molecular phylogeny of the …research.amnh.org/users/siddall/pub/haplosporida.pdf1111 j....

1111

J. Parasitol., 90(5), 2004, pp. 1111–1122q American Society of Parasitologists 2004

MOLECULAR PHYLOGENY OF THE HAPLOSPORIDIA BASED ON TWO INDEPENDENTGENE SEQUENCES

Kimberly S. Reece, Mark E. Siddall*, Nancy A. Stokes, and Eugene M. BurresonDepartment of Environmental and Aquatic Animal Health, Virginia Institute of Marine Science, The College of William and Mary, GloucesterPoint, Virginia 23062. e-mail: [email protected]

ABSTRACT: The phylogenetic position of the Haplosporidia has confounded taxonomists for more than a century because of theunique morphology of these parasites. We collected DNA sequence data for small subunit (SSU) ribosomal RNA and actin genesfrom haplosporidians and other protists for conducting molecular phylogenetic analyses to help elucidate relationships of taxawithin the group, as well as placement of this group among Eukaryota. Analyses were conducted using DNA sequence data frommore than 100 eukaryotic taxa with various combinations of data sets including nucleotide sequence data for each gene separatelyand combined, as well as SSU ribosomal DNA data combined with translated actin amino acids. In almost all analyses, theHaplosporidia was sister to the Cercozoa with moderate bootstrap and jackknife support. Analysis with actin amino acid sequencesalone grouped haplosporidians with the foraminiferans and cercozoans. The haplosporidians Minchinia and Urosporidium werefound to be monophyletic, whereas Haplosporidium was paraphyletic. ‘‘Microcell’’ parasites, Bonamia spp. and Mikrocytosroughleyi, were sister to Minchinia, the most derived genus, with Haplosporidium falling between the ‘‘microcells’’ and the morebasal Urosporidium. Two recently discovered parasites, one from abalone in New Zealand and another from spot prawns inBritish Columbia, fell at the base of the Haplosporidia with very strong support, indicating a taxonomic affinity to this group.

Haplosporidia is composed of histozoic and coelozoic para-sites in a variety of freshwater and marine invertebrates; somespecies are significant pathogens of commercially importantmolluscs (Burreson et al., 2000). Since the discovery of the firstspecies in the late 1800s, the Haplosporidia have been a trou-blesome group for taxonomists and phylogeneticists. Histori-cally, the taxon has been treated as a last resort for a diversityof spore-forming parasites that have multinucleated naked cells(plasmodia) in their life cycles and that were not readily clas-sifiable elsewhere (Sprague, 1979).

There have been numerous taxonomic schemes proposed forplacement of the group within the protists and for appropriatetaxa within the Haplosporidia. Caullery and Mesnil (1899) es-tablished Haplosporidium for 2 parasites of marine annelids andplaced the genus in the new order Haplosporidia in the classSporozoa of the phylum Protozoa. Caullery (1953) recognized6 genera in the order, and Kudo (1971) recognized 7 genera. Amajor change in the classification of the Haplosporidia was theseparation of the Haplosporidia and the Paramyxea from other‘‘sporozoa’’ by establishment of the new phylum Ascetospora(Sprague, 1979). This scheme proposed 2 classes: Stellatospo-rea, for the families Marteiliidae and Haplosporidiidae, and Par-amyxea, for the family Paramyxidae. The family Haplospori-diidae contained only 3 genera, i.e., Haplosporidium, Minchi-nia, and Urosporidium. Desportes and Nashed (1983) recog-nized that the family Marteiliidae belonged in the classParamyxea, not Stellatosporea, because of its development cy-cle, and proposed 2 classes in the phylum Ascetospora, i.e.,Haplosporea and Paramyxea. However, they suggested that the2 classes probably should be raised to phylum rank because ofvery different developmental sequences. Recently, the phylumAscetospora has been abandoned, and Haplosporidia and Par-amyxea have each been elevated to phylum rank (Desportesand Perkins, 1990; Perkins, 1990, 1991; Cavalier-Smith, 1993).Separate phylum rank for Haplosporidia and Paramyxea hasbeen accepted by most researchers; however, Corliss (1994) re-

Received 5 March 2003; revised 12 December 2003; accepted 17February 2004.

