molecular analyses support the safety and activity of ......jun 26, 2018 · toca 511 (vocimagene...

1

Molecular Analyses Support the Safety and Activity of Retroviral Replicating

Vector Toca 511 in Patients

Daniel J. Hogan1*, Jay-Jiguang Zhu2, Oscar R. Diago1, Dawn Gammon1, Ali Haghighi1, Guangrong

Lu2, Asha Das1, Harry E. Gruber1, Douglas J. Jolly1and Derek Ostertag1*

1. Tocagen Inc., 4242 Campus Point Court, Suite 500 San Diego, CA 92121

2. The University of Texas Health Science Center at Houston, McGovern Medical School, 6400

Fannin St, Houston, TX 77030

*Corresponding Authors: [email protected], [email protected]

Tocagen Inc., R&D Discovery Medicine, 4242 Campus Point Court, Suite 500 San Diego, CA

92121

Running title: Toca 511 molecular monitoring in patients

Keywords: Toca 511, retroviral replicating vector, gene therapy, immuno-oncology,

glioblastoma, insertional mutagenesis, APOBEC

Authors’ disclosures of potential conflicts of interest:

DJH, ORD, DG, AH, AD, HEG, DJJ and DO are employees of Tocagen Inc. and own stock in the company.

HEG and DJJ are founders of Tocagen Inc.

DJH, HEG, DJJ and DO have filed patents related to Toca 511 that are owned by Tocagen Inc.

Abbreviations:

Research. on May 27, 2021. © 2018 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on June 26, 2018; DOI: 10.1158/1078-0432.CCR-18-0619

mailto:[email protected]


http://clincancerres.aacrjournals.org/

2

5-FU: 5-Fluorouracil, 5-FC: 5-Fluorocytosine, Toca FC: Toca 5-Fluorocytosine, yCD2: yeast

cytosine deaminase version 2, HGG: high grade glioma, gRV: gamma-retrovirus, RRV: retroviral

replicating vector, RNV: retroviral non-replicating vector, MLV: murine leukemia virus, HSC:

hematopoietic stem cell, IV: intravenous, SCID: Severe combined immunodeficiency, LTR: long-

terminal repeat, qPCR: quantitative PCR, TSS: transcription start site, LLOQ: Lower Limit of

Quantification, SNV: single nucleotide variant, indel: insertion and deletion, GBM: glioblastoma

multiforme, CSF: cerebral spinal fluid, MOI: multiplicity of infection




3

ABSTRACT

Purpose: Toca 511 is a gammaretroviral replicating vector encoding cytosine deaminase that

selectively infects tumor cells and coverts the antifungal drug 5-fluorocytosine into the

antineoplastic drug 5-fluorouracil, which directly kills tumor cells and stimulates anti-tumor

immune responses. As part of clinical monitoring of Phase 1 clinical trials in recurrent high

grade glioma we have performed extensive molecular analyses of patient specimens in order to

track vector fate.

Experimental Design: Toca 511 and Toca FC (extended-release 5-fluorocytosine) have been

administered to 127 high grade glioma patients across three phase I studies. We measured

Toca 511 RNA and DNA levels in available body fluids and tumor samples from patients to

assess tumor specificity. We mapped Toca 511 integration sites and sequenced integrated Toca

511 genomes from patient samples with detectable virus. We measured Toca 511 levels in a

diverse set of tissue samples from one patient.

Results: Integrated Toca 511 is commonly detected in tumor samples and is only transiently

detected in blood in a small fraction of patients. There was no believable evidence for clonal

expansion of cells with integrated Toca 511 DNA, or preferential retrieval of integration sites

near oncogenes. Toca 511 sequence profiles suggest most mutations are caused by APOBEC

cytidine deaminases acting during reverse transcription. Tissue samples from a single whole-

body autopsy affirm Toca 511 tumor selectivity.




4

Conclusions: Toca 511 and Toca FC treatment was not associated with inappropriate integration

sites and clonal expansion. The vector is tumor selective and persistent in patients who

received Toca 511 injections.

Statement of Translational Relevance

Retroviral replicating vectors (RRVs) are potential therapies for a wide range of

oncological malignancies, with ongoing durable responses and multiyear survival outcomes for

some recurrent high grade glioma patients in a phase 1 trial. Detailed characterization including

viral presence in biological fluids and cancer cells, viral insertion site location and clonality, as

well as viral sequence stability are important to support future approval of biologic therapies

built on RRVs. Previous treatment-related adverse events, including lymphomas, in some

clinical trials with distinct non-replicating retroviral vectors were preceded by clonal expansion

of infected cells due to integration near a proto-oncogene. As part of our ongoing development

of RRV Toca 511 in recurrent high grade glioma, we performed extensive monitoring of the

virus in patient tumors and body fluids, including Toca 511 quantitation, integration site

identification and mutation profile characterization. Our results support the favorable safety

profile of Toca 511 and expansion of clinical trials into other indications. Moreover, this work

provides a broad framework for molecular monitoring of RRV therapies during clinical

development.




5

INTRODUCTION

Given the limits of conventional cancer treatments, retroviral replicating vectors (RRVs)

have emerged as a potential backbone for useful therapies across a wide range of oncological

malignancies. RRVs selectively infect tumor cells without directly lysing them. This differentiates

them from directly oncolytic and highly inflammatory viruses such as adenovirus and herpes

viruses (1-3). Thus, RRVs provide a platform for therapies based on tumor-specific gene delivery

strategies without the inherent limitation of rapidly killing infected cells. RRV are selective for

tumor cells partially due to virus-selective advantages in the tumor microenvironment from

blunted innate immune responses as well as suppressed adaptive immune responses relative to

normal dividing cells (3-6). Viral dependency on mitosis for integration contributes to cancer

cell selectivity (7), and the non-inflammatory nature of the infection (and replication

competency) allows subsequent spread (8).

Toca 511 (vocimagene amiretrorepvec) is a RRV derived from a murine gammaretrovirus

(gRV), with an amphotropic envelope to allow infection of human cells. Such viruses are known

to be non-pathogenic to humans (9), and all adult humans so far tested appear to be

seropositive (10,11). The modified Toca 511 virus encodes a transgene for an optimized yeast

cytosine deaminase (yCD2) that converts the orally available prodrug 5-fluorocytosine (5-FC)

into cytotoxic 5-fluorouracil (5-FU) (12-14).

Three phase I clinical trials, NCT01156584 (Study 8), NCT01470794 (Study 11) and

NCT01985256 (Study 13), evaluated safety of Toca 511 and Toca FC (an extended-release

formulation of 5-FC) therapy in patients with recurrent high grade glioma (HGG) by different

routes of Toca 511 administration, followed by oral Toca FC dosing. In Study 8, Toca 511 was




6

administered by injection into the tumor, without resection. In Study 11, tumor resection was

performed, followed by multiple injections of Toca 511 into the tissue walls of the resection

cavity (9). In Study 13, intravenous (IV) administration of Toca 511 (bolus injections for one,

three or five consecutive days) was followed by surgical resection plus additional injections of

Toca 511 into the tissues of the resection cavity eight to fourteen days later (clinical results

from Study 13 will be presented elsewhere). For all trials, four to six weeks after the final Toca

511 administration, patients were treated with Toca FC for approximately one week, in

repeated cycles, every four to eight weeks, for six months, or until radiological evidence of

tumor progression, clinical progression, or termination by treating physicians (Fig. 1A).

Historical safety concerns are associated with different retroviral non-replicative vectors

(RNVs). For instance, RNV preparations grossly contaminated with replicative murine leukemia

virus (MLV) derived from recombination during serial passage through ecotropic and

amphotropic murine cell derived packaging cell lines were employed for ex vivo transduction of

hematopoietic stem cells (HSCs) followed by autologous transplant into monkeys (15,16). Three

of ten monkeys so treated, that were unable to develop antiviral immune responses, developed

lymphomas containing multiple copies of an array of MLV related sequences in the tumor

genomes. A second source of concern was the observation, following transplant of autologous

cytokine-stimulated HSCs transduced ex vivo with RNV, of delayed occurrence of lymphoma in

some clinical trial patients several years after treatment (17-19). T-cell lymphoma was linked to

treatment of X-linked Severe Combined Immune Deficiency Syndrome (X-SCIDS) and Wisckott-

Aldrich Syndrome (WAS), which in turn was linked to insertions near the promoter for LMO2,

leading to its ectopic expression. Myelodysplastic Syndrome was linked to treatment of Chronic




7

Granulomatous Disease and insertion and activation of MDS-EVI-1 oncogene (19,20). However,

a therapy based on RNV transduction and reimplantation of autologous HSCs for ADA deficient

SCIDS has not shown such side effects, and was recently approved for sale in Europe (Strimvelis,

GSK Ltd.) (18). Additionally, long-term outcomes with persistent RNV transduced T-cells have

also failed to show such side effects (21). These observations suggest that such adverse

outcomes are influenced by factors including multiplicity of infection, nature of the transgene,

indication, clinical condition and age of the recipient, expected mechanism of action of the

transgene and target tissue (17,22).

Several methodologies have been developed to track the fate of viral vectors in

patients. Viral RNA and DNA levels can be measured over a broad dynamic range with

quantitative PCR (qPCR). Viral integration sites, originally identified by Sanger sequencing of

cloned PCR products (23), can be systematically mapped via next-generation sequencing (24-

26).

While previous gRV trials used RNVs, often transducing autologous cells ex vivo, Toca

511 is a RRV used to infect cancer cells in vivo. Thus, host immunity to viral proteins and virus-

host restriction factor interactions may influence Toca 511 spread and activity (27). For

instance, APOBEC proteins target a number of retroviruses in humans, causing G to A

hypermutation via processive cytidine deamination during reverse transcription (28,29). The

influence of APOBEC proteins on Toca 511 in patient samples can be measured via next-

generation sequencing. Additionally, RNVs (unlike RRVs) usually lack genes to produce viral

proteins that could eventually stimulate immune responses against infected cells. Thus, Toca




8

511 therapy requires an overlapping but distinct set of assays for molecular monitoring than

used in RNV trials.

