myc (C) or EXOG-myc (D) for 48 hours to verify siRNA function. 610

EXOG, ENDOG-myc, and EXOG-myc levels were quantitated following 611

immunoblotting and infrared detection. Data from three separate experiments were 612

averaged, plotted relative to actin, and normalized to the N.C. siRNA treatment. Standard 613

error is indicated. 614

615

FIG. 7. Knockdown of ENDOG and/or EXOG inhibits mtDNA depletion by UL12.5-616

SPA. HeLa cells co-transfected with the indicated siRNAs and either empty vector 617

(pMZS3F) or plasmids expressing UL12.5-SPA or UL12M185-G336A/S338A-SPA were 618


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

assessed for mtDNA depletion as described in Fig. 3. Data from three separate 619

experiments were averaged and standard error is indicated. Data denoted with * indicate 620

statistical significance (P < 0.05) when compared to the respective control (UL12M185-621

G336A/S338A-SPA/N.C. siRNA or UL12.5-SPA/N.C. siRNA) using a two-tailed t-test 622

with equal variance. 623

624

ACKNOWLEDGEMENTS 625

We thank Holly Saffran for technical assistance and Lori Frappier for the gift of pMZS3F 626

plasmid DNA. This research was funded by an operating grant from the Canadian 627

Institutes for Health Research to JRS (funding reference number: MOP 37995). BAD was 628

supported by a full-time studentship from Alberta Innovates-Health Solutions and a QEII 629

Graduate Scholarship from the Government of the Province of Alberta. JRS is a Canada 630

Research Chair in Molecular Virology (Tier I). 631

632

REFERENCES 633

1. Ohta A, Nishiyama Y. 2011. Mitochondria and viruses. Mitochondrion 11:1-634

12. 635

2. Galluzzi L, Kepp O, Trojel-Hansen C, Kroemer G. 2012. Mitochondrial 636

control of cellular life, stress, and death. Circ Res 111:1198-1207. 637

3. Bogenhagen D, Clayton DA. 1974. The number of mitochondrial 638

deoxyribonucleic acid genomes in mouse L and human HeLa cells. 639

Quantitative isolation of mitochondrial deoxyribonucleic acid. J Biol Chem 640

249:7991-7995. 641

4. Shmookler Reis RJ, Goldstein S. 1983. Mitochondrial DNA in mortal and 642

immortal human cells. Genome number, integrity, and methylation. J Biol 643

Chem 258:9078-9085. 644

5. Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, 645

Eperon IC, Nierlich DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden 646

R, Young IG. 1981. Sequence and organization of the human mitochondrial 647

genome. Nature 290:457-465. 648


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

6. Copeland WC. 2008. Inherited mitochondrial diseases of DNA replication. 649

Annu Rev Med 59:131-146. 650

7. Copeland WC. 2012. Defects in mitochondrial DNA replication and human 651

disease. Crit Rev Biochem Mol Biol 47:64-74. 652

8. Saffran HA, Pare JM, Corcoran JA, Weller SK, Smiley JR. 2007. Herpes 653

simplex virus eliminates host mitochondrial DNA. EMBO Rep 8:188-193. 654

9. Wiedmer A, Wang P, Zhou J, Rennekamp AJ, Tiranti V, Zeviani M, 655

Lieberman PM. 2008. Epstein-Barr virus immediate-early protein Zta co-656

opts mitochondrial single-stranded DNA binding protein to promote viral 657

and inhibit mitochondrial DNA replication. J Virol 82:4647-4655. 658

10. Corcoran JA, Saffran HA, Duguay BA, Smiley JR. 2009. Herpes simplex 659

virus UL12.5 targets mitochondria through a mitochondrial localization 660

sequence proximal to the N terminus. J Virol 83:2601-2610. 661

11. Costa RH, Draper KG, Banks L, Powell KL, Cohen G, Eisenberg R, Wagner 662

EK. 1983. High-resolution characterization of herpes simplex virus type 1 663

transcripts encoding alkaline exonuclease and a 50,000-dalton protein 664

tentatively identified as a capsid protein. J Virol 48:591-603. 665

12. Martinez R, Shao L, Bronstein JC, Weber PC, Weller SK. 1996. The product 666

of a 1.9-kb mRNA which overlaps the HSV-1 alkaline nuclease gene (UL12) 667

cannot relieve the growth defects of a null mutant. Virology 215:152-164. 668

13. Hoffmann PJ, Cheng YC. 1978. The deoxyribonuclease induced after 669

infection of KB cells by herpes simplex virus type 1 or type 2. I. Purification 670

