molecular analysis of the candida albicans homolog of ... · molecular analysis of the candida...

JOURNAL OF BACTERIOLOGY,0021-9193/99/$04.0010

Dec. 1999, p. 7439–7448 Vol. 181, No. 24

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Molecular Analysis of the Candida albicans Homolog ofSaccharomyces cerevisiae MNN9, Required for Glycosylation

of Cell Wall MannoproteinsSUSAN B. SOUTHARD,* CHARLES A. SPECHT,† CHITRA MISHRA, JOAN CHEN-WEINER,

AND PHILLIPS W. ROBBINS†

Center for Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

Received 30 June 1999/Accepted 29 September 1999

The fungal cell wall has generated interest as a potential target for developing antifungal drugs, and thegenes encoding glucan and chitin in fungal pathogens have been studied to this end. Mannoproteins, the thirdmajor component of the cell wall, contain mannose in either O- or N-glycosidic linkages. Here we describe themolecular analysis of the Candida albicans homolog of Saccharomyces cerevisiae MNN9, a gene required for thesynthesis of N-linked outer-chain mannan in yeast, and the phenotypes associated with its disruption. CaMNN9has significant homology with S. cerevisiae MNN9, including a putative N-terminal transmembrane domain,and represents a member of a similar gene family in Candida. CaMNN9 resides on chromosome 3 and isexpressed at similar levels in both yeast and hyphal cells. Disruption of both copies of CaMNN9 leads tophenotypic effects characteristic of cell wall defects including poor growth in liquid media and on solid media,formation of aggregates in liquid culture, osmotic sensitivity, aberrant hyphal formation, and increasedsensitivity to lysis after treatment with b-1,3-glucanase. Like all members of the S. cerevisiae MNN9 gene familythe Camnn9D strain is resistant to sodium orthovanadate and sensitive to hygromycin B. Analysis of cellwall-associated carbohydrates showed the Camnn9D strain to contain half the amount of mannan present incell walls derived from the wild-type parent strain. Reverse transcription-PCR and Northern analysis of theexpression of MNN9 gene family members CaVAN1 and CaANP1 in the Camnn9D strain showed that tran-scription of those genes is not affected in the absence of CaMNN9 transcription. Our results suggest that, whilethe role MNN9 plays in glycosylation in both Candida and Saccharomyces is conserved, loss of MNN9 functionin C. albicans leads to phenotypes that are inconsistent with the pathogenicity of the organism and thus identifyCaMnn9p as a potential drug target.

Candida albicans is a dimorphic, opportunistic fungal patho-gen that is responsible for the majority of fungal infections inimmunocompromised hosts (33). A great deal of attention hasfocused on understanding host-C. albicans interactions, in par-ticular the elements that promote the virulence of the organ-ism (14, 47). Putative virulence factors include morphogenesis(56), proteinase production (32), phenotypic switching (57),and adherence to host cells (8, 10). A number of systems whichallow C. albicans to adhere to host tissues have been identified(reviewed in references 8 and 10). In most instances, cell wall-associated mannoproteins bind to specific components on hostcells (8–10, 27). Cell wall mannan has also been implicated inother pathogenicity-related processes, including immunogenic-ity (10). Therefore, understanding the molecular biology ofglycosylation, as well as that of other processes that relate tobiosynthesis of the Candida cell wall, is critical to elucidatingthe pathogenicity of C. albicans. In turn, such investigationsmay facilitate the identification of genes which encode poten-tial targets for improved antifungal therapy. To this end, in-formation obtained from studies of these systems in Saccharo-myces cerevisiae has proven essential in facilitating suchresearch in Candida.

The biosynthesis and structure of the mannan outer chain inS. cerevisiae have been studied extensively by Ballou and co-workers (2). Those investigations led to the isolation of anumber of S. cerevisiae mannoprotein, or mnn, mutants (re-viewed in references 2, 3, and 23), several of which showdefects in glycosylation of secreted proteins (2–4). These mu-tants also exhibit phenotypes characteristic of defects in cellwall biosynthesis and/or assembly, including poor cell growth,flocculation in liquid media, clumpy growth on solid media,osmotic sensitivity, and aberrant sporulation. Of these mu-tants, the mnn9 strain suffers the most serious glycosylationdefect. In this mutant, N-linked chains in which one a-1,6-mannose is attached to the core oligosaccharide are formedbut further addition is blocked. Limited addition of a-1,2- anda-1,3-linked mannose residues results in the formation of aMan13GlcNAc2 structure (60).

The MNN9 gene has been cloned (64), and an MNN9 genefamily in S. cerevisiae has been identified based on sequencehomology. The other members of this family include VAN1and ANP1. VAN1 was isolated by complementation of vana-date-resistant mutant van1-18 (28) and has been shown to beallelic to vrg7, another vanadate-resistant mutant isolated in anindependent screen (5). That screen also identified vrg mutantsallelic to mnn9 (vrg6), as well as other mnn mutants. Like themnn9 strain, van1 strains underglycosylate secreted invertase(5, 29). In addition, mnn9 and van1 strains have similar growthand sporulation defects. Both strains also show sensitivity tothe aminoglycoside antibiotic hygromycin B, as well as resis-tance to sodium orthovanadate (5, 15, 28, 29). The third mem-ber of the MNN9 gene family is ANP1, which was originally

* Corresponding author. Present address: Department of Molecularand Cellular Biology, Boston University, Goldman School of DentalMedicine, 700 Albany St., Boston, MA 02118-2392. Phone: (617) 414-1047. Fax: (617) 414-1041. E-mail: [email protected].

† Present address: Department of Molecular and Cellular Biology,Boston University, Goldman School of Dental Medicine, Boston, MA02118-2392.

7439

on Septem

ber 12, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

identified within a cluster of genes whose deletion resulted insensitivity to the chloramphenicol breakdown product aminonitrophenol propanediol (39). ANP1 has since been shown tocomplement gem3. The gem3 mutant was isolated in a screenfor mutants that mislocalize a reporter protein that shouldreside in an early Golgi compartment (12). The anp1 (gem3)strain also grows slowly, is osmotically sensitive, exhibitsclumpy growth in liquid and solid media, is sensitive to hygro-mycin and resistant to vanadate, and is defective in outer-chainglycosylation (12). All three genes encode putative type IImembrane proteins. Disruption of the individual genes doesnot result in lethality (5, 12), but deletion of both ANP1 andVAN1 renders the doubly disrupted strain inviable (12). Re-cently, Jungmann and Munro (26) have shown that Mnn9p,Van1p, and Anp1p colocalize in the cis Golgi apparatus sub-compartment in two separate complexes, both of which containMnn9p (26). The separate complexes were isolated by immu-noprecipitation, and both were shown to have mannosyltrans-ferase activity. One of the isolated complexes contains Van1pand Mnn9p alone, while the other complex contains Mnn9p,Anp1p, and two other tightly associated proteins, Hoc1p andan uncharacterized protein encoded by open reading frame(ORF) YJL183w (26). Hoc1p (45) is a Golgi apparatus proteinwith homology to Och1p (43), the mannosyltransferase whichinitiates mannan backbone synthesis. However, deletion ofHOC1 does not lead to defects in protein glycosylation (45).The Yjl183w protein has clear homologies to Mnn10p (16) andan a-1,2-galactosyltransferase in Schizosaccharomyces pombe(13) and has since been renamed Mnn11p (26). The enzymaticstudies with the partially purified complexes show they synthe-size both a-1,6- (backbone) and a-1,2 (side chain)-mannoselinkages, suggesting that the complexes have multiple enzy-matic activities (26). While the specific catalytic functions ofeach of these proteins are yet to be resolved, it is suggested thatin addition to the role they play in outer-chain synthesis one ormore of the enzymes in these complexes may be involved inother processes responsible for maintaining the organizationand function of the secretory pathway (25, 46). Additionally,MNN9 gene family members have been identified in screensfor genes involved in the cell cycle-regulated progression ofpolarized growth in S. cerevisiae (41, 54).

The C. albicans genome is diploid, yet no sexual cycle hasbeen reported for this organism (31). Accordingly, geneticmanipulation of this pathogen has been difficult in the past. Inrecent years, techniques developed for targeted gene disrup-tion in Saccharomyces (1) have been adapted for use in Can-dida (18). This methodology has led to the successful disrup-tion of many C. albicans genes, including genes involved inglycosylation (7, 53, 59), maintenance of cellular integrity (44,48), and assembly and function of the cell wall (6, 20, 36, 40).