In this study we report results of Toca 511 monitoring in blood and tumor samples from

patients who received Toca 511 through direct injection into the resection cavity (Study 11) and

IV delivery (Study 13) 8 to 14 days prior to tumor removal (additional Toca 511 is delivered via

direct injection into the resection cavity), as well as analyses of tissue from a full autopsy of a

patient that participated in a phase 2 clinical study (NCT02414165) and received Toca 511

injection into the HGG resection cavity. Our monitoring methods include Toca 511

quantification, identification of genome integration sites and mutation profiles of Toca 511

genomes from available Toca 511-positive tumor tissue and blood cells. This work provides

molecular and genomic corollaries to traditional safety assessments and presents a framework

for clinical monitoring of RRV therapies during initial development, allowing for continued

confidence in using such vectors in patients.



http://stm.sciencemag.org/lookup/external-ref?link_type=CLINTRIALGOV&access_num=NCT02414165&atom=%2Fscitransmed%2F8%2F341%2F341ra75.atom


9

MATERIALS AND METHODS

Toca 511 quantification

DNA and RNA Purification

DNA and RNA were extracted from the same source (tumor or whole blood) using a

modified version of Promega’s Maxwell 16 Purification System as communicated by the

manufacturer. Tumor sections were minced in petri plates on dry ice and transferred into 1.5

mL microfuge tubes. 500 L of homogenization/1-thioglycerol solution were added into each

tube and the test articles were agitated with pestles (VWR: Cat #47747-366) followed by

vortexing at full speed for 30 sec. For whole blood DNA and RNA purification, up to 200 L of

whole blood (brought to 200 L with PBS if necessary) was transferred into 1.5 mL microfuge

tubes. 300 L of homogenization/1-thioglycerol solution was added to the tube and vortexed at

full speed for 30 sec. In each case 300 L of the homogenate was transferred into Maxwell 16

DNA Purification cartridges and subjected to automated DNA purification. Purified DNA was

eluted in 300 L of nuclease-free water. For RNA purification, 200 l of lysis buffer was added

into the 1.5 mL microfuge tubes containing the remaining 200 L of the original 500 L

homogenate. Test articles were vortexed for 30 sec and the full volume was transferred into

Promega’s Maxwell 16 simplyRNA Purification cartridges. Automated RNA purification was

carried out and purified RNA was eluted in 50 L of nuclease-free water. RNA purification from

plasma, urine, and saliva and IHC of CD gene were described previously (4).

qPCR




10

TaqMan probe-based qPCR was performed as single-targeted 20 μL reactions for Study

11 test articles and as multiplex reactions for Study 13 test articles. The reactions were

prepared in triplicate, on a CFX96 or CFX384 Real Time System (Bio-Rad) using primers and

probes annealing to sequences in the long terminal repeat region of Toca 511 or in the yCD2

transgene (monoplex) or in sequences in the amphotropic MLV4070A ENV, POL and yCD2

transgene (multiplex). Primers and probes were designed with PrimerQuest software and

synthesized by Integrated DNA Technologies. For qPCR detection of gRV-specific sequences,

primers were used at final concentration of 300 nM each of MLV-F (5’- AGC CCA CAA CCC CTC

ACT C-3’) and MLV-R (5’- TCT CCC GAT CCC GGA CGA-3’), and 100 nM of MLV hydrolysis probe

(5’- FAM-CCC CAA ATG AAA GAC CCC CGC TGA CG-3’BHQ_1) with iQ PCR Supermix (Bio-Rad).

For qPCR detection of yCD2, primers were used at 600 nM each of yCD2-F (5’-ATC ATC ATG TAC

GGC ATC CCT AG-3’) and yCD2-R (5’-TGA ACT GCT TCA TCA GCT TCT TAC-3’), and 100 nM of

yCD2 hydrolysis probe (5’-FAM/TCA TCG TCA ACA ACC ACC ACC TCG T/3’BHQ_1). For

simultaneous qPCR detection of POL, ENV and yCD2 the following concentrations were used:

300 nM each of Pol2-F (5’-CAA GGG GCT ACT GGA GGA AAG-3’) and Pol2-R (5’-CAG TCT GGT

ACA TGG AGG AAA G-3’); 100 nM of Pol2 hydrolysis probe (5’-HEX/TAT CGC TGG ACC ACG GAT

CGC AA/ 3’BHQ_1); 300 nM each of Pol3-F (5’-CGA CAC CAG ACT AAG AAC CTA G-3’) and Pol3-R

(5’-CGA TGC CGT CTA CTT TGA GG-3’); 100 nM of Pol3 hydrolysis probe (5’-HEX/CCT CGC TGG

AAA GGA CCT TAC ACA/ 3’IABkFQ); 300 nM each of Env2-F (5’-ACC CTC AAC CTC CCC TAC AAG

T-3’) and Env2-R (5’-GTT AAG CGC CTG ATA GGC TC-3’); 100 nM of Env2 hydrolysis probe (5’-

TEX615/AGC CAC CCC CAG GAA CTG GAG ATA GA/3’BHQ_2); 300 nM each of yCD2-F (5’-ATC

ATC ATG TAC GGC ATC CCT AG-3’) and yCD2-R (5’-TGA ACT GCT TCA TCA GCT TCT TAC-3’); and




11

100 nM of yCD2 hydrolysis probe (5’-FAM/TCA TCG TCA ACA ACC ACC ACC TCG T/3’BHQ_1).

Either the Pol2 or Pol3 primer/probe set was used as a component in the triplex reaction.

Thermal cycling conditions consisted of 95°C for 5 min, followed by three cycles of 95°C

for 15 sec and 65°C for 10 sec, followed by 38 cycles of 95°C for 15 sec and 65°C for 30 sec. CFX

Manager 3.0 software (Bio-Rad) was used to calculate threshold cycle (Ct) values. Technical

replicates were averaged and absolute quantification was determined from linear regression

using a six-log serial dilution standard curve (25 to 2.5e6 copies/reaction) from a Toca 511-

containing plasmid, pAZ3-yCD2.

RT-qPCR

TaqMan probe-based RT-qPCR was performed as single-targeted 20 l reactions for

Study 11 test articles and as multiplex reactions for Study 13 test articles. The reactions were

prepared in triplicate using primers and probes annealing to sequences in POL (monoplex) or to

sequences in the amphotropic MLV4070A ENV, POL and yCD2 (multiplex).

For simultaneous RT-qPCR detection of POL, ENV and yCD2 in a single reaction, primers

were used at 300 nM each of Pol2-F (5’-CAA GGG GCT ACT GGA GGA AAG-3’) and Pol2-R (5’-

CAG TCT GGT ACA TGG AGG AAA G-3’); 100 nM of Pol2 hydrolysis probe (5’-HEX/TAT CGC TGG

ACC ACG GAT CGC AA/ 3’BHQ_1); 300 nM each of Pol3-F (5’-CGA CAC CAG ACT AAG AAC CTA G-

3’) and Pol3-R (5’-CGA TGC CGT CTA CTT TGA GG-3’); 100 nM of Pol3 hydrolysis probe (5’-

HEX/CCT CGC TGG AAA GGA CCT TAC ACA/ 3’IABkFQ); 300 nM each of Env2-F (5’-ACC CTC AAC

CTC CCC TAC AAG T-3’) and Env2-R (5’-GTT AAG CGC CTG ATA GGC TC-3’); 100 nM of Env2

hydrolysis probe (5’-TEX615/AGC CAC CCC CAG GAA CTG GAG ATA GA/3’BHQ_2); 300 nM each




12

of yCD2-F (5’-ATC ATC ATG TAC GGC ATC CCT AG-3’) and yCD2-R (5’-TGA ACT GCT TCA TCA GCT

TCT TAC-3’); and 100 nM of yCD2 hydrolysis probe (5’-FAM/TCA TCG TCA ACA ACC ACC ACC TCG

T/3’BHQ_1) were used with AgPath-ID One-Step RT-PCR Reagent (Life Technologies) (either the

Pol2 or Pol3 primer/probe set was used as a component in the triplex reaction).

Thermal cycling conditions consisted of 46°C for 20 min, followed by 95°C for 10 min,

followed by 40 cycles of 95°C for 15 sec and 55°C for 45 sec. Absolute quantification was

determined from linear regression on a seven-log serial dilution RNA standard curve (2.55e2 to

2.55e8 copies/mL) purified from Toca 511 viral vector containing the corresponding targets that

underwent RT-qPCR in parallel with the test articles. The Toca 511 standard was originally

qualified by comparison with an in vitro synthesized RNA standard quantified by absorbance at

260 nm.

Identification of Toca 511 Integration Sites

Preparation of Sequencing Libraries

100-1000 ng of genomic DNA (isolated as described above) was sheared using Covaris

E220 to 300 bp peak size. Following cleanup with Ampure XP beads (Beckman Coulter), DNA

was end repaired (End-It™ DNA End-Repair Kit, Epicentre), a 3’ overhang A was added

(NEBNext® dA-Tailing Module, New England Biolabs), and partially double stranded adaptors

(Adaptor1 + Adaptor 2) were ligated with T4 ligase (Quick Ligation™ Kit, NEB). Two rounds of

PCR were performed using NEBNext® High-Fidelity 2X PCR Master Mix. The second round of

PCR included primers with barcoded Illumina adaptors. Following clean-up with Ampure XP




13

beads, libraries were quantified by qPCR and Qubit (Thermo Fisher) and pooled for paired-end

sequencing on Miseq or Hiseq 2000.

Oligonucleotides (ordered from IDT):

Adaptor1: 5’-

GTAATACGACTCACTATAGGCTTTCAGACGTGTGCTCTTCCGATCT(NNNNNNN)GCTCCGCTTAAGGGA

CT-3’

Adaptor2: 5’-/5Phos/GTC CCT TAA GCG GAG /3AmMO/-3’

Adaptors 1 and 2 were mixed at equimolar concentrations, annealed and used in ligation

reactions at ~10X molar excess to sheared DNA.