and characterization of the enzyme. J Biol Chem 253:3557-3562. 671

14. Hoffmann PJ, Cheng YC. 1979. DNase induced after infection of KB cells by 672

herpes simplex virus type 1 or type 2. II. Characterization of an associated 673

endonuclease activity. J Virol 32:449-457. 674

15. Banks L, Purifoy DJ, Hurst PF, Killington RA, Powell KL. 1983. Herpes 675

simplex virus non-structural proteins. IV. Purification of the virus-induced 676

deoxyribonuclease and characterization of the enzyme using monoclonal 677

antibodies. J Gen Virol 64 (Pt 10):2249-2260. 678

16. Bronstein JC, Weber PC. 1996. Purification and characterization of herpes 679

simplex virus type 1 alkaline exonuclease expressed in Escherichia coli. J 680

Virol 70:2008-2013. 681

17. Reuven NB, Antoku S, Weller SK. 2004. The UL12.5 gene product of herpes 682

simplex virus type 1 exhibits nuclease and strand exchange activities but does 683

not localize to the nucleus. J Virol 78:4599-4608. 684

18. Martinez R, Sarisky RT, Weber PC, Weller SK. 1996. Herpes simplex virus 685

type 1 alkaline nuclease is required for efficient processing of viral DNA 686

replication intermediates. J Virol 70:2075-2085. 687

19. Shao L, Rapp LM, Weller SK. 1993. Herpes simplex virus 1 alkaline nuclease 688

is required for efficient egress of capsids from the nucleus. Virology 196:146-689