Here, we report the identification of an MNN9 gene familyin C. albicans and describe the isolation and characterization ofone gene member of that family, C. albicans MNN9. Disrup-tion of both copies of C. albicans MNN9 results in a phenotype

suggestive of severe cell wall defects, including poor growth,flocullation in liquid medium, abnormal hyphal formation, andsensitivity to b-glucanase. Additionally, C. albicans Dmnn9strains are sensitive to hygromycin B and resistant to vanadate.These results suggest that C. albicans MNN9 encodes a proteininvolved in glycosylation and/or secretion of cell wall-associ-ated mannoproteins. In turn, the severe phenotypes exhibitedby the CaDmnn9 strain and the fact that no mammalian ho-mologs of MNN9 gene family members have been identifiedsuggest that C. albicans MNN9 would represent an attractivetarget for new antifungal drugs.

MATERIALS AND METHODS

Strains and growth conditions. Yeast and bacterial strains used in this studyare listed in Table 1. C. albicans was routinely grown in YPD medium (1% yeastextract, 2% peptone, 2% glucose) or SD minimal medium (0.67% Bacto yeastnitrogen base, 2% glucose) with shaking at the appropriate temperature. C.albicans ura revertants were selected on SD agar plates containing fluoro-oroticacid (5-FOA; 1.0 mg/ml). Uridine (50 mg/ml) was added to media when urastrains were cultured. Uridine and 5-FOA were purchased from Sigma ChemicalCo. (St. Louis, Mo.). Agar (2%) was added to solid media. C. albicans mnn9strains were also propagated in liquid media supplemented with either 0.5 MKCL or 0.5 M sorbitol for osmotic stabilization.

Hyphal growth was induced by use of a temperature-pH regimen in Lee’smedium (34) for Northern analysis. Germ tube formation was also induced byculturing in YPD liquid medium containing fetal bovine serum (10%) at 37°C, orby culturing in RPMI 1640 medium at 37°C for experiments examining theyeast-to-hypha transition.

Escherichia coli strains were grown at 37°C in Luria-Bertani (LB) broth sup-plemented with ampicillin (100 mg/ml), when appropriate. Agar was added to1.5% for LB plates.

Plasmids and genomic libraries. The plasmid pLV4, carrying the S. cerevisiaeactin gene on a 1.4-kb BamHI/NotI fragment, was kindly provided by Letty Vega(Massachusetts Institute of Technology [MIT], Cambridge, Mass.). PCR-Script(1) (Stratagene, La Jolla, Calif.) was used for subcloning and sequencing thePCR products. Construction of the C. albicans ATCC 10261 HindIII and EcoRIgenomic libraries in pUC18 has been described previously (38). The methodol-ogy utilized for library screening was as previously performed (38).

Plasmid p8A was isolated after screening the genomic library and contains a3.5-kb HindIII insert carrying C. albicans MNN9 (CaMNN9). The plasmid p8A-KpnID was generated by digesting p8A to completion with KpnI. The digest wasthen diluted and religated before being used to transform E. coli. p8A-KpnID wasused for subsequent sequence analysis and construction of the mnn9 deletionconstruct.

The Camnn9 deletion construct was generated by digesting p8A-KpnID withClaI and EcoRV to remove 0.6 kb of the coding sequence. The ClaI site was filledin with Klenow polymerase before BglII linkers were ligated to the blunt ends.The 4.0-kb BamHI/BglII fragment from p5921 (20), carrying the hisG URA3 hisGcassette (18), was inserted into the BglII sites of the modified p8A-KpnID to yieldthe plasmid pM9-8. Ultimately, pM9-8 was digested with HindIII and KpnI,ethanol precipitated, and used to transform the C. albicans uraD strain, CAI4(18).

Recombinant DNA techniques, PCR, and DNA sequencing. Transformation ofE. coli was performed by the calcium chloride method (22). C. albicans wastransformed by the lithium acetate protocol described by Ito et al. (24).

Plasmid DNA was prepared by alkaline lysis (51) or by using Miniprep col-umns (Qiagen, Chatsworth, Calif.). C. albicans genomic DNA for Southernanalysis was isolated by standard protocols (55). Total RNA was isolated aspreviously described by McCreath et al. (38) or by glass bead disruption andextraction in Trizol (GIBCO/BRL, Rockville, Md.). Genomic DNA from C.albicans Miniprep columns was prepared by the spheroplast method described byGuthrie and Fink (21). Northern and Southern transfer and hybridization con-ditions were as previously described (38), except that Northern hybridizations

TABLE 1. Strains used in this study

Organism Strain Genotype Source orreference

C. albicans ATCC 10261 Wild type ATCCSC5314 Wild type 19CAI4 ura3::imm434/ura::imm434; congenic to SC5314 18SSCA-2 mnn9::hisG-URA3-hisG/mnn9::hisG Dura3::imm434/Dura3::imm434 This workSS19-4 Dmnn9::hisG/Dmnn9::hisG Dura3::imm434/Dura3::434 This work

E. coli DH5amcr K-12 (lacZYA-argF)U169 supE44 thi-1 recA1 end1 hsdR17 gyrA relA1 (f80lacZDM15) 22

7440 SOUTHARD ET AL. J. BACTERIOL.

on Septem


.org/D

ownloaded from

http://jb.asm.org/

were at 60°C in Church’s buffer (0.5 M NaH2PO4 [pH 7.0], 1.0 mM EDTA [pH8.0], 7% sodium dodecyl sulfate (SDS), 1% bovine serum albumin). DNA probesfor hybridization were random prime labeled (17) with [a-32P]dCTP by followingthe manufacturer’s instructions (Boehringer Mannheim, Indianapolis, Ind.).Densitometry of X-ray film images was done with a FluorS MultiImager (Bio-Rad).

PCR amplification of C. albicans genomic DNA was performed with Ampli-Taq (Perkin-Elmer Cetus, Norwalk, Conn.) and carried out in an ERICOMPtwin-block thermocycler. The degenerate primers used were 59TGGGTI(C/T)(A/T)ITGGI(G/T)IGA(C/T)G(C/T)TGA39 and 59(C/T)(C/T)TI(G/C)C(A/G)AAI(G/C)C(C/T)TCIGT(C/T)TC39, where I indicates inosine. The primers weredesigned based on the nucleotide sequence encoding conserved regions in thecarboxy termini of the S. cerevisiae Mnn9, Van1, and Anp1 proteins and weresynthesized by the Biopolymer Laboratory at MIT. The conditions of amplifica-tion were denaturation at 95°C for 1 min, annealing at 50°C for 1 min, andextension at 72°C for 1 min.

Double-stranded DNA sequencing was carried out by the chain terminationmethod (52) with a cycle sequencing kit (Epicentre Technologies, Madison,Wis.). C. albicans MNN9 was progressively sequenced by extension of syntheticoligonucleotide primers (Biopolymer Laboratory, MIT) designed based on asequence derived from previous reactions. DNA sequence analysis was per-formed with DNAStar. Comparison of C. albicans MNN9 nucleotide and de-duced amino acid sequences to sequences present in GenBank and EMBLdatabases was carried out with BLAST (National Center for BiotechnologyInformation).

Sensitivity to hygromycin and sodium orthovanadate. Stock solutions of 100mM sodium orthovanadate (Sigma) and 10 mg of hygromycin B (Sigma)/ml wereprepared in distilled water and filter sterilized. Fresh stock solutions were dilutedinto sterile YPD medium containing 2% agar for solid medium. C. albicansyeasts were grown overnight at 30°C before the cultures were equilibrated withfresh medium to an optical density at 600 nm (OD600) of 0.5 (approximately6.0 3 106 cells/ml). Five microliters of each diluted culture was struck ontoquadrants on agar plates containing various concentrations of hygromycin orsodium orthovanadate. The drug concentrations tested were 10, 50, 100, 200,300, 350, and 400 mg of hygromycin/ml and 1, 2, 3, 4, 5, 6, 7, 10, 15, 20, and 25mM vanadate. Growth was scored after 3 and 7 days of incubation at 30°C.