* Department of Invertebrate Zoology, American Museum of NaturalHistory, New York, New York 10024.

tained the phylum Ascetospora for both Haplosporidia and Par-amyxea.

The earliest molecular phylogenetic analyses for the Haplos-poridia (Siddall et al., 1995; Flores et al., 1996) placed thephylum as a monophyletic group within the Alveolata and as ataxon of equal rank with the other alveolate phyla. A morerecent analysis, with much more sequence data available for avariety of taxa, has placed the Haplosporidia as sister taxon tothe Dictyosteliida (Berthe et al., 2000). The analysis by Bertheet al. (2000) also provided molecular phylogenetic support forseparate phylum rank for Haplosporidia and Paramyxea. Themost recent phylogenetic analysis involving the Haplosporidia(Cavalier-Smith and Chao, 2003) hypothesizes that the groupincludes the Paramyxea and falls within the Cercozoa.

The phylum Haplosporidia was recently described by Perkins(2000) as a group of parasitic protists that form ovoid, walledspores with an orifice covered externally by a hinged lid orinternally by a flap of wall material. There are 31 recognizedspecies in 3 genera, i.e., Minchinia, Haplosporidium, and Uro-sporidium. However, recent molecular phylogenetic analysessupported the inclusion of the enigmatic genus Bonamia andMikrocytos roughleyi, which are not known to form spores,within the Haplosporidia (Carnegie et al., 2000; Cochennec-Laureau et al., 2003).

For this study, we used nucleotide sequence data of 2 genes,actin and the small subunit (SSU) ribosomal RNA (rRNA)gene, to investigate the position of the Haplosporidia amongeukaryotes, to determine the taxonomic composition of thegroup, and to assess the monophyly of recognized genera.

MATERIALS AND METHODS

Sample collection

Samples of haplosporidian-infected host tissues were collected inU.K., France, Spain, and Australia, and in Mississippi, Virginia, andMichigan in the United States (Table I). Cercozoan culture samplesATCC50317 and ATCC50318 were obtained from ATCC for DNA iso-lation and amplification of actin gene fragments.

DNA isolation

Spores of haplosporidian species were isolated after degradation ofinfected host tissue, and genomic DNA was extracted by methods pre-viously described (Flores et al., 1996). DNA was isolated from the

1112 THE JOURNAL OF PARASITOLOGY, VOL. 90, NO. 5, OCTOBER 2004

TABLE I. Collection sites and dates of samples collected for this study.

Parasite species Host Sample collection site Year collected

Haplosporidium nelsoni Crassostrea virginica (Easternoyster)

Virginia 1992–1997

Haplosporidium louisiana Panopeus herbstii (mud crab) Gloucester Point, Virginia 1991Haplosporidium costale Crassostrea virginica (Eastern

oyster)Wachapreague, Virginia 1996

Haplosporidium lusitanicum Helcion pellucidus (limpet) Cap de la Hague, France 1998Haplosporidium pickfordi Physa parkeri (snail), Stagnicola

emarginalus (snail)Douglas Lake, Michigan 1999, 2000

Urosporidium crescens Microphallid trematode in Calli-nectes sapidus (blue crab)

Wachapreague, Virginia 1994

Urosporidium sp. Stictodora lari (trematode) in Bat-tilaria australis (whelk)

Sydney, New South Wales,Australia

2000

Minchinia chitonis Lepidochitona cinereus (chiton) Plymouth, U.K. 1996Minchinia tapetis Ruditapes decussatus (carpet shell

clam)Galicia, Spain 1996

Minchinia teredinis Teredo navalis (shipworm) Wachapreague, Virginia 1991, 1993, 1997Undescribed parasite Pandalus platyceros (spot prawn) Malaspina Strait, British Co-

lumbia, Canada1999

Undescribed haplosporidian Cyrenoida floridana (marsh clam) Ocean Springs, Mississippi 1999

cercozoan cultures with the QIAamp DNA mini-kit (Qiagen, Carlsbad,California) according to the manufacturer’s protocol for tissue samples.