Toca511_PCR1: 5’-CCTTGGGAGGGTCTCCTCTGAGT-3’

Linker_PCR1: 5’-GTAATACGACTCACTATAGGCT-3’

Toca511_PCR2:5’-

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACCATGACTAC

CCGTCAGCGGGGGTC-3’

Linker_PCR2: 5’-CAAGCAGAAGACGGCATACGAGAT(6mer barcode)

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’

Processing of Sequencing Data

Paired fastq files were processed using Cutadapt 1.1 (48):




14

cutadapt -e 0.05 -g TGACCATGACTACCCGTCAGCGGGGGTCTTTCATTAGTCCCTTAAGCGGAGC --

discard-trimmed -O 17 -o tmp1.1.fastq -p tmp1.2.fastq fastq1 fastq2

cutadapt -e 0.05 -g TGACCATGACTACCCGTCAGCGGGGGTCTTTCATTTGGGGG --discard-trimmed

-O 17 -o tmp2.1.fastq -p tmp2.2.fastq tmp1.1.fastq tmp1.2.fastq

cutadapt -e 0.05 -g TGACCATGACTACCCGTCAGCGGGGGTC --discard-untrimmed -O 17 -o

tmp3.1.fastq -p tmp3.2.fastq tmp2.1.fastq tmp2.2.fastq

cutadapt -e 0.00 -g ^TTTCA --no-indels --discard-untrimmed -o tmp4.1.fastq -p tmp4.2.fastq

tmp3.1.fastq tmp3.2.fastq

cutadapt -e 0.05 -a AGTCCCTTAAGCGGAGC -O 10 -m 11 -o tmp5.1.fastq -p tmp5.2.fastq

tmp4.1.fastq tmp4.2.fastq

cutadapt -e 0.05 -g GCTCCGCTTAAGGGACT --discard-untrimmed -O 10 -m 11 -o tmp6.2.fastq -p

tmp6.1.fastq tmp5.2.fastq tmp5.1.fastq

cutadapt -e 0.05 -a TGAAAGACCCCCGCTGACGGGTAGTCATGGTCA -O 10 -m 11 -o tmp7.2.fastq -

p tmp7.1.fastq tmp6.2.fastq tmp6.1.fastq

Trimmed and filtered fastq files were mapped to the human (hg19) and Toca 511

genomes using Bowtie2 (for human genome: -q -X 2000 --no-mixed --no-discordant --no-unal --

score-min L,0,-0.4)(49). Sorted BAM files were filtered to remove read pairs in which at least

one of the reads contained at least two mismatches to the reference genome in the first ten

bases using RSamtools (50). Filtered BAM files were converted to BED files (Bedtools) (51) and

read pairs with the same start and end positions (+/- 2 bp) were collapsed. We removed read

pairs that shared the same integration site but that had a different fragmentation site in cases




15

in which the fragmentation read site accounted for less than 1% of total integration events at

this site; we did this because we found that most (or all) cases were likely due to spurious PCR

products created from PCR duplicates of a single integration event. Integration sites that

contained sequence motifs enriched in sequences adjacent to integration sites from negative

controls, identified using HOMER2, were removed (52). These motifs contained matches to the

3’ end of Toca511 PCR_2 primer and/or the Toca 511 integration footprint (TTTCA). Finally, we

filtered out integration events in which another sample had the same integration site and

fragmentation site in at least 100X greater abundance, which was likely due to index primer

misidentification during sequencing. The locations of integration sites can be found in Dataset

S2.

Other Integration Analyses

We used Bedtools to identify EMSEMBL transcripts adjacent to integration sites. Gene

functional enrichment analyses were performed with Metascape (53). Cancer gene lists were

downloaded from supplementary material associated with Vogelstein et al. (54) and from

Bushman lab website: http://www.bushmanlab.org/links/genelists. The hypergeometric density

distribution was used to test for the significance of overlap between gene lists.

Toca 511 Sequencing

Full-Length PCR for Sequencing

PCR for full-length amplification of Toca 511 was performed as primary reactions

followed by nested reactions using LongRange PCR Kit (Qiagen). Primary PCRs (9197 bp) were



http://www.bushmanlab.org/links/genelists


16

executed using primers targeting the flanking long terminal repeat regions of Toca 511 at 400

nM each: Tri Set 1-Forward (5’- GACTTGTGGTCTCGCTGTTCCTT-3’) and Tri Set 3-Reverse (5’-

GAGTGAGGGGTTGTGGGCTCT-3’). Primers for nested PCRs (8349 bp) were designed to anneal

internally to the primary amplicons and were used at 400 nM each: 5’ Long PCR Sequencing

Primer-Forward (5-TGGTAGGAGACGAGAACCTAAA-3’) and 3’ UCLA 3-37 IRES-Reverse (5’-

CCCCTTTTTCTGGAGACTAAATAA-3’). Genomic DNA (up to 400 ng) for the primary PCR or

primary PCR reaction (1 L) for the nested PCR, Long Mix buffer (containing 25 mM MgCl2),

dNTPs (500 μM each), DMSO (2%), primers (400 nM), and LongRange Enzyme Mix (1 U) were

combined and PCRs initiated. Primary PCR: thermal cycling conditions consisted of one cycle of

93°C for 3 min, 20 cycles of 93°C for 15 sec, 55°C for 30 sec, 68°C for 9 min, followed by one

cycle of 93°C for 15 sec, 55°C for 30 sec, 68°C with 20 sec incremental increases from previous

time, for an additional 15 cycles. Nested PCR: thermal cycling conditions consisted of one cycle

of 93°C for 3 min, 35 cycles of 93°C for 15 sec, 60°C for 30 sec, 68°C for 8 min.

Tripartite PCR for Sequencing

PCR for tripartite amplification of Toca 511 was performed with three sets of

overlapping primers. Primers were utilized at 150 or 400 nM each: upstream sequence (2356

bp), 713_LTR Set 2-forward (5’-CGGGGGTCTTTCATTTGGGG-3’) and Tri Set 1-Reverse

(5’ACAGTCTGGTACATGGAGGAAAG-3’); middle sequence (4842 bp), 5' 2F2569-Forward (5’-

GGACAGAGGATGAGCAGAAAGA-3’) and TriSet2-Reverse (5’- GCGGTGGAATGATTGGTATAAGTG-

3’); and downstream sequence (3797 bp), Set 14-Forward (5’- AGC CTT CCC AAC CAA GAA AGA-

3’) and Set 14-Reverse (5’- AGC TAG CTT GCC AAA CCT ACA-3’). Reactions were prepared as 25




17

L aliquots with LongRange PCR Kit as described above. Thermal cycling conditions consisted of

one cycle of 93°C for 3 min, followed by 30 cycles of 93°C for 15 sec, 60°C for 30 sec, and 68°C

for 4 min.

Preparation for Sequencing

Following the nested PCR, products were separated on 1% TAE ethidium bromide

agarose gels and bands corresponding to the expected size were excised and purified according

to the manufacturer’s instructions (Gel PCR Purification Kit: Qiagen). Quantification of purified

PCR products was performed using QuantiFluor dsDNA (Promega) on an Infinite M200 Plate

Reader (Tecan).

Purified PCR products were prepared for sequencing using Nextera XT kit (Illumina)

according to manufacturer’s instructions. Pooled libraries were sequenced on Illumina MiSeq (2

x 75 base reads) at University of California San Diego IGM facility. Fastq files are available from

NCBI SRA database (SRP149280).

Toca 511 Sequence Analyses

PCR duplicates were removed with PRINSEQ-lite 0.20.4 (55). Read pairs were quality

trimmed with Cutadapt (-q 30,30 --minimum-length 30) and mapped to the Toca 511 genome

using bwa mem 0.7.15-r1140 using default parameters (56). SNVs and indels were identified

with Varscan 2.3 (--p-value 0.01 --min-coverage 500 --min-avg-qual 25 --min-var-freq 0.01) (36)

from Samtools (57) generated mpileup files (-d 20000). The resulting VCF files were parsed,

combined and analyzed in R using custom scripts. Plots for figures were made with ggplot2.




18

yCD2 Sequencing

Primers used to amplify the yCD2 coding region included Illumina Nextera XT universal

primer sequences at their 5’ ends: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

CACGGGGACGTGGTTTTCCTT-3’ and 5’-

GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACAGGTGGGGTCTTTCATTCC-3’. Primary PCR was

performed with 400 nM of each primer using Qiagen Long Range PCR kit components. PCR products

were gel purified and a secondary PCR was performed with Nextera XT dual-indexed primers to prepare

samples for sequencing. Samples were pooled and sequenced on Illumina MiSeq (2 x 300 base

reads). Adaptors were removed from sequencing reads with Cutadapt. Reads were quality

trimmed with Trimmomatic v0.32 (SLIDINGWINDOW:30:30) (58) and then mapped to Toca 511

genome with bwa mem as described above. SNVs were identified with Varscan2 as described

above. Fastq files are available from NCBI SRA database (SRP149351).

Patient Autopsy Samples

The whole-body autopsy patient was a 65 year old male with a past medical history of

left temporal anaplastic astrocytoma with transformation to GBM status post resection. The

patient completed Toca 511 dosing and a single cycle of Toca FC. Main study informed consent

was reviewed and received approval from Western Institutional Review Board, which allows

Tocagen to request tissues from autopsy case. Full autopsy consent was obtained by the

investigators at UTHealth. Samples were collected approximately 40 days after the last dose of

Toca FC. Tissue and biofluids samples were collected as follows:, brain -adjacent, tumor – non-

injected site A, tumor – non-injected site B, tumor – non-injected site C, tumor injection site A,

tumor injection site B, tumor injection site C, 1 mL blood, 1 mL urine, skin, lower GI, testes,




19

liver, spleen, lymph nodes, bone marrow, spinal cord, lung - left lower lobe, lung - Lobe

Consolidation, CSF.

The brain autopsy was from an 80 year old male with a past medical history of GBM and

recurrent GBM post-resection. Samples from the following locations were collected:

contralateral temp lobe (amygdala), ipsilateral frontal cortex (sagittal), anterior half (putamen

and internal capsule), posterior half, posterior tumor, posterior tumor (slightly more anterior),

anterior tumor (presumed injection site), anterior tumor (presumed injection site, slightly more

posterior).




20

RESULTS

Toca 511 is transiently detected in blood in a small subset of patients in Study 11

In Study 11, surgical resection was followed by multiple injections of Toca 511 into the

walls of the resection cavity; four to six weeks later, Toca FC dosing started (Supplementary

Table S1)(9). In order to quantitatively measure Toca 511 DNA and RNA levels over a broad

dynamic range, robust (reverse-transcription [RT])-qPCR assays that utilized a six-log standard

curve for absolute quantification were developed (see Materials and Methods). The estimated

Lower Limit of Quantification (LLOQ) for the qPCR assay is 25 viral genome copies per reaction,

whereas the LLOQ for the RT-PCR assay is ~7300 viral RNA copies per mL of plasma. As part of

Study 11, we performed Toca 511 qPCR on DNA isolated from whole blood as well as RT-qPCR

on total RNA isolated from plasma, urine and saliva, sampled longitudinally starting just prior to

Toca 511 treatment and continuing at intervals over the course of treatment, including > 500

DNA and RNA test samples across 56 patients (Fig. 1A – red lines)(9). Samples that were within

the quantitative range of the assay, as defined above, were considered detected.