Analysis of cell wall carbohydrate. C. albicans yeast cells (5.0-ml cultures) werelabeled with UDP-[14C]glucose (7.5 mCi), and cell wall polysaccharides werefractionated and quantitated as described by Castro et al. (11).

b-Glucanase sensitivity. b-1,6-glucanase was purified from a commercial en-zyme preparation (cell wall-lysing enzyme; L-2265; Sigma) from Trichodermaharzianum by substrate affinity chromotography and preparative isoelectric fo-cusing with the Rotofor system (Bio-Rad). The enzyme is now commerciallyavailable from BioMarin Pharmaceutical (Novato, Calif.). Both the crude en-zyme preparation and pure b-1,6-glucanase were used to determine the sensi-tivities of C. albicans wild-type and mutant strains, as well as the release of cellwall proteins from those strains.

Sensitivities to crude b-1,3-glucanase from T. harzianum (Sigma; L-2265) andpure b-1,6-glucanase from T. harzianum were determined by a modified versionof the protocol described by Ram et al. (49). Cells were harvested duringlogarithmic growth (approximately 1.5 3 107 to 2.0 3 107 cells/ml) and washedwith 50 mM sodium acetate buffer (pH 5.0). Cells were then suspended in thesame buffer containing either 1 mg of crude b-1,3-glucanase or 15 mg of purifiedb-1,6-glucanase and incubated at 37°C. The OD530 was measured at the onset ofincubation and again 2 h later. The decrease in OD530 over time reflects thepercentage of lysed cells. Cells were also incubated in the same buffer without theaddition of enzyme as controls. Mutants were classified as glucanase sensitivewhen there was greater than 40% reduction in the measured OD530.

Isolation and analysis of cell wall proteins. Yeast cells from 100-ml cultureswere harvested during logarithmic growth (1.25 3 107 to 2.5 3 107 cells/ml) andwashed three times with 10 mM sodium acetate buffer (pH 5.0) containing 1 mMphenylmethylsulfonyl fluoride (PMSF; Sigma). The cells were then resuspendedin 1.0 ml of the same buffer before the addition of glass beads (0.45 mm indiameter) to the meniscus. Cells were disrupted by vortexing three times for 1min each, interspersed with cooling on ice for 30 s. The cell lysate was separatedfrom the glass beads by centrifugation and collected. The glass beads were thenwashed two times with 1 M NaCl, and the washes were pooled with the lysate.Cell walls were pelleted by centrifugation at 1,000 3 g for 10 min, washed twotimes with 1 M NaCl containing PMSF, and then stored in PMSF at 220°C.

Noncovalently bound proteins were extracted from cell wall preparations byincubation in Tris-HCl (pH 7.8) containing 2% SDS, 100 mM EDTA, and 40 mMb-mercaptoethanol for 5 min at 100°C. The cell wall fraction was pelleted bycentrifugation for 5 min at 10,000 3 g, and the supernatant containing SDS-soluble proteins was collected.

Glucanase-extractable proteins were isolated from the SDS-extracted cell wallfractions as follows. SDS-treated cell walls were washed several times with 1 mMPMSF to remove residual SDS. Cell walls were then incubated with pure b-1,6-glucanase from T. harzianum (0.4 g wet weight of cell walls) in 50 mM sodiumacetate buffer (pH 5.0) containing 1 mM PMSF at 37°C for 2 h. As a control, cellwalls were incubated in the same buffer without the addition of enzyme. Thereaction mixture was centrifuged for 5 min at 10,000 3 g, and the supernatantwas analyzed for protein release after glucanase treatment. SDS- and glucanase-

extractable proteins were separated by linear-gradient (4 to 20%) SDS-polyacryl-amide gel electrophoresis (PAGE) and visualized by silver staining (Daiichisilver stain; Integrated Separation Systems, Natick, Mass.).

Photomicroscopy. Cells were mounted on glass slides and photographed witha 340 objective with Nomarski optics on a Nikon Diaphot microscope.

Electrophoretic karyotyping. C. albicans chromosomes were prepared andseparated by pulsed-field electrophoresis as previously described (63). The chro-mosomal blot was kindly provided by Joy Sturtevant (Georgetown UniversityMedical Center, Washington, D.C.). The chromosomal blot was hybridized withthe internal ClaI/EcoRV fragment of CaMNN9 derived from p8A-KpnID. Hy-bridization was performed in Church’s buffer at 60°C before the filter was washedin 23 SSC (13 is 0.15 M NaCl plus 0.015 M sodium citrate) containing 0.1%SDS at 60°C for 15 min.

RT-PCR. Total RNA was isolated from wild-type and Camnn9D strains grownas yeast. Cultures (50 ml) were centrifuged, and the collected cells were washedwith sterile water and resuspended in Trizol (GIBCO/BRL) at 1.0 ml per 2.0 gof wet cells. Cells were disrupted by being vortexed in the presence of glass beads(0.45 nm in diameter), and RNA was extracted in accordance with the manu-facturer’s instructions. RNA samples were precipitated with 0.5 M NaCl and 2volumes of ethanol before RNA concentrations were determined by measuringthe OD260. Total RNA samples (1.0 to 2.0 mg) were treated with DNase (am-plification grade; GIBCO/BRL) by following the manufacturer’s instructions.Total DNase reaction mixtures (10 ml) were subjected to first-strand cDNAsynthesis with a Superscript II kit (GIBCO/BRL) and internal 39 primers specificfor either C. albicans MNN9, VAN1 (59GCGCTCGAGATCACCATTACGATCCGG39 [57a]), or ANP1 (59AGGAGGTTTACAATTGGC39 [57a]). Reversetranscription (RT) reaction mixtures (2 to 5 ml) were utilized directly as tem-plates in PCR mixtures (100 ml) containing 13 PCR buffer, 25 mM MgCl2, 0.8mM dNTP mixture, 1.0 mM concentrations of each 39 (above) and 59 gene-specific primer (CaVAN1, 59GCGCCATGGCCATCTTATATTGAAAGCG39,and CaANP1, 59AAATCACATAATGAGGTAACC39 [57a]), and 4 U of BIO-X-ACT DNA polymerase (ISC:Bioexpress, Kaysville, Utah). PCR consisted ofdenaturation at 95°C for 1 min, annealing at 55°C for 1 min, and extension at72°C for 1 min. Amplification products were separated by electrophoresis on1.2% Separide (GIBCO/BRL) agarose gels, stained with ethidium bromide, andvisualized under UV light.

Nucleotide sequence accession number. The C. albicans MNN9 nucleotidesequence has been deposited in the GenBank and EMBL databases under theaccession no. U63642.

RESULTS

Isolation and analysis of the C. albicans MNN9 gene. De-generate primers were designed based on conserved regionspresent in the S. cerevisiae MNN9, VAN1, and ANP1 nucleotidesequences (Fig. 1). The primers were used to amplify a 420-bpproduct from C. albicans ATCC 10261 genomic DNA. Theamplification product was cloned into PCR-Script (1), andseveral individual clones were sequenced. Sequence analysisrevealed the presence of two sequences which, based on se-quence similarity with the catalogued S. cerevisiae MNN9 andVAN1 sequences in the GenBank database, were identified asportions of the putative C. albicans MNN9 and VAN1 genes.The mixture of amplification products was used to probe di-gests of genomic DNA derived from three strains of C. albicansand hybridized to 3.5- and 4.5-kb HindIII fragments and 2.4-and 6.5-kb EcoRI fragments in all strains analyzed (data notshown). The PCR mixture was subsequently used to screen C.albicans ATCC 10261 HindIII and EcoRI genomic librariesconstructed in pUC18 (38). Several positive clones were iso-lated from each library. Restriction analysis of the positiveclones isolated from the respective libraries revealed HindIIIinserts of 3.5 kb or 2.4-kb EcoRI inserts (data not shown).Initial sequence analysis of the clone containing the 2.4-kbEcoRI fragment showed it to carry the 39 portion of the C.albicans VAN1 gene (which will be described in detail in adifferent study). The clone containing the 3.5-kb HindIII insertwas subcloned to a 2.1-kb HindIII/KpnI fragment in pUC18(plasmid p8A-KpnID; see Fig. 4), and both DNA strands weresequenced. Sequence analysis revealed an ORF of 1,107 bppredicted to encode a protein of 368 amino acids. The deducedamino acid sequence showed 65.6% overall identity with the S.cerevisiae Mnn9 protein, strongly suggesting that the C. albi-cans homolog had been isolated. A relevant feature observed

VOL. 181, 1999 GLYCOSYLATION OF C. ALBICANS CELL WALL MANNOPROTEINS 7441

on Septem


.org/D

ownloaded from

http://jb.asm.org/

in the deduced amino acid sequence is the presence of a region(amino acids 18 to 34) predicted to be a membrane-spanningdomain. A similar domain is present in the same region of theS. cerevisiae MNN9 amino acid sequence (64). Alignment ofthe C. albicans MNN9 gene product sequence with those of theS. cerevisiae MNN9, VAN1, and ANP1 genes indicated signifi-cant homology within the carboxy regions of all predicted pro-teins (Fig. 1). A putative C. albicans homolog of S. cerevisiaeANP1 has been identified by PCR amplification and Southernanalysis (see above; data not shown), indicating the presence ofa similar MNN9 gene family in Candida.