162. 690

20. Weller SK, Seghatoleslami MR, Shao L, Rowse D, Carmichael EP. 1990. The 691

herpes simplex virus type 1 alkaline nuclease is not essential for viral DNA 692

synthesis: isolation and characterization of a lacZ insertion mutant. J Gen 693

Virol 71 ( Pt 12):2941-2952. 694


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

21. Feederle R, Bannert H, Lips H, Muller-Lantzsch N, Delecluse HJ. 2009. The 695

Epstein-Barr virus alkaline exonuclease BGLF5 serves pleiotropic functions 696

in virus replication. J Virol 83:4952-4962. 697

22. Bronstein JC, Weller SK, Weber PC. 1997. The product of the UL12.5 gene 698

of herpes simplex virus type 1 is a capsid-associated nuclease. J Virol 699

71:3039-3047. 700

23. Henderson JO, Ball-Goodrich LJ, Parris DS. 1998. Structure-function 701

analysis of the herpes simplex virus type 1 UL12 gene: correlation of 702

deoxyribonuclease activity in vitro with replication function. Virology 703

243:247-259. 704

24. Zeghouf M, Li J, Butland G, Borkowska A, Canadien V, Richards D, Beattie 705

B, Emili A, Greenblatt JF. 2004. Sequential Peptide Affinity (SPA) system 706

for the identification of mammalian and bacterial protein complexes. J 707

Proteome Res 3:463-468. 708

25. Wang W, Malcolm BA. 1999. Two-stage PCR protocol allowing introduction 709

of multiple mutations, deletions and insertions using QuikChange Site-710

Directed Mutagenesis. Biotechniques 26:680-682. 711

26. Schafer P, Scholz SR, Gimadutdinow O, Cymerman IA, Bujnicki JM, Ruiz-712

Carrillo A, Pingoud A, Meiss G. 2004. Structural and functional 713

characterization of mitochondrial EndoG, a sugar non-specific nuclease 714

which plays an important role during apoptosis. J Mol Biol 338:217-228. 715

27. Cymerman IA, Chung I, Beckmann BM, Bujnicki JM, Meiss G. 2008. 716

EXOG, a novel paralog of Endonuclease G in higher eukaryotes. Nucleic 717

Acids Res 36:1369-1379. 718

28. Ahn BH, Kim HS, Song S, Lee IH, Liu J, Vassilopoulos A, Deng CX, Finkel 719

T. 2008. A role for the mitochondrial deacetylase Sirt3 in regulating energy 720

homeostasis. Proc Natl Acad Sci U S A 105:14447-14452. 721

29. Goldstein JN, Weller SK. 1998. The exonuclease activity of HSV-1 UL12 is 722

required for in vivo function. Virology 244:442-457. 723

30. Buisson M, Geoui T, Flot D, Tarbouriech N, Ressing ME, Wiertz EJ, 724

Burmeister WP. 2009. A bridge crosses the active-site canyon of the Epstein-725

Barr virus nuclease with DNase and RNase activities. J Mol Biol 391:717-726

728. 727

31. Dahlroth SL, Gurmu D, Schmitzberger F, Engman H, Haas J, Erlandsen H, 728

Nordlund P. 2009. Crystal structure of the shutoff and exonuclease protein 729

from the oncogenic Kaposi's sarcoma-associated herpesvirus. Febs J 730

276:6636-6645. 731

32. Kuchta AL, Parikh H, Zhu Y, Kellogg GE, Parris DS, McVoy MA. 2012. 732

Structural modelling and mutagenesis of human cytomegalovirus alkaline 733

nuclease UL98. J Gen Virol 93:130-138. 734

33. Horst D, Burmeister WP, Boer IG, van Leeuwen D, Buisson M, Gorbalenya 735

AE, Wiertz EJ, Ressing ME. 2012. The "Bridge" in the Epstein-Barr virus 736

alkaline exonuclease protein BGLF5 contributes to shutoff activity during 737

productive infection. J Virol 86:9175-9187. 738

34. Glaunsinger B, Ganem D. 2004. Lytic KSHV infection inhibits host gene 739

expression by accelerating global mRNA turnover. Mol Cell 13:713-723. 740


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

35. Draper KG, Devi-Rao G, Costa RH, Blair ED, Thompson RL, Wagner EK. 741

1986. Characterization of the genes encoding herpes simplex virus type 1 and 742

type 2 alkaline exonucleases and overlapping proteins. J Virol 57:1023-1036. 743

36. Balasubramanian N, Bai P, Buchek G, Korza G, Weller SK. 2010. Physical 744

interaction between the herpes simplex virus type 1 exonuclease, UL12, and 745

the DNA double-strand break-sensing MRN complex. J Virol 84:12504-746

12514. 747

37. Covarrubias S, Gaglia MM, Kumar GR, Wong W, Jackson AO, Glaunsinger 748

BA. 2011. Coordinated destruction of cellular messages in translation 749

complexes by the gammaherpesvirus host shutoff factor and the mammalian 750

exonuclease Xrn1. PLoS Pathog 7:e1002339. 751

38. Cummings OW, King TC, Holden JA, Low RL. 1987. Purification and 752

characterization of the potent endonuclease in extracts of bovine heart 753

mitochondria. J Biol Chem 262:2005-2015. 754

39. Gerschenson M, Houmiel KL, Low RL. 1995. Endonuclease G from 755

mammalian nuclei is identical to the major endonuclease of mitochondria. 756

Nucleic Acids Res 23:88-97. 757

40. Chattopadhyay R, Wiederhold L, Szczesny B, Boldogh I, Hazra TK, Izumi T, 758

Mitra S. 2006. Identification and characterization of mitochondrial abasic 759

(AP)-endonuclease in mammalian cells. Nucleic Acids Res 34:2067-2076. 760

41. Tell G, Crivellato E, Pines A, Paron I, Pucillo C, Manzini G, Bandiera A, 761

Kelley MR, Di Loreto C, Damante G. 2001. Mitochondrial localization of 762

APE/Ref-1 in thyroid cells. Mutat Res 485:143-152. 763

42. Tsuchimoto D, Sakai Y, Sakumi K, Nishioka K, Sasaki M, Fujiwara T, 764

Nakabeppu Y. 2001. Human APE2 protein is mostly localized in the nuclei 765

and to some extent in the mitochondria, while nuclear APE2 is partly 766

associated with proliferating cell nuclear antigen. Nucleic Acids Res 29:2349-767