Quantitative Toca 511 RNA signal was rarely detected in urine or saliva samples but was

detected in 32 plasma samples collected from 22 of 56 patients tested (Supplementary Fig. S1

& Supplementary Dataset S1) and rapidly cleared. Sixteen of the positive RNA samples from

plasma were detected from samples collected one day after surgery (visit 2). This is probably

too early for infection and viral replication to occur and likely represents leakage of the injected

vector into the blood stream following surgery. Thirteen patients had positive RNA signal at

times after visit 2, occurring between day ~10 (visit 3) and week 6(visit 5).




21

We detected Toca 511 in DNA isolated from blood in fifteen samples collected from

eleven patients (Fig. 1B and Supplementary Dataset S1). Detection of Toca 511 DNA in whole

blood did not correlate with patients’ Toca 511 dose level (Supplementary Dataset S1). In all

cases quantitative signal occurred between week 4 (visit 4) and week 10 (visit 7) (Fig. 1B).

Patients begin taking Toca FC at week 6 (visit 5) and it is likely this helped clear virus from the

blood. Even in cases in which integrated Toca 511 was detected, overall levels were low; the

maximum DNA signal was 3,400 copies per g of genomic DNA (~2 copies per 100 diploid

genome equivalents) (Fig. 1B & 1D). In summary, virus was well controlled as it was

infrequently and only transiently detected in the patients’ blood with quantitative Toca 511

signal in 6% of plasma samples and 3% of whole blood samples, respectively.

Toca 511 infects patients’ HGG tumors

While it was not feasible to systematically measure Toca 511 levels in residual tumors

from patients in Study 11, we obtained tumor samples from eight patients in Study 11 for

whom their tumor recurred following Toca 511 and Toca FC treatment and the tumor was

subsequently resected (re-tumor samples in the figures). We detected Toca 511 in DNA isolated

from three of seven tumors tested. Two of these patients’ tumors had both quantifiable Toca

511 DNA and RNA signal (Fig. 1C & Supplementary Dataset S1), It is likely viral levels in these

tumors are not representative of the initial uptake in the patient population as Toca FC

treatment is expected to deplete Toca 511 expressing cells; moreover, one reason for tumor

recurrence would be from a paucity of Toca 511-infected cancer cells.




22

In Study 13, recurrent HGG tumor was resected eight to fourteen days after the initial

day of IV administration of Toca 511, additional Toca 511 was injected into the resected cavity

followed by Toca FC treatment four to six weeks later (Fig. 1A & Supplementary Table S2).

Appropriate qPCR was performed on DNA and RNA isolated from multiple tumor pieces

(referred to, herein, as IV tumor samples) (Fig. 1A). For eight of the seventeen patients given IV

Toca 511, integrated Toca 511 was detected in at least one tumor piece (Fig. 1C), at levels up to

47,000 copies per g of DNA (~31 copies per 100 diploid genome equivalents) (Fig. 1D &

Supplementary Dataset S1). We detected Toca 511 RNA isolated from tumor samples in nine

patients, including six patients whose tumors also had quantifiable levels of integrated Toca 511

(Supplementary Dataset S1). The first two low dose patients showed no quantifiable signal for

DNA or RNA in their tumors. At the third, fourth and fifth dose levels with one, three or five day

administration respectively, Toca 511 was detected in 11 of 15 tumors. These results suggest

that Toca 511 gains access to the brain tumor in a dose dependent manner after virus infusion

into peripheral blood and can successfully deliver therapeutic transgenes.

Toca 511 integration patterns are tissue specific and consistent with previous analyses

of gammaretroviral integration

Identification of integration sites in samples with few integration events per hundreds of

genomes is challenging and we optimized an integration site enrichment procedure and

sequencing analysis workflow to reliably do so (Supplementary Text, Supplementary Fig. S2, S3

& S4). We distinguished clonal events from PCR duplicates by virtue of having the same

integration site, but different fragmentation site, as is standard (e.g. (30-32)). Nine blood

samples from Study 11, and ten tumor samples from Study 13 with quantifiable Toca 511 signal




23

were analyzed along with three negative controls (DNA isolated from human cells not exposed

to Toca 511) (Fig. 2A). The three negative controls yielded zero, three and eight “integration

events“ respectively (from millions of sequencing reads); these events were likely created from

spurious priming by the Toca 511 specific nested primer in locations of the human genome that

happened to be immediately followed by the four bp Toca 511 integration sequence. Patient

samples generally had orders of magnitude more read pairs that mapped to the human

genome than the negative control samples, yielding on average 34 integration events per blood

sample and 165 integration events per tumor sample for a total of 1984 measured integration

events across all samples tested (Fig. 2A and Supplementary Fig. S5).

Given gRVs’ preference to integrate near the 5’ends of transcriptionally active units, as

also observed for Toca 511 in cell culture (Supplementary Fig. S3D), we predicted there would

be enrichment of Toca 511 integration sites near annotated mRNA transcription start sites

(TSSs) from patient samples. For these analyses we combined integration sites from blood and

integration sites from tumor into two pools of data. We plotted the distribution of integration

sites adjacent to annotated TSSs and observed a characteristic enrichment centered around

TSSs in both blood and tumor samples, albeit with a shallower peak than observed in cell

culture (Fig. 2B). For both blood and tumor, 14% of integrations occurred within five kb of the

nearest annotated TSS (vs 5% expected based on random chance; p = 0.03 and p < 1e-5 for

blood and tumor, respectively based on proportions test). We asked whether genes proximal to

integration sites (immediately upstream (within 10 kb) or within the gene) encode proteins that

are functionally linked to the site from which samples were taken; blood or brain tumor.

Utilizing the hundreds of GO and REACTOME gene sets (33,34), we found that brain tumor-




24

derived integration sites preferentially occurred near genes involved in neuronal functions and

growth/differentiation, while blood-derived integration sites preferentially occurred near genes

linked to blood functions (Fig. 2C). Thus, Toca 511 integration site preferences from patient

tumor and blood transduced in vivo are congruent with previous work on gRVs showing

preference for sites of active transcription ex vivo and in mice (25,26).

Absence of compelling evidence for clonal expansion of Toca 511-integrated cells

The degree to which integration sites are unique versus subclonal expansion is key in

order to assess the putative risk of insertion mutagenesis leading to hyperproliferation. An

abundance of unique integration events would also indicate viral spread within the tumor

versus expansion of one to a few tumor cells with integrated genomes. For each sample, we

determined the number of sites with two or more integration events and plotted the results as

a fraction of all integration events (Fig. 3A). For samples with at least twenty identified

integration events multiple events from the same site comprised fewer than five percent of the

total, with one exception, from patient 11_33 visit 4a blood (not shown in Figure 3A). Follow-up

analyses suggest this potential clonal expansion, which occurred in an Alu element, was a

technical artifact caused by recombination with other Alu elements during PCR (Supplementary

Text and Supplementary Fig. S6).

Given the precedent for clonal expansion due to integration of gRVs adjacent to

oncogenes, particularly LMO2, we determined if there was a preponderance of sites adjacent to

or within various classes of cancer-related genes, in both blood and tumor. We found some

integration events within ten kb of oncogenic drivers or tumor suppressor genes in blood or




25

tumor (Fig. 3B). There was one integration site in blood (11_05 visit 7) near a lymphoma-linked

gene, NKAIN2/TCBA1, which encodes a transmembrane protein that interacts with the beta

subunit of a sodium/potassium-transporting ATPase (35). There was no observed clonal

expansion from this integration event and like all other patients detectable Toca 511 signal was

undetectable after Toca FC treatment. These results are consistent with the lack of

development of lymphoma-like symptoms in surviving patients after Toca 511 delivery to date

and the paucity of Toca 511 infected cells in all patients’ blood samples (9).

Toca 511 genomes are mutated by restriction factors in patients

We previously reported Toca 511 gross genome stability in vitro across multiple

passages of the virus in cell culture (13). In the clinical setting, Toca 511 was PCR-amplified from

patient DNA samples using a single nested PCR that spanned nine kb of the genome including

all coding regions, or three overlapping PCR products that spanned the same region

(Supplementary Fig. S7). PCR products were gel purified and those with sufficient material were

prepared for Illumina sequencing. We obtained quality sequencing results (> 1,000X coverage

across at least 6,000 bp) from three blood samples, six samples from re-resected tumors, six

tumor samples following IV treatment and four nonclinical samples, including two cell lines (HT-

1080 and U-87MG) infected with Toca 511 and two plasmids containing the parental Toca 511

genome.

Following quality filtering and read mapping to the Toca 511 reference genome, we

characterized the mutation profiles of the Toca 511 genomes from each sample using Varscan2

(36), which identifies both single nucleotide variants (SNVs) and short insertions and deletions

(indels) (Fig. 4 and Supplementary Fig. S8). At a mutation frequency threshold of 3%, there




26

were four SNVs and zero indels in the two plasmid controls and U-87MG infected cells. These

mutations were previously identified shared silent point mutations from the initial cloned MLV

genome from which Toca 511 was derived (37)and were removed for subsequent analyses.

There were two additional SNVs in the HT-1080 control sample, both occurring at less than 5%

frequency. In contrast to the plasmid and cell culture samples, there was a wide spectrum of

mutations among patient samples. Total SNVs per sample ranged from 31 (11_33 blood visit 7)

to 742 (11_02 re-tumor section 8) (mean = 204) (Fig. 4A & B). Indels were much less frequent

than SNVs (Supplementary Fig. S8). There were generally more SNVs and indels in Toca 511

genomes from re-resected tumors versus newly resected tumors and blood, which could reflect

more rounds of infection and replication and/or enrichment of non-functional Toca 511

following Toca FC treatment (patient 11_02 took one cycle of Toca FC while patient 11_31 took

three cycles of Toca FC).

Next we asked whether there was a bias in the mutation patterns among SNVs, which

may suggest underlying mechanisms of mutation. For each sample we calculated the fraction of

all SNVs corresponding to each of the twelve possible pairwise combinations. As shown in Fig.