Analysis of chromosomes isolated from two strains of C.albicans showed that MNN9 resides on chromosome 3 in bothstrains (Fig. 2). The same chromosomal blot was stripped andreprobed with the C. albicans URA3 gene (derived from plas-mid p5921), which has been shown to be located on chromo-some 3 (19, 37) for verification of chromosomal mapping (datanot shown). These results, as well as those obtained fromrestriction mapping and Southern analysis (data not shown),suggest that there is only one copy of CaMNN9 present in theC. albicans genome.

Northern analysis of total RNA obtained from C. albicansATCC 10261 growing in either yeast or hyphal phases identi-fied an mRNA of approximately 1.35 kb that hybridized withthe HindIII/KpnI fragment from p8A-KpnID carrying CaMNN9(Fig. 3). The level of MNN9 transcript, as measured by densi-tometry, was only slightly elevated during mycelial growth (1.4times the yeast phase signal) when normalized to values fromsignals obtained after hybridization with the S. cerevisiae actingene (Fig. 3).

Deletion of the MNN9 gene in C. albicans. A homozygousmnn9D strain was constructed by the method devised by Fonziand Irwin (18) in order to determine the phenotypes associatedwith disruption of the C. albicans MNN9 gene. Approximately600 bp of the CaMNN9 ORF was replaced with the hisG URA3hisG cassette (see Materials and Methods), and the resultingconstruct was transformed into CAI4, a C. albicans ura3Dstrain (18). More than 30 Ura1 transformants were obtained,and Southern analysis of three isolates showed that homolo-gous recombination had occurred (Fig. 4). One of the Ura1

MNN9/mnn9 isolates, SS21, was plated on SD medium con-taining uridine and 5-FOA to select for Ura2 revertants that

FIG. 1. Amino acid alignments of the CaMNN9 product with protein sequences encoded by members of the S. cerevisiae MNN9 gene family. Boxes indicate aminoacid identity. The putative membrane-spanning domains present in the CaMNN9 and ScMNN9 proteins are overlined. Arrows indicate sequences used to design primersfor amplification of C. albicans genomic DNA.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

would arise from excision of the URA3 gene as a result ofrecombination of the flanking hisG repeats (18). Two of thethree isolates analyzed by Southern hybridization had under-gone the desired event (Fig. 4), resulting in strains that wereMNN9/mnn9 heterozygotes, auxotrophic for uracil.

In order to obtain a homozygous mnn9 deletion strain, theaforementioned heterozygotes, SS22 and SS62, were trans-formed with the same deletion construct and Ura1 transfor-mants were once again selected. Over 60 transformants were

checked by Southern analysis before one homozygous dis-ruptant was identified (Fig. 4). Ultimately, five Ura1 mnn9/mnn9 strains were isolated (all showed the same hybridizationpattern, suggesting that the same recombination event hadoccurred in each strain), and one such strain, SSCA-2, wasused for further studies. Ura2 auxotrophic strain SS19-4 wasderived from SSCA-2 by following the same protocol as thatdescribed above. Northern analysis of total RNA obtainedfrom each of the null mutants (Ura1 and Ura2) verified thatCaMNN9-specified transcripts were not produced in thosestrains (data not shown). In most instances, the Ura1 strainsSC5314 and SSCA-2 were used for the analyses describedbelow, since their respective Ura2 derivatives (CAI4 andSS19-4) tended to grow more slowly. Often, experiments wererepeated with the other independently isolated homozygousdeletion strains to verify that the phenotypes were the same.When SS19-4 was used in studies, it was compared to Ura2

strain CAI4.Morphology and growth phenotype of mnn9D cells. The C.

albicans mnn9/mnn9 double disruptants exhibited many of thesame growth phenotypes as those observed for their S. cerevi-siae mnn9 strain counterparts (2, 64). Specifically, Camnn9D

FIG. 2. Chromosomal analysis of CaMNN9. Chromosomes isolated from C.albicans CAI4 and ATCC 10261 (A, lanes 1 and 2, respectively) were probed withthe internal 600-bp ClaI/EcoRV fragment from p8A-KpnID (B). Chromosomaldesignations are on the left. CaMNN9 resides on chromosome 3 in both strains.

FIG. 3. Analysis of expression of CaMNN9. Shown is a Northern analysis oftotal RNA (10 mg) isolated from C. albicans ATCC 10261 growing in either yeast(lane Y) or hyphal (lane H) growth phases. The blot was probed with the internalClaI/EcoRV fragment of CaMNN9 (A), stripped, and reprobed with the S.cerevisiae actin gene (B).

FIG. 4. Strategy used for disruption of both alleles of the C. albicans MNN9gene. (A) Restriction map of a genomic fragment containing CaMNN9. The600-bp ClaI/EcoRV fragment was replaced with the 4.0-kb BglII/BamHI frag-ment carrying the hisG URA3 hisG cassette (see Materials and Methods). (B)Southern analysis of genomic DNA from strains obtained during the deletionprocess. DNA was digested with HindIII and separated by agarose gel electro-phoresis. After transfer to a nylon membrane, the blot was probed with the2.1-kb HindIII/KpnI fragment containing CaMNN9. Lane 1, SC5314 (wild type);lane 2, CAI4 (wild type, Ura2); lane 3, SS21 (MNN9/mnn9, Ura1); lane 4, SS22(MNN9/mnn9, Ura2); lane 5, SSCA-2 (mnn9/mnn9, Ura1); lane 6, SS19-4(mnn9/mnn9, Ura2). The 3.5-kb band represents the wild-type MNN9 locus. The6.9- and 4.0-kb bands correspond to the Camnn9::hisG-URA3-hisG andCamnn9::hisG loci, respectively.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

strains grew more slowly than the wild-type strain, exhibited asmall, dry-colony phenotype on solid media, and grew as largeclumps in liquid media. Addition of osmotic stabilizers, such assorbitol and KCl, to media provided some reparation of growthdefects but did not restore normal growth rates or phenotypes.Disruption of CaMNN9 also resulted in an impairment in con-version of yeast cells to hyphal growth forms. Strains SSCA-2and SS19-4 were induced to form germ tubes in either 10%serum or RPMI 1640 medium, and in both instances the fre-quency of germ tube formation was greatly reduced comparedto those for strains SC5314 and CAI4, respectively (data notshown). Hyphal formation also appeared abnormal in thatmany pseudohyphae were observed among yeast and hyphalcells in large aggregates. When cells were viewed under amicroscope with Normarski optics, the differences in the cellmorphology of both yeast and hyphal cells were found to bequite pronounced (Fig. 5). These results are indicative of adefect that affects the biosynthesis and/or assembly of the C.albicans cell wall, as would be expected in strains defective inprotein glycosylation or secretion processes. In turn, poorgrowth and the inability to properly form hyphae suggest thatthe mnn9 strains might lack the appropriate adherence and/orinvasive properties necessary to establish infection.