2360. 768

43. Liu P, Qian L, Sung JS, de Souza-Pinto NC, Zheng L, Bogenhagen DF, Bohr 769

VA, Wilson DM, 3rd, Shen B, Demple B. 2008. Removal of oxidative DNA 770

damage via FEN1-dependent long-patch base excision repair in human cell 771

mitochondria. Mol Cell Biol 28:4975-4987. 772

44. Szczesny B, Tann AW, Longley MJ, Copeland WC, Mitra S. 2008. Long 773

patch base excision repair in mammalian mitochondrial genomes. J Biol 774

Chem 283:26349-26356. 775

45. Zheng L, Zhou M, Guo Z, Lu H, Qian L, Dai H, Qiu J, Yakubovskaya E, 776

Bogenhagen DF, Demple B, Shen B. 2008. Human DNA2 is a mitochondrial 777

nuclease/helicase for efficient processing of DNA replication and repair 778

intermediates. Mol Cell 32:325-336. 779

46. Szczesny RJ, Hejnowicz MS, Steczkiewicz K, Muszewska A, Borowski LS, 780

Ginalski K, Dziembowski A. 2013. Identification of a novel human 781

mitochondrial endo-/exonuclease Ddk1/c20orf72 necessary for maintenance 782

of proper 7S DNA levels. Nucleic Acids Res 41:3144-3161. 783

47. Dake E, Hofmann TJ, McIntire S, Hudson A, Zassenhaus HP. 1988. 784

Purification and properties of the major nuclease from mitochondria of 785

Saccharomyces cerevisiae. J Biol Chem 263:7691-7702. 786


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

48. Zassenhaus HP, Hofmann TJ, Uthayashanker R, Vincent RD, Zona M. 1988. 787

Construction of a yeast mutant lacking the mitochondrial nuclease. Nucleic 788

Acids Res 16:3283-3296. 789

49. Chow TY, Fraser MJ. 1983. Purification and properties of single strand 790

DNA-binding endo-exonuclease of Neurospora crassa. J Biol Chem 791

258:12010-12018. 792

50. Ruiz-Carrillo A, Renaud J. 1987. Endonuclease G: a (dG)n X (dC)n-specific 793

DNase from higher eukaryotes. Embo J 6:401-407. 794

51. Widlak P, Li LY, Wang X, Garrard WT. 2001. Action of recombinant 795

human apoptotic endonuclease G on naked DNA and chromatin substrates: 796

cooperation with exonuclease and DNase I. J Biol Chem 276:48404-48409. 797

52. McDermott-Roe C, Ye J, Ahmed R, Sun XM, Serafin A, Ware J, Bottolo L, 798

Muckett P, Canas X, Zhang J, Rowe GC, Buchan R, Lu H, Braithwaite A, 799

Mancini M, Hauton D, Marti R, Garcia-Arumi E, Hubner N, Jacob H, 800

Serikawa T, Zidek V, Papousek F, Kolar F, Cardona M, Ruiz-Meana M, 801

Garcia-Dorado D, Comella JX, Felkin LE, Barton PJ, Arany Z, Pravenec M, 802

Petretto E, Sanchis D, Cook SA. 2011. Endonuclease G is a novel 803

determinant of cardiac hypertrophy and mitochondrial function. Nature 804

478:114-118. 805

53. Huang KJ, Ku CC, Lehman IR. 2006. Endonuclease G: a role for the enzyme 806

in recombination and cellular proliferation. Proc Natl Acad Sci U S A 807

103:8995-9000. 808

54. Huang KJ, Zemelman BV, Lehman IR. 2002. Endonuclease G, a candidate 809

human enzyme for the initiation of genomic inversion in herpes simplex type 810

1 virus. J Biol Chem 277:21071-21079. 811

55. Parrish J, Li L, Klotz K, Ledwich D, Wang X, Xue D. 2001. Mitochondrial 812

endonuclease G is important for apoptosis in C. elegans. Nature 412:90-94. 813

56. Cote J, Renaud J, Ruiz-Carrillo A. 1989. Recognition of (dG)n.(dC)n 814

sequences by endonuclease G. Characterization of the calf thymus nuclease. J 815

Biol Chem 264:3301-3310. 816

57. Li LY, Luo X, Wang X. 2001. Endonuclease G is an apoptotic DNase when 817

released from mitochondria. Nature 412:95-99. 818

58. Schwer B, North BJ, Frye RA, Ott M, Verdin E. 2002. The human silent 819

information regulator (Sir)2 homologue hSIRT3 is a mitochondrial 820

nicotinamide adenine dinucleotide-dependent deacetylase. J Cell Biol 821