4C, an overwhelming majority of SNVs corresponded to three of four possible transitions: G to

A, A to G and T to C. For eleven of thirteen samples the majority of SNVs were G to A

transitions, which is commonly seen in retroviral mutation profiles due to APOBEC cytidine

deaminase-mediated C to U transitions during reverse transcription (Fig. 4D) (28,29). G to A

transitions were more likely to occur at higher frequency than other transitions in nine samples

(Dunn test, p < 0.001). These results suggest that APOBEC-mediated cytidine deamination




27

during reverse transcription contributes to Toca 511 mutation spectrum in both patient blood

and tumors, but that its influence varies among samples.

G to A mutations can create premature stop codons in Toca 511

The abundance of SNVs in integrated Toca 511 genomes from patient samples raises the

question as to what degree these mutations inactivate the vector. We focused our attention on

nonsynonymous mutations caused by G to A transitions due their abundance. What stood out

was the potential the codon encoding tryptophan (TGG) to be converted to stop codons (STOP -

TGA, TAG and TAA) by any combination of G to A at the second or third position. Toca 511

contains 52 tryptophan codons: 12 in gag, 24 in pol, 14 in env and two in yCD2. We calculated

the frequency of G to A mutations in tryptophan codons and plotted the results for each sample

as a heatmap (Fig. 5A). There were a number of sites in the genome with high frequency

tryptophan to STOP that occurred in multiple samples. There were ten samples with at least

one tryptophan to STOP at 30% frequency or greater (Fig. 5B). Coinciding with increased

mutation accumulation and/or selection for nonfunctional Toca 511 genomes, tryptophan to

STOP was more abundant in samples from tumors re-resected following repeated cycles of

Toca FC treatment. The most common tryptophan to STOP mutation was in amino acid 10

(W10) in yCD2, which was mutated in eight samples at > 30% frequency. This mutation,

occurring near the 5’end of yCD2 coding sequence presumably eliminates functional yCD2

protein unless an alternative start codon rescues function; for instance, the closest downstream

methionine is at amino acid 15. W10 is immediately adjacent to the first alpha helix and is

conserved in orthologs from closely related fungal species (Supplementary Fig. S9) (38). The

next two most frequent mutations affected W804 and W1016 in pol. W804 to STOP occurred in




28

three re-resected tumors and five tumors resected prior to Toca 511 and Toca FC treatment,

while W1016 to STOP occurred in one blood, three re-resected tumors and two tumors

resected prior to Toca FC treatment.

In order to corroborate these results we performed targeted sequencing on the yCD2

coding region (Supplementary Text & Fig. S10). According to the targeted yCD2 sequencing

results at least 30% of yCD2 coding sequences were functional in ten of sixteen samples

isolated from tumors following IV treatment, one of five samples isolated from blood (three of

five were from one patient) and one of three samples from re-resected tumors (Fig. 5C). While

technical replicates for targeted sequencing of yCD2 were highly concordant (Supplementary

Fig. S11), the concordance between Toca 511 sequencing results and targeted yCD2 sequencing

results varied (Supplementary Text & Fig. S10). Thus, we must be cautious about quantitative

interpretation of specific mutation frequencies, which could be skewed by a small number of

viral copies going into PCR reactions prior to sequencing preparation (39). For instance, even in

tumors resected after Toca 511 delivery and multiple rounds of Toca FC, where deleterious

mutations are observed at high frequency, we still detect yCD2 expression, suggesting a

reservoir of functional virus persists (Supplementary Fig. S12) (9).

Toca 511 preferentially targets tumors in a recurrent GBM patient

While we have characterized the tissue and biofluid distribution of Toca 511 in mice

(12), analogous analyses have not been reported in humans. Twenty-one tissue samples

throughout the body were obtained after the death of a male patient with recurrent

glioblastoma multiforme (GBM) who was treated with Toca 511 via injection into the newly




29

resected tumor cavity, as in Study 11. The patient died approximately three months after Toca

511 injection and approximately six weeks after a single cycle of Toca FC as the patient declined

further treatment due to poor quality of life with global aphasia. We obtained three pieces of

recurrent tumor at the Toca 511-injection site, three from a separate non-injected GBM tumor,

two from non-neoplastic brain, one from spinal cord, one from cerebral spinal fluid (CSF) as

well as from sites that are considered potential repositories for gRVs or important organs to

test, including spleen, lymph node, bone marrow, lung, liver, lower GI, testes and skin as well as

whole blood and urine.

We measured Toca 511 levels in DNA and total RNA isolated from each autopsy tissue

sample. Toca 511 was detected in RNA isolated from two of three samples from the injected

tumor site and from one of three samples from neighboring non-injected tumor, but not

elsewhere (Fig. 6A, right panel). Toca 511 was detected in DNA isolated from all three injected-

site tumor pieces, two of three non-injected tumor pieces, immediately adjacent non-

neoplastic brain region, spinal cord and CSF (Fig. 6A, left panel). Outside of the central nervous

system we found observable but not quantifiable (< 100 copies/g, < 1 copy/15,000 diploid cell

equivalents) Toca 511 DNA in blood, liver, spleen, lymph node, lung and bone marrow. No Toca

511 signal was observed in DNA isolated from testes, urine, skin, or lower GI. No Toca 511 RNA

was detected outside of the tumor samples, reinforcing the low probability of live virus

shedding by patients. Toca 511 tumor specificity is corroborated by whole brain autopsy

samples isolated from a patient in Study 8 who underwent one cycle of Toca FC (Supplementary

Table 3).




30

We amplified and sequenced integrated Toca 511 from DNA isolated from the injection

site tumor, the non-injected tumor, CSF and blood. For all four samples we obtained quality

results from the 3’ PCR product covering 3,750 bp including yCD2 (Supplementary Fig. S7).

There were more than twice as many SNVs from the two tumor samples and CSF relative to

blood (Fig. 6B). Most mutations in tumor and CSF were G to A (Fig. 6C). Nonetheless the specific

mutation pattern in each sample was unique (Fig. 6D). Thus while the general mutation biases

were similar among the tumor and CSF samples, the locations and frequencies of specific

mutations varied considerably.

DISCUSSION

The logic behind gammaretroviral replicating vector gene therapy for oncology

Gammaretroviral replicating vector gene therapy holds promise for a range of

oncological therapeutic indications due its ability to selectively infect cancer cells without direct

cell lysis and deliver a therapeutic transgene. In animal models, Toca 511-infected tumor cells

are killed by 5-FU converted from 5- FC. The diffusible 5-FU also kills susceptible neighboring

cells, including immune suppressor myeloid cells that contribute to the immune-suppressed

tumor microenvironment (40,41). After several cycles of Toca FC, treated immune competent

animals that clear tumor are resistant to tumor re-challenge (12) and this resistance is T-cell

mediated (40,41).

The potential advantages of a RRV, Toca 511, over RNV center around the premise that

there will be multiple rounds of infection and spread in the tumor over time, leading to a




31

greater proportion of tumor cells and geographical regions infected, including non-injected

tumors. The replication of retroviruses, including Toca 511, includes stable integration of viral

genomes into infected cancer cell genomes creating a reservoir of Toca 511. This reservoir

persists during Toca FC treatment in part because non-cycling cancer cells are more resistant to

5-FU killing than replicating cells (42). The reservoir provides a source of Toca 511 production

and spread to newly formed tumor cells between Toca FC doses. This allows for continued

killing of tumor cells over multiple cycles of Toca FC and subsequent breaking of immune

tolerance and re-activation of the immune system against the tumor. This is seen in preclinical

models where several cycles of Toca FC are required to produce durable response in immune-

competent animals (12).

Toca 511 selectively replicates and spreads in patient tumors

Several lines of circumstantial evidence suggest Toca 511 does indeed undergo multiple

rounds of infection in patient samples. The strongest evidence comes from mutational profiles

in which the frequencies of specific mutations vary over 30-fold (Fig. 4). Samples from tumors

isolated after Toca 511 and Toca FC treatment categorically displayed more mutations than

samples from tumors taken before Toca FC treatment, likely due to depletion of functional Toca

511 genomes from yCD2-dependent 5-FU-mediated cell death. Detection of integrated Toca

511 in blood samples emerges weeks after dosing suggesting ongoing viral replication and

spread of productive virus over time (Fig. 1). Toca 511 was quantitatively detected in both the

tumor from the injection site and in a separate non-injected tumor in the brain (Figure 6).

Multiple lines of evidence presented herein support Toca 511’s selectivity for tumor

cells over normal cells and tissues in humans. Integrated Toca 511 was detected transiently in




32

blood but only in 11 of 56 patients treated in Study 11 (Fig. 1). Toca 511 RNA was only detected

in two of the fifteen blood samples with detectable levels of integrated Toca 511 DNA

(Supplementary Dataset S1). While it was not feasible to measure Toca 511 levels in tumor cells

in the resection study prior to Toca FC treatment, we did measure Toca 511 levels in the

context of IV delivery as well as in tumors that recurred post Toca FC treatment. In these

contexts, Toca 511 DNA and Toca 511 RNA were detected in > 40% of tumors, at levels

generally higher than seen in blood (Fig. 1), arguing for active virus production in the tumor

(Supplementary Dataset S1). These results are extended in a more expansive analysis of non-

tumor samples from a patient’s whole body autopsy, where we detected integrated virus and

viral RNA in the injected tumor site as well as in a non-injected brain tumor, but we only

detected non-quantifiable levels of virus DNA in a subset of bodily sites outside of the central

nervous system (Fig. 6). All patients cleared detectable virus signal in blood within the first

couple cycles of Toca FC suggesting that human patients are generally able to control the virus

systemically, even if a sizeable fraction of integrated Toca 511 genomes appear to be

inactivated (Fig. 4 and Fig. 5). We hypothesize blood clearance is due to a combination of yCD2-

dependent apoptosis following 5-FC administration, Toca 511 independent cell turnover and

multiple innate and adaptive defense mechanisms that act naturally to clear MLV, which is not

zoonotic.