Effect of MNN9 deletion on sensitivities to hygromycin andsodium orthovanadate. Yeast mutants with defects in Golgi

apparatus-specific glycoprotein processing, including all mem-bers of the S. cerevisiae MNN9 gene family, have shown resis-tance to sodium orthovanadate and sensitivity to the amino-glycoside antibiotic hygromycin B (5, 15). Thus, the C. albicansmnn9D strains were tested to determine sensitivity to thesecompounds. Both Ura1 and Ura2 derivative Camnn9D strains,as well as the respective Ura1 and Ura2 wild-type Candidastrains, were scored for growth on YPD plates containing var-ious amounts of hygromycin B or sodium orthovanadate (Ta-ble 2). As anticipated, the mnn9D strains displayed resistanceto sodium orthovanadate, being able to grow on plates con-taining 20 mM vanadate. In contrast, the wild-type parentalstrains were completely inhibited on plates containing 15 mMvanadate. In turn, the Candida mnn9 mutants were sensitive tohygromycin. Both wild-type strains were able to grow on me-dium supplemented with 300 mg of hygromycin per ml, whilethe mnn9 strains were completely growth inhibited at 100 mg ofhygromycin/ml. Since hygromycin sensitivity is due, at least inpart, to defects in glycosylation (15), these results suggestedthat disruption of C. albicans MNN9 results in a glycosylationdefect similar to that observed in S. cerevisiae mnn9 strains (3,64).

mnn9D strain cell walls contain reduced mannan levels. Theresults of drug studies suggested that disruption of CaMNN9resulted in an inability to properly glycosylate secreted and/or

FIG. 5. Morphology of yeast and hyphal growth forms of C. albicans wild-type and mnn9D strains. Yeast cells (Y) were grown in YPD to an OD600 of 1.0. Thedimorphic transition to hyphal growth was induced by the addition of serum to 10% and shifting the culture to 37°C. Hyphal samples (H) were observed after 4 h ofincubation. Cells were viewed under a microscope with Nomarski optics.

TABLE 2. Phenotypic effects of disruption of CaMNN9

StrainDrug sensitivitya % [14C]glucose incorporatedb into: Glucanase sensitivityc

Vanr Hygs Alkali-insoluble fraction Alkali-soluble b-glucan Mannan Crude b-1,3 Pure b-1,6

SC5314 (WT)d 2 1 52 16 14 2 1SSCA-2 (Dmnn9) 1 2 56 24 7 2 2

a Resistance to sodium orthovanadate (Van) and sensitivity to hygromycin B (Hyg) were measured as growth on YPD medium supplemented with variousconcentrations of drug (see Materials and Methods). 1, phenotype present; 2, phenotype absent.

b Results are percentages of incorporation of radioactivity from [14C]glucose into different cell wall polysaccharide fractions. Experiments were done in triplicate.c Crude glucanase preparation from T. harzianum (Sigma) contains b-1,3-glucanase, b-1,6-glucanase, and chitinase activities. 1, sensitive; 2, not sensitive.d WT, wild type.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

cell wall-associated mannoproteins. Such a defect should di-rectly result in a reduction of the mannan content of the mnn9strain cell wall. Thus, mutant and wild-type strains were grownin YPD medium containing radioactive glucose to label thevarious cell wall carbohydrate components. Cell walls werethen isolated, and the amounts of radioactivity incorporatedinto the alkali-insoluble, alkali-soluble b-glucan, and mannancell wall fractions were determined (Table 2). As anticipated,the mnn9 deletion strain cells exhibited a significant decrease(50%) in the mannan portion of their cell walls compared tothe wild-type strain. In cell walls extracted from strain SSCA-2mannan comprised only 7% of total cell wall carbohydrate,compared to 14% for wild-type strain SC5314. Interestingly,the incorporation of radioactive glucose into the alkali-solubleb-glucan fraction was clearly increased in the disrupted strains.This might reflect an attempt by the mutant cells to compen-sate for the mannan synthesis defect.

Effect of MNN9 deletion on sensitivity to glucanase. Sensi-tivity to glucanase is often used as a parameter for changes incell wall composition in yeast (35, 49). The C. albicans mnn9Dstrains were tested for sensitivity to a crude b-1,3-glucanaseand a purified b-1,6-glucanase preparation. Both Ura1 andUra2 derivative Camnn9D strains were found to be sensitive tob-1,3-glucanase compared to the Ura1 and Ura2 wild-typeCandida strains. In contrast, both the mutant and wild-typestrains (Ura1 and Ura2) were insensitive to lysis by treatmentwith pure b-1,6-glucanase (Table 2). Control cells incubatedunder similar conditions without the addition of either enzymeshowed no lysis.

Analysis of cell wall-associated proteins. The S. cerevisiaemnn9 strain has recently been used to study the anchorage,structure, and types of cell wall proteins released after treat-ment with glucanases (30, 42, 61). Therefore, it was of interestto determine if disruption of CaMNN9 altered the profile ofproteins released by this method. Strains SC5314 and SSCA-2were grown to exponential phase, and cell walls were prepared(see Materials and Methods). Proteins released from cell wallsafter treatment with SDS were separated by SDS-PAGE anddetected by silver staining. No obvious differences between theprofiles of proteins released from the cell walls of mnn9D straincells and wild-type strain cells were observed (Fig. 6). Cell wallfractions remaining after extraction with SDS were digestedwith either a purified b-1,6-glucanase from Trichoderma or acrude Trichoderma b-1,3-glucanase to release covalently bound

mannoproteins. SDS-PAGE analysis of the resulting proteinextracts showed the release of b-1,6-glucosylated mannopro-teins from both mutant and wild-type strains (Fig. 6). Indeed,more high-molecular-weight proteins were released from themnn9D strain cell walls than from the wild-type cell walls. It ispossible that the reduction in the mannan content of the mu-tant cell wall facilitates the release of those glucan-linked pro-teins by providing better enzyme access. Treatment with thecrude b-1,3-glucanase resulted in the release of a low level ofproteins detectable by silver staining from SDS-extracted cellwalls derived from either the mutant or wild-type strains (Fig.6).

Analysis of MNN9 gene family transcript levels in mnn9Dstrain cells. The proteins encoded by the SaccharomycesMNN9 gene family have been shown to interact physically andmight have overlapping and/or redundant enzymatic activities(26). Thus, experiments were performed to determine if ex-pression of the Candida family member genes was affected ina mnn9D strain background. PCR was initially performed withgenomic DNAs obtained from both wild-type C. albicansSC5314 and the mnn9D strain SSCA-2 as the templates. Prim-ers were designed on the basis of known sequences of C.albicans MNN9, VAN1, and ANP1 (57a). Amplification prod-ucts of the expected sizes were obtained for all template-primer combinations, except for MNN9 with mnn9D DNA asthe template, as expected (data not shown). In addition, equiv-alent amounts of DNA were amplified for each gene in bothstrains (data not shown). Each of the gene-specific primers wasthen used in RT-PCR, and the predicted products were ob-tained (Fig. 7). Little or no product was obtained when thecontrol reaction mixture with no reverse transcriptase was usedas the template with ANP1-specific primers or when MNN9gene-specific primers were used to amplify the SSCA-2 cDNAreaction. The expected 500- and 350-bp products were ampli-fied from the respective VAN1 and ANP1 cDNAs derived fromthe wild-type and mnn9D strains, with no apparent significant

FIG. 6. SDS-PAGE analysis of b-1,6-glucanase-soluble (A), b-1,3-glucanase-soluble (B), and SDS-soluble (C) proteins extracted from C. albicans SSCA-2(Dmnn9) and SC5314 (wild type) cell walls. Controls are represented as un-treated wild-type (lanes 1 and 5) and Dmnn9 (lanes 2 and 6) strain cell walls.Proteins isolated from wild-type (odd-numbered lanes) and mutant (even-num-bered lanes) strain cell walls after treatment with either b-1,6-glucanase (lanes 3and 4), b-1,3-glucanase (lanes 7 and 8), or SDS (lanes 9 and 10) were separatedon 4- to 20% gradient gels and visualized by silver staining. Molecular massstandards (in kilodaltons) are shown on the left.