158:647-657. 822

59. Cote J, Ruiz-Carrillo A. 1993. Primers for mitochondrial DNA replication 823

generated by endonuclease G. Science 261:765-769. 824

60. Tiranti V, Rossi E, Ruiz-Carrillo A, Rossi G, Rocchi M, DiDonato S, Zuffardi 825

O, Zeviani M. 1995. Chromosomal localization of mitochondrial 826

transcription factor A (TCF6), single-stranded DNA-binding protein (SSBP), 827

and endonuclease G (ENDOG), three human housekeeping genes involved in 828

mitochondrial biogenesis. Genomics 25:559-564. 829

61. DeLuca SZ, O'Farrell PH. 2012. Barriers to male transmission of 830

mitochondrial DNA in sperm development. Dev Cell 22:660-668. 831


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

62. Dzierzbicki P, Kaniak-Golik A, Malc E, Mieczkowski P, Ciesla Z. 2012. The 832

generation of oxidative stress-induced rearrangements in Saccharomyces 833

cerevisiae mtDNA is dependent on the Nuc1 (EndoG/ExoG) nuclease and is 834

enhanced by inactivation of the MRX complex. Mutat Res 740:21-33. 835

63. Tann AW, Boldogh I, Meiss G, Qian W, Van Houten B, Mitra S, Szczesny B. 836

2011. Apoptosis induced by persistent single-strand breaks in mitochondrial 837

genome: critical role of EXOG (5'-EXO/endonuclease) in their repair. J Biol 838

Chem 286:31975-31983. 839

64. Kazak L, Reyes A, Holt IJ. 2012. Minimizing the damage: repair pathways 840

keep mitochondrial DNA intact. Nat Rev Mol Cell Biol 13:659-671. 841

65. Latchman DS. 1988. Effect of herpes simplex virus type 2 infection on 842

mitochondrial gene expression. J Gen Virol 69 ( Pt 6):1405-1410. 843

66. Rowe M, Glaunsinger B, van Leeuwen D, Zuo J, Sweetman D, Ganem D, 844

Middeldorp J, Wiertz EJ, Ressing ME. 2007. Host shutoff during productive 845

Epstein-Barr virus infection is mediated by BGLF5 and may contribute to 846

immune evasion. Proc Natl Acad Sci U S A 104:3366-3371. 847

848

849


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

TABLE 1. Oligonucleotides used to generate expression plasmids for this study

Primer name Sequence (5’s3’)a

F1 ……………………………………. GGAATTCCGCCACCATGGAGTCCACGGGAGGCC

F2 ……………………………………. GGAATTCCGCCACCATGTGGTCGGCGTCGGTGAT

F3 ……………………………………. GGAATTCCGCCACCATGGTGGACCGCGGACTCGG

F4 ……………………………………. CGAGACGTTCGAGCGCCACAAACGCGGGTTGCTGC

F5 ……………………………………. CGAATTCCGCCACCATGCACCTGCGCGGG

F6 ……………………………………. GGTATGGTGGACGCATATGCACCCCTCATGGGG

F7 ……………………………………. AGAATTCCGCCACCATGCACCTGCGCGG

F8 ……………………………………. GGAATTCCGCCACCATGGTGGACCGCGGACTCGG

F9 ……………………………………. TAGTCGAATTCCGCCACCATGCGGGCGCTGCG

F10 …………………………………... TACGGATCCCGCCACCATGGCTATCAAGAGTATCGCTTCCCG

F11 …………………………………... CCGCGGTGCCCTGGCC

F12 …………………………………... GTCACGAGGAGCCATGGCTCCAG

R1 …………………………………… CCTCTAGAGCCTACTTGTCATCGTCATCCTTGTAGTCG

R2 …………………………………… GGCACAGCCTCAGGTCACTACTTGTCATCGTCATCC

R3 …………………………………… GCAGCAACCCGCGTTTGTGGCGCTCGAACGTCTCG

R4 …………………………………… CCCGCGCAGGTGCATGGTGGCGGAATTCG

R5 …………………………………… CCCCATGAGGGGTGCATATGCGTCCACCATACC

R6 …………………………………… CCGATATCTCAATCGATGCGGACGGGGGTAATG

R7 …………………………………… GGGGTACCGCGAGACGACCTCCCCGTCGTCGGTG

R8 …………………………………… GGGGTACCATCGATGCGGACGGGGGTAATGATCAGGGCGATCG

R9 …………………………………… AGCAAGCTTCTTACTGCCCGCCGTGATGG

R10 ………………………………….. TGCAAGCTTGGATGGCTTTCTTATCTGGGTTCCTGA

R11 ………………………………….. GGCCAGGGCACCGCGG

R12 ………………………………….. CTGGAGCCATGGCTCCTCGTGAC

a Start/stop codons are indicated in bold italics, point mutations/insertions are indicated in bold,

and restriction sites are underlined.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

mitochondrial nucleases endog and exog participate in

Documents