APOBEC-mediated cytidine deamination is likely the dominant source of Toca 511

mutations in patients

Most mutations in Toca 511 genomes isolated from patient samples were G to A

transitions (Fig. 4). The human genome encodes a repertoire of APOBEC cytidine deaminases,

some of which are incorporated into retroviral particles via interactions with the core viral




33

protein GAG and viral RNA and catalyze C to U transitions on single-stranded DNA during

reverse transcription in the cytoplasm (43), leading to G to A mutations in the viral coding

strand. The most parsimonious explanation for the mutation profiles is that Toca 511 particles

encapsulate one or more APOBEC molecules, which then processively mutate C’s to U’s during

reverse transcription in the subsequent rounds of infection, leading to mutated and often

inactivated integrated virus (Fig. 4). Among G to A mutations, those resulting in conversion of

the tryptophan codon (TGG) to premature stop codons (TGA, TAG and TAA) are expected to be

particularly deleterious to viral functions. The complement of the tryptophan codon is the

preferred sequence context for APOBEC3G, suggesting this paralog as a likely culprit. Generally

though, the sources and identities of APOBECs incorporated into Toca 511 particles in patients

are not known. While in some samples we estimate > 90% frequency of specific G to A stop

mutations, such as mutations leading to conversion of tryptophan at position 10 in yCD2 (Fig. 4,

Fig. 5C & Supplementary Fig. S10), we are cautious about quantitative interpretation of the

mutation frequencies given the observed intra-sample discordance (Supplementary Text & Fig.

S10). Indeed, we detected yCD2 via IHC in some tumor samples with high frequency of

conversion of tryptophan at position 10 to stop codon (Supplementary Fig. S12), suggesting

APOBECs inactivate some, but not all, Toca 511 genomes. However, we are unable to make

quantitative connections between observed yCD2 expression by IHC from one piece of

tumor to Toca 511 DNA and RNA levels in another piece of tumor due to intra-tumor

heterogeneity.

As Toca 511 is derived from a mouse gammaretrovirus, it did not specifically evolve

mechanisms to minimize inactivation by human APOBECs (or other human restriction factors).




34

In principle, future generations of gRVs could be engineered to minimize tryptophan residues

within the transgene, which could lead to enhanced efficacy in tumors while maintaining the

safety profile.

No evidence for pathology or molecular abnormalities from Toca 511 insertions

A primary safety concern using RRVs has been that infection of blood progenitor cells

leading to oncogenic transformation could occur in some clinical situations as has been

observed with RNVs. Toca 511 integration profiles from blood and tumor samples described

herein, after administration both into the tumor resection cavity and IV, show no compelling

evidence for clonal expansion of infected cells within the time frame of these trials (Study 11

started in 2011)(Fig. 3). These results are consistent with the absence of direct clinical evidence

for this kind of adverse event so far in recurrent HGG patients treated with Toca 511 and Toca

FC in a resection setting (9). However, given the precedence for subsequent malignancies in

patients with HGG and temozolomide-related haematological adverse events (44,45), it is likely

that we will eventually encounter patients treated with Toca 511 and Toca FC that develop

haematological adverse events, including lymphoma. The assays presented herein would

enable us to gauge the contribution, if any, of Toca 511 insertional mutagenesis.

Gammaretrovirus integration is stimulated by physical interactions between integrase

with BET proteins which orchestrate assembly of transcription initiation complexes, leading to

so-called pseudo-random insertion preferentially near transcription start sites, including active

enhancers and promoters (46). Therefore, many gRV integration sites are within gene

regulatory regions, which in turn could influence the transcriptional regulation of linked genes,

as seen for LMO2 in HSCs in some treated X-SCID patients, resulting in the delayed onset of




35

leukemia in some of these severely immune compromised patients (47). Our analyses of Toca

511 integration sites in blood and brain tumor suggest that while Toca 511 follows pseudo-

random preferences of other gRVs, there was no compelling evidence for clonal expansion as

judged by overrepresentation of specific integration sites, nor was there preferential insertion

near oncogenes (Fig. 3). We did find that insertion sites in blood and brain tumor occurred

preferentially near genes that function in their respective tissue type (Fig. 2).

Conclusions

Toca 511 and Toca FC treatment represents a general novel anti-cancer modality (9).

This study fills in crucial gaps in our understanding of the therapeutic use of Toca 511 and

replicating retroviral vectors in general. The data provided herein provide molecular rationales

for the previously reported lack of Toca 511-related excess tumorigenicity observed in patients

treated with Toca 511 and Toca FC (9) as well as the continued investigation of replicating

retrovirus-based immunotherapies. A randomized phase 3 trial (NCT02414165) in patients with

recurrent GBM and anaplastic astrocytoma and a phase Ib trial investigating treatment in solid

tumors (NCT02576665) are ongoing.



http://stm.sciencemag.org/lookup/external-ref?link_type=CLINTRIALGOV&access_num=NCT02414165&atom=%2Fscitransmed%2F8%2F341%2F341ra75.atom


36

FIGURE LEGENDS

Fig. 1. Toca 511 detection frequency and timing in DNA isolated from patient blood

and tumor samples.

(A) Timeline of resection Study 11 and IV Study 13 treatment regimes. The timelines start at

day 1 and are not to scale. The grey boxes above the timelines show when Toca FC was

taken. The vertical red lines below the timelines indicate regularly scheduled blood draws

for Toca 511 monitoring.

(B) Heatmap representation of Toca 511 DNA signal in blood as a function of time for the

eleven patients of 56 in Study 11 with detectable signal. Visit number is shown above the

heatmap. Visit 3a is 1 week after visit 3. Visit 4a is 1 week after visit 4.

(C) Barplot showing the percentage of patients with detectable Toca 511 signal in DNA: blood =

red, re-resected tumor after Toca 511/FC treatment = magenta, resected tumor after IV

treatment = blue. The numbers on top of the bars show the fraction of patients with

detectable signal.

(D) Boxplot showing the estimated number of copies of Toca 511 per g of genomic DNA for

samples with detectable signal in (C). The horizontal bar shows the median, the lower and

upper hinges correspond to the first and third quartiles respectively, and the whiskers

extend from the hinge to the largest value no further than 1.5 x the interquartile range from

the hinges. There are 15 samples from 11 patients with quantifiable signal in blood (B).

Fig. 2. Toca 511 integration patterns are tissue specific and consistent with previous

analyses of gammaretroviral integration.

(A) Boxplot showing the number of identified integration events obtained from negative

controls (grey), blood samples (red) and IV tumor samples (blue).




37

(B) Distribution of Toca 511 integration sites in blood samples (red) and tumor samples (blue)

around the nearest annotated transcription start site (TSS). Preferential Toca 511

integration near TSSs is consistent with established integration preferences of gRVs.

(C) Genes that harbor Toca 511 integration sites immediately upstream (within 10 kb) or within

the gene encode proteins whose expression is linked to the site from which samples were

taken. (top-red) Integration sites in blood tend to occur within or near genes encoding

proteins linked to blood-cell functions. (bottom-blue) In contrast, brain tumor integration

sites are enriched for genes linked to neuronal stem cell proliferation and differentiation

and neuronal functions. The significance of enrichment of integration sites near genes

annotated in each category is represented as a bar plot of the p-value, calculated using the

hypergeometric density distribution function. GO = Gene Ontology term, PID = Pathway

Interaction Database.

Fig. 3. Absence of compelling evidence for clonal expansion of Toca 511-integrated

cells.

(A) The number of total integration events for each sample are color-coded by the proportion

of sites represented once (grey) versus the number of sites represented multiple times

(black). Samples in red are from blood: e.g., 11_05_v7 indicates Study 11 patient 05 visit 7

blood draw. Samples in blue are from brain tumors: e.g., 13_03_p5 indicates Study 13

patient 03 tumor piece 5.

(B) Neither blood (red) nor tumor (blue) integration sites preferentially occur near genes linked

to tumorigenesis. The significance of enrichment of integration sites near genes annotated

in each category is represented as a bar plot of the p-value, calculated using the

hypergeometric density distribution function.




38

Fig. 4. Toca 511 genomes are mutated by restriction factors in patients.

(A) Boxplot showing the total number of single nucleotide variants (SNVs) from different classes

of samples at a mutation frequency threshold of 3%: Toca 511 containing plasmid and

transduced cell lines (black, n=4), blood (red, n=3), brain tumors re-resected after further

progression of disease after Toca 511 delivery (magenta, n=4), brain tumors following IV

dosing prior to Toca FC treatment (blue, n=6).

(B) Mutations occur at a wide-range of frequencies in patient samples. Barplots show the

fraction of mutations across all patients from whom data could be obtained, with frequency

3-10 % (light green), 10-30% (green) and greater than 30% (dark green).

(C) Boxplot showing the percent totals of all possible point mutations from different classes of

samples. For instance, A>C indicates A to C transitions. Nearly all mutations are transitions.

(D) Barplot showing the percentage frequency of the four possible transitions in each patient

sample. G to A mutations predominate for all samples.

Fig. 5. G to A mutations can create premature stop codons in Toca 511.

(A) The tryptophan (W) codon is converted to stop codons (STOP) by G to A transitions. Each

row corresponds to the Toca 511 mutation spectrum from a single DNA sample. The color

bar on the left side indicates each sample’s tissue of origin (colors as in Figure 4A). The

heatmap shows the percentage frequency of conversion of W to STOP along the Toca 511

genome. High frequency inactivating mutations were largely restricted to tumor re-resected

(magenta) after multiple Toca FC treatment cycles.

(B) The number of W to STOP changes (on an amino acid basis) across Toca 511 as a function of

their frequency in the sample.




39

(C) Boxplot representation of the estimated percentage of “functional” yCD2 based on targeted

yCD2 sequencing. “Functional” is defined as 100 minus the maximum mutation frequency of

the three observed G to A mutations that are expected to inactivate yCD2 (Supplementary

Fig. S10).

Fig. 6. Toca 511 preferentially targets tumors in a GBM patient.

(A) (left) Average Toca 511 signal (copies/g) from qPCR replicates with quantifiable signal. *

indicates samples for which signal was below the LLOQ – the bars are arbitrarily set at 50%

of the LLOQ; (right) Average Toca 511 RNA signal (copies/g) from RT-qPCR replicates with

quantifiable signal. Note the break in the x-axis.

(B) Barplot showing the fraction of SNVs with percentage frequency 3-10 % (light green), 10-

30% (green) and greater than 30% (dark green). The source of DNA is indicated below the

plots.

(C) Barplot showing mutation frequency for the four possible transitions.

(D) Heatmap representation of percentage frequency of SNVs across the 3’ end of Toca 511

genome from the four patient samples. Only positions in Toca 511 in which at least one

sample had a SNV were included. Samples were clustered by Euclidean distance.

ACKNOWLEDGEMENTS

We would like to thank John Wood MBA RAC (Tocagen Inc.) and John M. Coffin Ph.D. (Tufts

University) for critically reading the manuscript. We wish to thank the patients and their

families for participating in Tocagen’s Clinical Trials. We are also deeply grateful to those

patients and families who consented to the autopsy procedures.