FIG. 7. RT-PCR (A) and Northern (B) analysis of expression of MNN9family genes in C. albicans wild-type and Dmnn9 strains. RT-PCR was performedwith RNA extracted from wild-type strain SC5314 (lanes 1 to 4) and Dmnn9strain SSCA-2 (lanes 5 to 8). cDNA synthesis and subsequent amplification weredone with primers specific for the C. albicans MNN9 (lanes 2 and 6), VAN1 (lanes3 and 7), and ANP1 (lanes 4 and 8) genes. Control reactions (lanes 1 and 5)utilized ANP1-specific primers, and reaction mixtures contained no reverse tran-scriptase. Northern blot analysis was performed with total RNA (10 mg) isolatedfrom strains SC5314 (lane 1) and SSCA-2 (lane 2), and the purified wild-typeMNN9, VAN1, and ANP1 RT-PCR products were used as probes. The blot wasstripped sequentially between hybridizations and was probed with the S. cerevi-siae actin gene as a quantitative control for gel loading.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

differences in product amount. In turn, the results of Northernblot experiments show no substantial difference in ANP1 orVAN1 transcript levels between wild-type and mnn9D strains(Fig. 7). Total RNA (10 mg) obtained from both SC5314 andSSCA-2 was Northern blotted and probed (sequentially, strip-ping the blot after each hybridization) with either the 501-bpVAN1 PCR product, the 299-bp ANP1 product, or the 965-bpMNN9 product. The relative transcript levels were similar in allcases to levels of actin transcript obtained after stripping theblot and reprobing with the S. cerevisiae actin gene (Fig. 7). Asexpected, no transcript was identified when the MNN9 PCRproduct was used to probe RNA derived from strain SSCA-2.Jungmann and Munro previously observed a lower level ofAnp1 protein immunoprecipitated from an S. cerevisiae mnn9Dstrain (26). Our results suggest that the decrease observed isdue to posttranslational processing (most probably degrada-tion of uncomplexed Anp1p) rather than changes at the tran-scriptional level.

DISCUSSION

We have isolated and characterized the MNN9 gene fromthe fungal pathogen C. albicans and examined some of thephenotypic effects of disruption of this gene. Analysis of thegene sequence revealed an intron-free ORF of 1,107 bp en-coding a protein of 368 amino acids. As expected, CaMNN9has a high degree of homology with its S. cerevisiae counterpartat the deduced amino acid sequence level (65.6%), with severalblocks of strong homology within the predicted carboxy ter-mini. A predicted transmembrane domain is present betweenresidues 18 and 34 of the amino acid sequence. Similar regionshave been identified in the amino termini of S. cerevisiaeMNN9 gene family member proteins (12, 64). Additionally,electrophoretic karyotype analysis mapped CaMNN9 to chro-mosome 3 in both strains examined. A single mRNA of ap-proximately 1.35 kb was identified in both the yeast and hyphalmorphological growth phases of C. albicans. In addition, nosignificant difference in transcript levels was observed, whichsuggests that the CaMNN9 gene is not growth phase regulated.Both chromosomal copies of CaMNN9 were disrupted by the“URA blaster” method (18). Many of the phenotypes exhib-ited by the mutant were indicative of cell wall defects, includingosmotic instability, slow growth, severe clumping in liquid me-dia, and abnormal colony formation on solid media. The ad-dition of osmotic stabilizers did not have a pronounced effecton cell growth or stability. Hyphal formation was also impairedboth in terms of frequency of conversion of yeast cells tohyphal forms and the elaboration of defective hyphae andmany pseudohyphae. An inability to correctly synthesize cellwall components would certainly influence proper expansion ofthe cell wall during yeast-to-mycelium conversion. Indeed, ex-amination of radioactively labeled cell wall carbohydrate com-ponents showed Camnn9D strain cell walls to contain half theamount of mannose present in parental strain cell walls. Inaddition, a greater amount of alkali-soluble b-glucans waspresent in mutant cell walls than in wild-type cell walls, sug-gesting an attempt to compensate for the mannan defect. Likeall strains carrying mutant members of the S. cerevisiae MNN9gene family, Camnn9D strains were shown to be resistant tosodium orthovanadate and sensitive to the aminoglycoside an-tibiotic hygromycin B. Camnn9D strains also proved to besensitive to lysis by a crude b-1,3-glucanase preparation, whilethe parental strains were resistant. Since increased sensitivityto b-1,3-glucanases is indicative of altered cell wall composi-tion (35, 49) and since sensitivity to hygromycin has beenshown to correlate with defects in glycosylation (15), it is as-

sumed that deletion of CaMNN9 directly affects the mannosy-lation of cell wall-associated mannoproteins. Treatment ofSDS-extracted cell walls with a purified T. harzianum b-1,6-glucanase resulted in the release of more covalently bound,high-molecular-weight proteins from mutant cell walls thanfrom wild-type cell walls. These proteins probably representglycosyl phosphatidylinositol (GPI)-anchored proteins that areheavily O-mannosylated. Examination of secreted chitinasefrom S. cerevisiae MNN9 gene family knockout strains showedthat the processes of O glycosylation remain intact in thesemutant strains and that only N-linked glycosylation is affected(57a). It could be inferred that the overall reduction in themannan content of the Camnn9 mutant cell wall would facili-tate the release of these proteins linked to glucan. Indeed, theS. cerevisiae mnn9 strain has been utilized by others in similarexperiments to gain a clearer understanding of the types ofproteins that are cell wall associated and how, and to what cellwall components, they are anchored (30, 42, 61).

The shared phenotypes of S. cerevisiae mnn9 gene familymutants suggest that Mnn9p, Anp1p, and Van1p might per-form redundant enzymatic activities. Certain proteins encodedby members of the MNN9 gene family have also been shown tophysically interact with each other (26) (see below), suggestingeither overlapping or coordinate functions. It was of interest todetermine if the loss of function of one gene family member inC. albicans would affect the transcriptional activity of either ofthe other family member genes. The results of RT-PCR andNorthern analysis of CaVAN1 and CaANP1 expression in aCamnn9D strain showed that neither of these genes is up ordown regulated in the absence of the CaMNN9 transcript. Ithad been observed that the steady-state level of S. cerevisiaeAnp1p was reduced in an S. cerevisiae mnn9D strain (26). Ourresults suggest that Anp1p is probably degraded in the absenceof its complex partner, Mnn9p.

Recently, Jungmann and Munro (26) have provided greaterinsight into the role S. cerevisiae MNN9 gene family membersplay in the synthesis of the outer chain of cell wall mannan. Themodel they propose suggests that a Mnn9p-Van1p complex isresponsible for the synthesis of a short a-1,6-mannose chainonto the initiating mannose residue, placed by Och1p. Themannose polymer is then extended to its full length by theaction of the Mnn9p-Anp1p complex, which also catalyzes theaddition of the initial a-1,2-mannose branches. Mnn2p andMnn5p have recently been identified as the a-1,2-mannosyl-transferases responsible for the initiation and extension ofadditional a-1,2-mannose branches, respectively (50). Ulti-mately, the chains are terminated by the Mnn1p (64)-catalyzedaddition of an a-1,3-linked mannose, and phosphomannose isincorporated by Mnn6p (62).

While proteins encoded by MNN9 gene family members areobviously directly involved in yeast glycosylation, acting eitheras mannosyltransferases themselves or by organizing and di-recting the appropriate mannosyltransferases, there is a greatdeal of evidence which suggests that they are involved in othercellular processes. Loss of Anp1p results in mislocalization ofvarious Golgi apparatus resident proteins (12, 46). Anp1p hasalso been shown to interact genetically with Bet5p, a proteininvolved in transport from the endoplasmic reticulum to theGolgi apparatus (25). Additionally, ANP1 was identified in ascreen for genes of mutants defective in polarized growth, butwith no defects in actin cytoskeleton structure (41). Interest-ingly, the mutation of ANP1 was recently shown to be synthet-ically lethal in conjunction with cmd1A, a temperature-sensi-tive yeast calmodulin mutant which confers a defect in actinorganization (54). In turn, both anp1 and cmd1A proved to besynthetically lethal with a specific mutation of MYO2, a gene


on Septem


.org/D

ownloaded from

http://jb.asm.org/

that encodes a calmodulin-binding class V myosin (54). Theseresults implicate Anp1p either directly, or indirectly by virtueof its role in glycosylation, in the regulation of actin organiza-tion.