Polymerase chain reaction amplification

The SSU rRNA genes for most of the haplosporidian species wereamplified in the polymerase chain reaction (PCR) using ‘‘universal’’eukaryotic primers (Medlin et al., 1988) and conditions previously de-scribed (Flores et al., 1996). Internal SSU rRNA gene primers Uro-comp280SSU (Reece and Stokes, 2003) and Uro280SSU (TAA-YTGTTCGGATCGCATGGC) were paired with the eukaryotic primers16S-A and 16S-B (Medlin et al., 1988), respectively, to amplify theAustralian Urosporidium sp. rather than host DNA. Amplification con-ditions were same as for eukaryotic primers above. Generation of theSSU rRNA gene sequence for Haplosporidium pickfordi required sev-eral amplifications using specific primers: HAP-F1 (Renault et al., 2000)and 16S-B; 16S-A and MpickSSU391 (GCTTATTCAATCGGTAG-GAGC); 16S-A and MpickSSU280 (CAATCGTCTATCCCCACTTG);Mpick125F (AACCGTGGTAACTCCAGGG) and Mpick1450R (TTA-TTGCCCCACGCTTCC); Mpick250F (CATTCAAGTTTCTGCCCTATCAG) and Mpick1220R (TGTCTGGTAAGTTTTCCCGTGTTG);HAP-F1 and HAP-R3 (Renault et al., 2000). Reaction mixtures for PCRwere same as above except with Mpick125F1 Mpick1450R andMpick250F1 Mpick1220R, where buffer and polymerase were fromthe Expand High Fidelity PCR system (Roche Diagnostics, Indianapo-lis, Indiana). Cycling parameters consisted of an initial denaturation of4 min at 94 C followed by 35 cycles of 30 sec at 94 C for denaturation,30 sec at 48 C for HAP-F1116S-B and HAP-F11HAP-R3, 55 C for16S-A1MpickSSU391 and 16S-A1MpickSSU280, 59 C forMpick125F1Mpick1450R and Mpick250F1Mpick1220R for anneal-ing, 1.5 min at 72 C for extension and a final extension of 5 min at 72 C.

A central coding region of actin genes from the haplosporidians, theirhosts, and cercozoans was amplified using various combinations of 2forward (480, 481) and 2 reverse (482, 483) universal actin gene prim-ers (Carlini et al., 2000) using amplification parameters and conditionspreviously described (Reece et al., 1997). Amplification products werecloned into either the plasmid vector pNoTA/T7 using the Prime PCRCloner Cloning System (5 Prime-3 Prime, Inc., Boulder, Colorado) orinto pCR2.1 using the TA Cloning Kit (Invitrogen, Carlsbad, California)according to the manufacturers’ instructions.

DNA sequencing

DNA clone inserts of SSU and actin gene fragments were sequencedmanually as previously described (Reece et al., 1997) or by automatedsequencing using either unidirectional or simultaneous bidirectional cy-

cle sequencing. Reactions for automated analysis were done as previ-ously described (Reece and Stokes, 2003). Sequences were importedinto MacVector 7.0 Sequence Analysis Software (Oxford MolecularLtd., Oxford, U.K.) for trimming vector sequences, alignment, and forthe actin gene sequences, coding region analyses. Actin gene introns(see Table II) were located, and the splice junction points were identifiedby using the MacVector 7.0 package to translate the DNA sequences inall 3 reading frames followed by coding region analyses and alignmentto haplosporidian and other protistan actin gene fragments that did notcontain introns.