40

Funding

The authors thank the ABC2 Foundation (Washington, DC), the National Brain Tumor Society

(Watertown, MA), the American Brain Tumor Association (Chicago, IL), the Musella Foundation

(Hewlett, NY), and Voices Against Brain Cancer (New York, NY) for their support and

collaborations.




41

REFERENCES 1. Kaufman HL, Kohlhapp FJ, Zloza A. Oncolytic viruses: a new class of immunotherapy drugs.

Nature reviews Drug discovery 2015;14(9):642-62 doi 10.1038/nrd4663. 2. Kohlhapp FJ, Kaufman HL. Molecular Pathways: Mechanism of Action for Talimogene

Laherparepvec, a New Oncolytic Virus Immunotherapy. Clinical cancer research : an official journal of the American Association for Cancer Research 2016;22(5):1048-54 doi 10.1158/1078-0432.CCR-15-2667.

3. Logg CR, Robbins JM, Jolly DJ, Gruber HE, Kasahara N. Retroviral replicating vectors in cancer. Methods in enzymology 2012;507:199-228 doi 10.1016/B978-0-12-386509-0.00011-9.

4. Critchley-Thorne RJ, Simons DL, Yan N, Miyahira AK, Dirbas FM, Johnson DL, et al. Impaired interferon signaling is a common immune defect in human cancer. Proceedings of the National Academy of Sciences of the United States of America 2009;106(22):9010-5 doi 10.1073/pnas.0901329106.

5. Rabinovich GA, Gabrilovich D, Sotomayor EM. Immunosuppressive strategies that are mediated by tumor cells. Annual review of immunology 2007;25:267-96 doi 10.1146/annurev.immunol.25.022106.141609.

6. Zitvogel L, Tesniere A, Kroemer G. Cancer despite immunosurveillance: immunoselection and immunosubversion. Nature reviews Immunology 2006;6(10):715-27 doi 10.1038/nri1936.

7. Roe T, Reynolds TC, Yu G, Brown PO. Integration of murine leukemia virus DNA depends on mitosis. The EMBO journal 1993;12(5):2099-108.

8. Lin AH, Burrascano C, Pettersson PL, Ibanez CE, Gruber HE, Jolly DJ. Blockade of type I interferon (IFN) production by retroviral replicating vectors and reduced tumor cell responses to IFN likely contribute to tumor selectivity. Journal of virology 2014;88(17):10066-77 doi 10.1128/JVI.02300-13.

9. Cloughesy TF, Landolfi J, Hogan DJ, Bloomfield S, Carter B, Chen CC, et al. Phase 1 trial of vocimagene amiretrorepvec and 5-fluorocytosine for recurrent high-grade glioma. Science translational medicine 2016;8(341):341ra75 doi 10.1126/scitranslmed.aad9784.

10. Kim S, Park EJ, Yu SS, Kim S. Development of enzyme-linked immunosorbent assay for detecting antibodies to replication-competent murine leukemia virus. Journal of virological methods 2004;118(1):1-7 doi 10.1016/j.jviromet.2004.01.010.

11. Martineau D, Klump WM, McCormack JE, DePolo NJ, Kamantigue E, Petrowski M, et al. Evaluation of PCR and ELISA assays for screening clinical trial subjects for replication-competent retrovirus. Human gene therapy 1997;8(10):1231-41 doi 10.1089/hum.1997.8.10-1231.

12. Ostertag D, Amundson KK, Lopez Espinoza F, Martin B, Buckley T, Galvao da Silva AP, et al. Brain tumor eradication and prolonged survival from intratumoral conversion of 5-fluorocytosine to 5-fluorouracil using a nonlytic retroviral replicating vector. Neuro Oncol 2012;14(2):145-59 doi nor199 [pii]

10.1093/neuonc/nor199. 13. Perez OD, Logg CR, Hiraoka K, Diago O, Burnett R, Inagaki A, et al. Design and selection of Toca

511 for clinical use: modified retroviral. Molecular therapy : the journal of the American Society of Gene Therapy 2012;20:1689-98 doi 10.1038/mt.2012.83

10.1038/mt.2012.83. Epub 2012 May 1. 14. Twitty CG, Diago OR, Hogan DJ, Burrascano C, Ibanez CE, Jolly DJ, et al. Retroviral Replicating

Vectors Deliver Cytosine Deaminase Leading to Targeted 5-Fluorouracil-Mediated Cytotoxicity in Multiple Human Cancer Types. Human gene therapy methods 2016;27(1):17-31 doi 10.1089/hgtb.2015.106.




42

15. Vanin EF, Kaloss M, Broscius C, Nienhuis AW. Characterization of replication-competent retroviruses from nonhuman primates with virus-induced T-cell lymphomas and observations regarding the mechanism of oncogenesis. Journal of virology 1994;68(7):4241-50.

16. Purcell DF, Broscius CM, Vanin EF, Buckler CE, Nienhuis AW, Martin MA. An array of murine leukemia virus-related elements is transmitted and expressed in a primate recipient of retroviral gene transfer. Journal of virology 1996;70(2):887-97.

17. Yi Y, Hahm SH, Lee KH. Retroviral gene therapy: safety issues and possible solutions. Current gene therapy 2005;5(1):25-35.

18. Cicalese MP, Ferrua F, Castagnaro L, Pajno R, Barzaghi F, Giannelli S, et al. Update on the safety and efficacy of retroviral gene therapy for immunodeficiency due to adenosine deaminase deficiency. Blood 2016;128(1):45-54 doi 10.1182/blood-2016-01-688226.

19. Baum C, Dullmann J, Li Z, Fehse B, Meyer J, Williams DA, et al. Side effects of retroviral gene transfer into hematopoietic stem cells. Blood 2003;101(6):2099-114 doi 10.1182/blood-2002-07-2314.

20. Yi Y, Noh MJ, Lee KH. Current advances in retroviral gene therapy. Current gene therapy 2011;11(3):218-28.

21. Muul LM, Tuschong LM, Soenen SL, Jagadeesh GJ, Ramsey WJ, Long Z, et al. Persistence and expression of the adenosine deaminase gene for 12 years and immune reaction to gene transfer components: long-term results of the first clinical gene therapy trial. Blood 2003;101(7):2563-9 doi 10.1182/blood-2002-09-2800.

22. Haviernik P, Bunting KD. Safety concerns related to hematopoietic stem cell gene transfer using retroviral vectors. Current gene therapy 2004;4(3):263-76.

23. Deichmann A, Hacein-Bey-Abina S, Schmidt M, Garrigue A, Brugman MH, Hu J, et al. Vector integration is nonrandom and clustered and influences the fate of lymphopoiesis in SCID-X1 gene therapy. The Journal of clinical investigation 2007;117(8):2225-32 doi 10.1172/JCI31659.

24. Scholler J, Brady TL, Binder-Scholl G, Hwang WT, Plesa G, Hege KM, et al. Decade-long safety and function of retroviral-modified chimeric antigen receptor T cells. Science translational medicine 2012;4(132):132ra53 doi 10.1126/scitranslmed.3003761.

25. LaFave MC, Varshney GK, Gildea DE, Wolfsberg TG, Baxevanis AD, Burgess SM. MLV integration site selection is driven by strong enhancers and active promoters. Nucleic acids research 2014;42(7):4257-69 doi 10.1093/nar/gkt1399.

26. De Ravin SS, Su L, Theobald N, Choi U, Macpherson JL, Poidinger M, et al. Enhancers are major targets for murine leukemia virus vector integration. Journal of virology 2014;88(8):4504-13 doi 10.1128/JVI.00011-14.

27. Wolf D, Goff SP. Host restriction factors blocking retroviral replication. Annual review of genetics 2008;42:143-63 doi 10.1146/annurev.genet.42.110807.091704.

28. Yu Q, Konig R, Pillai S, Chiles K, Kearney M, Palmer S, et al. Single-strand specificity of APOBEC3G accounts for minus-strand deamination of the HIV genome. Nature structural & molecular biology 2004;11(5):435-42 doi 10.1038/nsmb758.

29. Armitage AE, Katzourakis A, de Oliveira T, Welch JJ, Belshaw R, Bishop KN, et al. Conserved footprints of APOBEC3G on Hypermutated human immunodeficiency virus type 1 and human endogenous retrovirus HERV-K(HML2) sequences. Journal of virology 2008;82(17):8743-61 doi 10.1128/JVI.00584-08.

30. Hacein-Bey-Abina S, Pai SY, Gaspar HB, Armant M, Berry CC, Blanche S, et al. A modified gamma-retrovirus vector for X-linked severe combined immunodeficiency. The New England journal of medicine 2014;371(15):1407-17 doi 10.1056/NEJMoa1404588.




43

31. Sherman E, Nobles C, Berry CC, Six E, Wu Y, Dryga A, et al. INSPIIRED: A Pipeline for Quantitative Analysis of Sites of New DNA Integration in Cellular Genomes. Molecular therapy Methods & clinical development 2017;4:39-49 doi 10.1016/j.omtm.2016.11.002.

32. Gillet NA, Melamed A, Bangham CR. High-Throughput Mapping and Clonal Quantification of Retroviral Integration Sites. Methods in molecular biology 2017;1582:127-41 doi 10.1007/978-1-4939-6872-5_10.

33. Fabregat A, Sidiropoulos K, Garapati P, Gillespie M, Hausmann K, Haw R, et al. The Reactome pathway Knowledgebase. Nucleic acids research 2016;44(D1):D481-7 doi 10.1093/nar/gkv1351.

34. The Gene Ontology C. Expansion of the Gene Ontology knowledgebase and resources. Nucleic acids research 2017;45(D1):D331-D8 doi 10.1093/nar/gkw1108.

35. Tagawa H, Miura I, Suzuki R, Suzuki H, Hosokawa Y, Seto M. Molecular cytogenetic analysis of the breakpoint region at 6q21-22 in T-cell lymphoma/leukemia cell lines. Genes, chromosomes & cancer 2002;34(2):175-85 doi 10.1002/gcc.10057.

36. Koboldt DC, Zhang Q, Larson DE, Shen D, McLellan MD, Lin L, et al. VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing. Genome research 2012;22(3):568-76 doi 10.1101/gr.129684.111.

37. Shoemaker C, Hoffman J, Goff SP, Baltimore D. Intramolecular integration within Moloney murine leukemia virus DNA. Journal of virology 1981;40(1):164-72.