In conclusion, since MNN9 gene structure and function seemto be well conserved between C. albicans and S. cerevisiae andsince gene families have been identified in both genera, thefundamental role this gene plays in C. albicans cellular pro-cesses should be further investigated. Disruption of CaMNN9results in phenotypes that are inconsistent with pathogenicity,including poor growth, aberrant hypha formation, and alteredcell wall composition. Since the Candida cell wall is essentialfor the biology and pathogenicity of the organism it is likelythat mutation of MNN9 will render the strain avirulent. In fact,recent studies have shown that disruption of genes that encodeO-mannosyltransferases in C. albicans does alter the virulencecapabilities of the knockout strains (7, 59). Thus, we are cur-rently assessing the adherence capabilities of the Camnn9Dstrains and ultimately will test the virulence of these strains inanimal models of infection. Unfortunately, the severe clump-ing phenotype and osmotic instability of the deletion mutantpresent obstacles to these studies and are being addressed atthis time. Ultimately, the results of those experiments willdefine members of this family as potential drug targets.

ACKNOWLEDGMENTS

We thank Carlos Hirschberg (Boston University Medical Center)for critical reading of this manuscript, W. A. Fonzi, June Zhao, and JoySturtevant (Georgetown University Medical Center) for strains, plas-mids, and the karyotype blot, respectively, and Letty Vega (MIT) forthe S. cerevisiae actin gene. We also thank Paul Awald (MIT) for helpwith the cell wall carbohydrate analysis and Stu Levitz (Boston Uni-versity Medical Center) for use of the Nikon Diaphot microscope.

This work was supported by grants from the National Institutes ofHealth, GM45188 (to P.W.R.) and CA14051 (to R. O. Hynes).

REFERENCES

1. Alani, E., L. Cao, and N. Kleckner. 1987. A method for gene disruption thatallows repeated use of URA3 selection in the construction of multiply dis-rupted yeast strains. Genetics 116:541–545.

2. Ballou, C. E. 1982. Yeast cell wall and cell surface, p. 335–360. In J. N.Strathern, E. W. Jones, and J. R. Broach (ed.), The molecular biology of theyeast Saccharomyces. Metabolism and gene expression. Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y.

3. Ballou, C. E. 1990. Isolation, characterization and properties of Saccharo-myces mnn mutants with non-conditional protein glycosylation defects.Methods Enzymol. 185:440–476.

4. Ballou, L., R. E. Cohen, and C. E. Ballou. 1980. Saccharomyces cerevisiaemannoprotein mutants that make mannoproteins with a truncated outerchain. J. Biol. Chem. 255:5986–5991.

5. Ballou, L., R. A. Hitzeman, M. S. Lewis, and C. E. Ballou. 1991. Vanadate-resistant yeast are defective in protein glycosylation. Proc. Natl. Acad. Sci.USA 88:3209–3212.

6. Bulawa, C. E., D. W. Miller, L. K. Henry, and J. W. Becker. 1995. Attenuatedvirulence of chitin-deficient mutants of Candida albicans. Proc. Natl. Acad.Sci. USA 92:10570–10574.

7. Buurman, E. T., C. Westwater, B. Hube, A. J. Brown, F. C. Odds, and N. A.Gow. 1998. Molecular analysis of CaMnt1p, a mannosyl transferase impor-tant for adhesion and virulence of Candida albicans. Proc. Natl. Acad. Sci.USA 95:7670–7675.

8. Calderone, R. A., and P. C. Braun. 1991. Adherence and receptor relation-ships of Candida albicans. Microbiol. Rev. 55:1–20.

9. Calderone, R. A., and M. Fukayama. 1992. Virulence-associated mannopro-teins of Candida albicans, p. 524–545. In J. A. Sutcliffe and N. H. Georgeo-papadakou (ed.), Emerging targets in antibacterial and antifungal chemo-therapy. Chapman and Hall, New York, N.Y.

10. Calderone, R. A. 1994. The recognition of host cells by the pathogenic yeast,Candida albicans. Jpn. J. Med. Mycol. 35:9–18.

11. Castro, C., J. C. Ribas, M. H. Valdivieso, R. Varona, F. Del Rey, and A.Duran. 1995. Papulacandin B resistance in budding and fission yeast: isola-tion and characterization of a gene involved in (1,3)b-D-glucan synthesis inSaccharomyces cerevisiae. J. Bacteriol. 177:5732–5739.

12. Chapman, R. E., and S. Munro. 1994. The functioning of the yeast Golgi

apparatus requires an ER protein encoded by ANP1, a member of a newfamily of genes affecting the secretory pathway. EMBO J. 13:4896–4907.

13. Chappell, T., N. Hajibagheri, K. Ayscough, M. Pierce, and G. Warren. 1994.Localization of an a-1,2 galactosyltransferase activity to the Golgi apparatusof Schizosaccharomyces pombe. Mol. Biol. Cell 5:519–528.

14. Cutler, J. E. 1991. Putative virulence factors of Candida albicans. Annu. Rev.Microbiol. 45:187–218.

15. Dean, N. 1995. Yeast glycosylation mutants are sensitive to aminoglycosides.Proc. Natl. Acad. Sci. USA 92:1287–1291.

16. Dean, N., and J. B. Poster. 1996. Molecular and phenotypic analysis of the S.cerevisiae MNN10 gene identifies a family of related glycosyltransferases.Glycobiology 6:73–81.

17. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNArestriction endonuclease fragments to high specific activity. Anal. Biochem.132:6–13.

18. Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and genemapping in Candida albicans. Genetics 134:717–728.

19. Gillum, A. M., E. Y. Tsay, and D. R. Kirsch. 1984. Isolation of the Candidaalbicans gene for orotidine-59-phosphate decarboxylase by complementationof S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179–182.

20. Gow, N. A. R., P. W. Robbins, J. W. Lester, A. J. P. Brown, W. A. Fonzi, T.Chapman, and O. Kinsman. 1994. A hyphal-specific chitin synthase gene(CHS2) is not essential for growth, dimorphism or virulence of Candidaalbicans. Proc. Natl. Acad. Sci. USA 91:6216–6220.

21. Guthrie, C., and G. R. Fink. 1991. Guide to yeast genetics and molecularbiology. Methods Enzymol. 194:169–182.

22. Hanahan, D. 1988. Techniques for transformation of E. coli, p. 109–135. InD. M. Glover (ed.), DNA cloning. IRL Press, Oxford, United Kingdom.

23. Herscovics, A., and P. Orlean. 1993. Glycoprotein synthesis in yeast. FASEBJ. 7:540–548.

24. Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation ofintact yeast cells with alkali cations. J. Bacteriol. 153:163–168.

25. Jiang, Y., A. Scarpa, L. Zhang, S. Stone, E. Feliciano, and S. Ferro-Novick.1998. A high-copy suppressor screen reveals genetic interactions betweenBET3 and a new gene: evidence for a novel complex in ER-to-Golgi trans-port. Genetics 49:833–841.

26. Jungmann, J., and S. Munro. 1998. Multi-protein complexes in the cis Golgiof S. cerevisiae with a-1,6 mannosyltransferase activity. EMBO J. 17:423–434.

27. Kanbe, T., Y. Han, B. Redgrave, M. Rieselman, and J. Cutler. 1993. Evi-dence that mannans of Candida albicans are responsible for adherence ofyeast forms to spleen and lymph node tissue. Infect. Immun. 61:2578–2584.

28. Kanik-Ennulat, C., and N. Neff. 1990. Vanadate-resistant mutants of Sac-charomyces cerevisiae show alterations in protein phosphorylation andgrowth control. Mol. Cell. Biol. 10:898–909.

29. Kanik-Ennulat, C., E. Montalvo, and N. Neff. 1995. Sodium orthovanadate-resistant mutants of Saccharomyces cerevisiae show defects in Golgi-medi-ated protein glycosylation, sporulation and detergent resistance. Genetics140:933–943.

30. Kapteyn, J. C., R. C. Montijn, E. Vink, J. de la Cruz, H. Shimoi, P. N. Lipke,and F. M. Klis. 1996. Retention of Saccharomyces cerevisiae cell wall proteinsthrough a phosphodiester-linked b-1,3-/b-1,6-glucan heteropolymer. Glyco-biology 6:337–345.

31. Kurtz, M. B., R. Kelly, and D. R. Kirsch. 1990. Molecular biology of Candidaalbicans, p. 21–74. In D. R. Kirsch, R. Kelly, and M. B. Kurtz (ed.), Thegenetics of Candida albicans. CRC Press, Inc., Boca Raton, Fla.

32. Kwon-Chung, K. J., D. Lehman, C. Good, and P. T. Magee. 1985. Geneticevidence for role of extracellular proteinase in virulence of Candida albicans.Infect. Immun. 49:571–575.