Sequence and phylogenetic analyses

Occasionally, host or other contaminant SSU rRNA and actin geneswere amplified rather than the targeted haplosporidian sequences. Iden-tification of the DNA source for all amplified gene fragments involvedBLAST (Altschul et al., 1990) searches of the National Center for Bio-technology Information (NCBI) GenBank database, as well as frequentintermediate phylogenetic analyses, which included previously obtainedhost, haplosporidian, and other protozoan sequences. In some cases,amplification of haplosporidian sequences from several infected hostindividuals was done to demonstrate that identical or highly similar(.98% sequence identity) sequences could be obtained from indepen-dent samples.

Phylogenetic analyses were conducted in 2 series. The first concernedthe assessment of the relationship of the Haplosporidia to other eukary-otic groups and comprised 121 taxa for the SSU rDNA sequences and50 taxa for the actin sequences ranging across Eukaryota. Consider-ations at that level were limited principally to support for the groupingsof and among various clades of protists, as opposed to support withineach grouping. The second series concerned specific analysis of thephylogenetic relationships of genera and species within Haplosporidiausing the closest relatives of the group, as determined from the firstseries of analyses. Sequences were aligned for each of these series in-dependently.

The SSU rRNA and actin gene sequences used in the phylogeneticanalyses, along with their GenBank accession numbers, are listed inTable III. Sequences were aligned using the CLUSTALW algorithm(Thompson et al., 1994) in the MacVector 7.0 package using a varietyof open and extend gap penalties in the ranges of 4–20 and 2–10,respectively. The SSU rRNA gene alignments were compared with sec-ondary structure–based alignments done through the Ribosomal Data-base Project II website (http://rdp.cme.msu.edu/html/, Maidak et al.,2001). Final alignments used in the analyses were accomplished withgap penalties of 8 for insertions and 3 for extensions both in pairwise

REECE ET AL.—MOLECULAR PHYLOGENY OF THE HAPLOSPORIDIA 1113

TABLE II. Actin gene introns, locations, and lengths. Sequences in bold were used in the phylogenetic analyses presented here.

Parasite species

No. of uniqueactin sequences

identifiedNo. of DNA

clones sequencedGene

designation

No. of intronswithin amplified

fragmentIntron positions* (intron

lengths in bp)

Haplosporidium costaleHaplosporidium louisiana

14

47

HcAc1HlAc1HlAc5HlAc8HlAc11

20003

131, 172 (18, 17)

131, 172, 224 (177, 63, 83)Haplosporidium nelsoniMinchinia chitonis

13

48

HnAc3McAc5McAc11McAc42

0131

304 (124)131, 172, 224 (25, 25, 28)304 (114)

Minchinia tapetis 3 6 MtaAc1MtaAc7MtaAc9

020

131, 172 (33, 77)

Minchinia teredinis

Urosporidium crescensUndescribed parasite CfPUndescribed parasite SPP

3

111

5

415

MteAc2MteAc5MteAc9UcAc1CfhapAc64SppAc6

220014

172, 224 (22, 60)131, 172 (23, 25)

172 (25)131, 172, 224, 304 (50, 60, 222, 185)

* Intron positions are designated relative to the homologous amino acid position in the human aortic actin gene (GenBank NMp005159).

and in multiple alignment phases. In addition, aligned sequences wereanalyzed in various combinations to determine the sensitivity of variousgroups to the relative inclusion and exclusion of potentially phyloge-netically informative sites. In the first series of analyses, which con-cerned the relative position of Haplosporidia within Eukaryota, it wasnoted that there were large inserted regions in the SSU rDNA sequencesof some taxa, including some of the haplosporidians, e.g., the prawnparasite and Urosporidium species. In light of this, a total of 798 sitesin the alignment were targeted for removal to determine the effect thatremoval or inclusion of these sequences had on results. Similarly, interms of the actin nucleotide data, the relative contribution of thirdcodon positions to the predicted phylogenies was assessed, both throughtheir exclusion and by using translated amino acid sequences.