38. Stolworthy TS, Korkegian AM, Willmon CL, Ardiani A, Cundiff J, Stoddard BL, et al. Yeast cytosine deaminase mutants with increased thermostability impart sensitivity to 5-fluorocytosine. Journal of molecular biology 2008;377(3):854-69 doi 10.1016/j.jmb.2008.01.002.

39. Welkers MR, Jonges M, Jeeninga RE, Koopmans MP, de Jong MD. Improved detection of artifactual viral minority variants in high-throughput sequencing data. Frontiers in microbiology 2014;5:804 doi 10.3389/fmicb.2014.00804.

40. Mitchell LA, Lopez Espinoza F, Mendoza D, Kato Y, Inagaki A, Hiraoka K, et al. Toca 511 gene transfer and treatment with the prodrug, 5-fluorocytosine, promotes durable antitumor immunity in a mouse glioma model. Neuro Oncol 2017 doi 10.1093/neuonc/nox037.

41. Hiraoka K, Inagaki A, Kato Y, Huang TT, Mitchell LA, Kamijima S, et al. Retroviral replicating vector-mediated gene therapy achieves long-term control of tumor recurrence and leads to durable anticancer immunity. Neuro Oncol 2017 doi 10.1093/neuonc/nox038.

42. Richard C, Duivenvoorden W, Bourbeau D, Massie B, Roa W, Yau J, et al. Sensitivity of 5-fluorouracil-resistant cancer cells to adenovirus suicide gene therapy. Cancer gene therapy 2007;14(1):57-65 doi 10.1038/sj.cgt.7700980.

43. Cullen BR. Role and mechanism of action of the APOBEC3 family of antiretroviral resistance factors. Journal of virology 2006;80(3):1067-76 doi 10.1128/JVI.80.3.1067-1076.2006.

44. Villano JL, Letarte N, Yu JM, Abdur S, Bressler LR. Hematologic adverse events associated with temozolomide. Cancer chemotherapy and pharmacology 2012;69(1):107-13 doi 10.1007/s00280-011-1679-8.

45. Li X, Li Y, Cao Y, Li P, Liang B, Sun J, et al. Risk of subsequent cancer among pediatric, adult and elderly patients following a primary diagnosis of glioblastoma multiforme: a population-based study of the SEER database. The International journal of neuroscience 2017:1-7 doi 10.1080/00207454.2017.1288624.

46. Sharma A, Larue RC, Plumb MR, Malani N, Male F, Slaughter A, et al. BET proteins promote efficient murine leukemia virus integration at transcription start sites. Proceedings of the National Academy of Sciences of the United States of America 2013;110(29):12036-41 doi 10.1073/pnas.1307157110.




44

47. Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, Leboulch P, et al. LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 2003;302(5644):415-9 doi 10.1126/science.1088547.

48. Martin M. Cutadapt Removes Adapter Sequences From High-Throughput Sequencing Reads. doi Cutadapt Removes Adapter Sequences From High-Throughput Sequencing Reads.

49. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nature methods 2012;9(4):357-9 doi 10.1038/nmeth.1923.

50. Morgan M PH, Obenchain V and Hayden N Rsamtools: Binary alignment (BAM), FASTA, variant call (BCF), and tabix file import R package version 1261. http://bioconductor.org/packages/release/bioc/html/Rsamtools.html.2016.

51. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 2010;26(6):841-2 doi 10.1093/bioinformatics/btq033.

52. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Molecular cell 2010;38(4):576-89 doi 10.1016/j.molcel.2010.05.004.

53. Tripathi S, Pohl MO, Zhou Y, Rodriguez-Frandsen A, Wang G, Stein DA, et al. Meta- and Orthogonal Integration of Influenza "OMICs" Data Defines a Role for UBR4 in Virus Budding. Cell host & microbe 2015;18(6):723-35 doi 10.1016/j.chom.2015.11.002.

54. Vogelstein B, Papadopoulos N, Velculescu VE, Zhou S, Diaz LA, Jr., Kinzler KW. Cancer genome landscapes. Science 2013;339(6127):1546-58 doi 10.1126/science.1235122.

55. Schmieder R, Edwards R. Quality control and preprocessing of metagenomic datasets. Bioinformatics 2011;27(6):863-4 doi 10.1093/bioinformatics/btr026.

56. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009;25(14):1754-60 doi 10.1093/bioinformatics/btp324.

57. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009;25(16):2078-9 doi 10.1093/bioinformatics/btp352.

58. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 2014;30(15):2114-20 doi 10.1093/bioinformatics/btu170.



http://bioconductor.org/packages/release/bioc/html/Rsamtools.html.2016


C

<100 300 800 2000

copi

es/u

g

not tested

B

Resec on(Study 11)

Intravenous(Study 13)

1 23d 4w 6w 10w

5-FC

14w

resectionToca 511 5-FC 5-FC

811d 25d 8w 12w

5-FCIV

Toca 511 5-FCresectionToca511

A

11/56

8/173/7

0

25

50

75

100

perc

enta

ge o

f pat

ient

s w

ith +

sig

nal

11_05 11_06 11_09 11_18

11_29 11_33 11_36 11_50 11_52 11_57

11_24

1 2 3 4 4a 5 6 7 8 9 103a

64

512

4096

32768

inte

grat

ed T

oca

511

(cop

ies/

ug)

D

Toca 511 DNA in blood

patie

nt

visit

Figure 1.

blood IV tumorre-tumor

blood IV tumorre-tumor




4

32

256

0

10

20

negativecontrol

blood IV tumor −10 −5 0 5 10distance to TSS (kb)

inte

grat

ion

even

ts

inte

grat

ion

even

ts

A B

GO: embryo developmentREACTOME: signalling by NGF

REACTOME: GRB2 events in ERBB2 signalingGO: transmembrane receptor protein tyrosine kinase signaling pathway

GO: regulation of neuron projection developmentGO: protein autophosphorylation

GO: neuron projection morphogenesisPID: NFAT pathway

GO: secretion by cellPID: C−MYB pathway

GO: adenylate cyclase−activating GPCR signaling pathwaycell recognition

PID: IL4 pathwayGO: negative regulation of blood circulation

GO: positive regulation of immune response

1 .01 10-4 10-6

p-value

C

Figure 2.




1

4

16

64

256

inte

grat

ion

even

ts

multiplesingle

1 0.3 0.1 0.03 0.01p-value

cancer predisposition

driver (amp/del)

driver (subtle)

liquid rearrangement

lymphoma

tumor suppressor

0 20 40 60number of genes

BA11

_05_

v711

_06_

v511

_06_

v711

_09_

v511

_18_

v711

_33_

v411

_33_

v713

_03_

p513

_03_

p25

13_0

7_p3

13_0

8_p5

13_0

8_p1

413

_08_

p23

13_1

0_p1

213

_10_

p14

13_1

1_p1

13_1

1_p3

Figure 3.




3-10%10-30%30-100%

A B

0

200

400

600

SNVs

control blood re-tumor IV tumor

PAZ3

PAZ3

bH

T-10

80U

-87

11_0

6_v5

11_0

6_v7

11_3

3_v7

11_0

2_p7

11_0

2_p8

11_0

2_p1

211

_31_

01_p

113

_08_

p14

13_1

0_p1

213

_12_

p18

13_1

3_p8

13_1

5_p1

513

_15_

p6

0

200

400

600

SNVs

C

0

25

50

75

100

perc

enta

ge

D

11_0

6_v5

11_0

6_v7

11_3

3_v7

11_0

2_p7

11_0

2_p8

11_0

2_p1

211

_31_

01_p

113

_08_

p14

13_1

0_p1

213

_12_

p18

13_1

3_p8

13_1

5_p1

513

_15_

p6

0

25

50

75

perc

ent o

f tot

al

A>C A>G A>T C>A C>G C>T G>A G>C G>T T>A T>C T>G

100

T > CA > GC > T

frequency

G > A

Figure 4.




0

10

20

30

W to

STO

P

pol env CDgag

Tryptophan (W) --> STOPTGG TAG

TGATAA

A

B

PAZ3

U-8

7

pAZ3

bH

T-10

80

11_0

6_v5

11_0

6_v7

11_3

3_v7

11_0

2_p7

11_0

2_p8

11_0

2_p1

211

_31_

01_p

113

_08_

p14

13_1

0_p1

213

_12_

p18

13_1

3_p8

13_1

5_p1

513

_15_

p6

40

frequency3-10%10-30%30-100%

< 3 11 45 100

% fr

eque

ncy

0

25

50

75

100

blood re_tumor tumorfu

nctio

nal y

CD

2 (%

)

C

Figure 5.




skinurine

testeslowerGI

lung LLL consolidationlung LLL nodule

liverbone marrow

lymph nodespleenblood

spinal cordbrain distal

brain adjacentCSF

tumor noninjected 3tumor noninjected 2tumor noninjected 1

tumor 3tumor 2tumor 1

Toca511 injected tumorother sites in CNSsites outside CNS

0 100 200DNA (copies/ug)

10 100 105

RNA (copies/ug)

Blood

Tumor 1

CSF

Tumornoninj 2

B C

D

< 3 11 45 100

% fr

eque

ncy

A

G > AT > CA > GC > T

frequency3-10%10-30%30-100%

0

25

50

75

100Bl

ood

CSF

Tum

or 1

perc

enta

ge

0

20

40

60

SNVs

Bloo

d

Tum

or 1

Tum

or n

onin

ject

ed 2

CSF

Tum

or n

onin

ject

ed 2

pol env CD

*

*

*

*******

* < LLOQ

Figure 6.




Published OnlineFirst June 26, 2018.Clin Cancer Res Daniel J Hogan, Jay-Jiguang Zhu, Oscar Diago, et al. Replicating Vector Toca 511 in PatientsMolecular Analyses Support the Safety and Activity of Retroviral

Updated version

10.1158/1078-0432.CCR-18-0619doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2018/06/20/1078-0432.CCR-18-0619.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/early/2018/06/26/1078-0432.CCR-18-0619To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-18-0619

http://clincancerres.aacrjournals.org/content/suppl/2018/06/20/1078-0432.CCR-18-0619.DC1

http://clincancerres.aacrjournals.org/cgi/alerts


http://clincancerres.aacrjournals.org/content/early/2018/06/26/1078-0432.CCR-18-0619


molecular analyses support the safety and activity of ......jun 26, 2018 · toca 511 (vocimagene...

Documents