33. Kwon-Chung, K. J., and J. E. Bennett. 1992. Medical mycology, p. 280–336.Lea and Febiger, Philadelphia, Pa.

34. Lee, K. L., H. R. Buckley, and C. C. Campbell. 1975. An amino acid liquidsynthetic medium for development of mycelial and yeast forms of Candidaalbicans. Sabouraudia 13:148–153.

35. Lussier, M., A. M. White, J. Sheraton, T. diPaolo, J. Treadwell, S. B.Southard, C. I. Horenstein, J. Chen-Weiner, A. R. J. Ram, J. C. Kapteyn, T.Roemer, D. H. Vo, D. C. Bondoc, J. Hall, W. W. Zhong, A. M. Sidcu, J.Davies, F. M. Klis, P. W. Robbins, and H. Bussey. 1997. Large scale iden-tification of genes involved in cell surface biosynthesis and architecture inSaccharomyces cerevisiae. Genetics 147:435–450.

36. Lussier, M., A. M. Sidcu, S. Shahinian, and H. Bussey. 1998. The Candidaalbicans KRE9 gene is required for cell wall b-1,6-glucan synthesis and isessential for growth on glucose. Proc. Natl. Acad. Sci. USA 95:9825–9830.

37. Magee, B. B., Y. Koltin, J. A. Gorman, and P. T. Magee. 1988. Assignmentof cloned genes to the seven electrophoretically separated Candida albicanschromosomes. Mol. Cell. Biol. 8:4721–4726.

38. McCreath, K. J., C. A. Specht, and P. W. Robbins. 1995. Molecular cloningand characterization of chitinase genes from Candida albicans. Proc. Natl.Acad. Sci. USA 92:2544–2548.

39. McKnight, G. L., T. S. Cardillo, and F. Sherman. 1981. An extensive dele-tion causing overproduction of yeast iso-2-cytochrome c. Cell 25:409–419.

40. Mio, T., M. Adachi-Shimizu, Y. Tachibana, H. Tabuchi, S. B. Inoue, T. Yabe,


on Septem


.org/D

ownloaded from

http://jb.asm.org/

T. Yamada-Okabe, M. Arisawa, T. Watanabe, and H. Yamada-Okabe. 1997.Cloning of the Candida albicans homolog of Saccharomyces cerevisiae GSC1/FKS1 and its involvement in b-1,3-glucan synthesis. J. Bacteriol. 179:4096–4105.

41. Mondesert, G., D. J. Clarke, and S. I. Reed. 1997. Identification of genescontrolling growth polarity in the budding yeast Saccharomyces cerevisiae: apossible role of N-glycosylation and involvement of the exocyst complex.Genetics 147:421–434.

42. Montijn, R. C., J. van Rinsum, F. A. van Schagen, and F. M. Klis. 1994.Glucomannoproteins in the cell wall of Saccharomyces cerevisiae contain anovel type of carbohydrate side chain. J. Biol. Chem. 269:19338–19342.

43. Nakayama, K., T. Nagusa, Y. Shimma, J. Kuromitu, and Y. Jigami. 1992.OCH1 encodes a novel membrane bound mannosyltransferase: outer chainelongation of asparagine-linked oligosaccharides. EMBO J. 11:2511–2519.

44. Navarro-Garcia, F., M. Sanchez, J. Pla, and C. Nombela. 1995. Functionalcharacterization of the MKC1 gene of Candida albicans, which encodes amitogen-activated protein kinase homolog related to cell integrity. Mol. Cell.Biol. 15:2197–2206.

45. Neiman, A. M., V. Mhaiskar, V. Manus, F. Galibert, and N. Dean. 1997.Saccharomyces cerevisiae HOC1, a suppressor of pkc1, encodes a putativeglycosyltransferase. Genetics 145:637–645.

46. Nothwehr, S. F., N. J. Bryant, and T. H. Stevens. 1996. The newly identifiedyeast GRD genes are required for retention of late-Golgi membrane pro-teins. Mol. Cell. Biol. 16:2700–2707.

47. Odds, F. C. 1994. Candida species and virulence. ASM News 60:313–318.48. Paravicini, G., A. Mendiza, B. Antonsson, M. Cooper, C. Losberger, and M.

Payton. 1996. The Candida albicans PKC1 gene encodes a protein kinase Chomolog necessary for cellular integrity, but not for dimorphism. Yeast12:741–756.

49. Ram, A. F. J., A. Wolters, R. T. Hoopen, and F. M. Klis. 1994. A newapproach for isolating cell wall mutants in Saccharomyces cerevisiae byscreening for hypersensitivity to Calcofluor white. Yeast 10:1019–1030.

50. Rayner, J. C., and S. Munro. 1998. Identification of the MNN2 and MNN5mannosyltransferases required for forming and extending the mannosebranches of the outer chain mannans of Saccharomyces cerevisiae. J. Biol.Chem. 273:26836–26843.

51. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

52. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with

chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.53. Sarthy, A. V., T. McGonigal, M. Coen, D. J. Frost, J. A. Meulbroek, and R. C.

Goldman. 1997. Phenotype in Candida albicans of a disruption of the BGL2gene encoding a 1,3-b-glucosyltransferase. Microbiology 143:367–376.

54. Sekiya-Kawasaki, M., D. Botstein, and Y. Ohya. 1998. Identification offunctional connections between calmodulin and the yeast actin cytoskeleton.Genetics 150:43–48.

55. Sherman, F., G. R. Fink, and J. B. Hicks. 1986. Methods in yeast genetics: alaboratory course manual. Cold Spring Harbor Press, Cold Spring Harbor,N.Y.

56. Sobel, J. D., G. Muller, and H. R. Buckley. 1984. Clinical role of germ-tubeformation in the pathogenesis of candidal vaginitis. Infect. Immun. 44:576–580.

57. Soll, D. R., C. J. Langtimm, J. McDowell, J. Hicks, and R. Galask. 1987.High-frequency switching in Candida strains from vaginitis patients. J. Clin.Microbiol. 25:1611–1622.

57a.Southard, S. Unpublished data.58. Thompson, J. R., C. M. Douglas, W. Li, C. K. Jue, B. Premanik, X. Yuan,

T. H. Rude, D. L. Tofaletti, J. R. Perfect, and M. Kurtz. 1999. A glucansynthase FKS1 homolog in Cryptococcus neoformans is single copy and en-codes an essential function. J. Bacteriol. 181:444–453.

59. Timpel, C., S. Strahl-Bolsinger, S. Ziegelbauer, and J. F. Ernst. 1998. Mul-tiple functions of Pmt1p-mediated O-mannosylation in the fungal pathogenCandida albicans. J. Biol. Chem. 273:20837–20846.

60. Tsai, P. K., P. Frevert, and C. E. Ballou. 1984. Carbohydrate structure ofSaccharomyces cerevisiae mnn9 mannoprotein. J. Biol. Chem. 259:3805–3811.

61. van der Vaart, J. M., L. H. P. Caro, J. W. Chapman, F. M. Klis, and C. T.Verrips. 1995. Identification of three mannoproteins in the cell wall ofSaccharomyces cerevisiae. J. Bacteriol. 177:3104–3110.

62. Wang, X. H., K. Nakayama, Y. Shimma, A. Tanaka, and Y. Jigami. 1997.MNN6, a member of the KRE2/MNT1 family, is the gene responsible formannosylphosphate transfer in Saccharomyces cerevisiae. J. Biol. Chem. 272:18117–18124.

63. Wickes, B. L., J. E. Golin, and K. J. Kwon-Chung. 1991. Chromosomalrearrangement in Candida stellatoidea results in a positive effect on pheno-type. Infect. Immun. 59:1762–1771.

64. Yip, C. L., S. K. Welch, F. Klebel, T. Gilbert, P. Seidel, F. J. Grant, P. J.O’Hara, and V. L. MacKay. 1994. Cloning and analysis of the S. cerevisiaeMNN9 and MNN1 genes required for complex glycosylation of secretedproteins. Proc. Natl. Acad. Sci. USA 91:2723–2727.


on Septem


.org/D

ownloaded from

http://jb.asm.org/

molecular analysis of the candida albicans homolog of ... · molecular analysis of the candida...

Documents