All combinations of SSU rDNA nucleotides, with and without the798 sites targeted for exclusion, alone, and in combination with actinnucleotides, with and without third codon positions, or using translatedamino acid sequences alone or in combination with the SSU rDNA data,were examined in terms of their relative support for higher-level rela-tionships among the included eukaryotic taxa. Insofar as the specificsof species-level relationships were of only passing interest in the anal-yses of all Eukaryotic taxa, groupings and relative levels of supportwere determined through unweighted parsimony jackknife methods(Farris et al., 1996) for nucleotide combinations using XAC (Farris,1998). Unweighted parsimony jackknife and bootstrap in PAUP 4.0b10(Swofford, 2002) were used for those analyses concerning amino acidsequences with the ‘‘emulate Jac’’ option. In each case, 1,000 replicateswere used, each with 5 random additions and with a subtree-pruning-regrafting branch swapping algorithm. After determinations of jackknifesupport in these higher-level Eukaryota analyses, we also searched foroptimal trees on the combined SSU rDNA and actin amino acid se-quences because jackknife values from this data combination were in-termediate among the 6 combinations tried. This search used 30 randomtaxon addition search sequences followed by branch breaking (TBRbranch swapping).

With respect to the secondary analyses in which we were concernedwith the specifics of the relationships within Haplosporidia, sequenceswere realigned for the 26 included taxa for the combined analysis ac-cording to the same parameters as above. In these analyses, all sites forboth nucleotide sets were included and combinations of data consideredSSU rDNA alone, as well as those data in combination with actin nu-cleotides or with translated actin amino acid sequences. Thorough heu-ristic searches for most parsimonious trees (as opposed to jackknifesupport trees) were conducted with PAUP 4.0b10 (Swofford, 2002) for

all the secondary data sets. In each case, searches involved 30 randomtaxon addition search sequences followed by branch breaking (TBRbranch swapping).

RESULTS

From some samples, novel host as well as parasite SSUrRNA or actin gene sequences (or both) were identified. Hostand parasite SSU rRNA and actin gene sequences that wereconfidently identified as either of host or parasite origin byBLAST searches and phylogenetic analyses in this study weredeposited in GenBank. Additional sequences whose origincould not be determined were obtained from many samples andwere presumed to be from contaminating organisms.

Jackknife values obtained from the various data combinationsused across Eukaryota for determination of the closest extantrelatives of Haplosporidia are listed in Table IV. Bootstrap val-ues were comparable with the jackknife values in all analyses,never varying by more than 3%, and usually bootstrap supportvalues were slightly higher. With all but 1 of the data set com-binations, the Haplosporidia were supported as having arisenfrom a common ancestor with the Cercozoa. With the completecombined nucleotide data set, which included all the SSU rRNAand actin gene nucleotides, the Haplosporidia were not sup-ported as having arisen from a common ancestor with the Cer-cozoa. This complete nucleotide data set, however, failed to findgreater than 50% support for the Haplosporidia grouping withany of the other Eukaryotic clades used in this analysis. Par-simony analysis with the actin amino acid data set alonegrouped the Haplosporidia with the Foraminifera and mostclosely to the type 1 foraminiferan actins (Keeling, 2001). Theforaminiferan and haplosporidian clade was sister to the cer-cozoans. The support for these groupings, however, was below50%. All the remaining data sets found that Haplosporidia andCercozoa are clades with support levels ranging from 61% withthe SSU rDNA alone up to 81% with the SSU rDNA sequences


TABLE III. Taxa included in phylogenetic analysis and the GenBank accession numbers of their SSU rRNA and actin gene sequences. Sequencesdetermined for this study are shown in bold.

Taxon SSU rRNA gene Actin gene

Bonamia ostreaeBonamia sp.Haplosporidium costaleHaplosporidium louisianaHaplosporidium lusitanicum

AF192759, AF262995AF337563AF387122U47851AY449713

NA*NAAY450407AY450408–411NA

Haplosporidium nelsoniHaplosporidium pickfordiMikrocytos roughleyiMinchinia chitonisMinchinia tapetis

U19538AY452724AF508801AY449711AY449710

AY450412NANAAY450413–415AY450416–418

Minchinia teredinisUrosporidium crescensUrosporidium sp.Undescribed Cyrenoida floridana parasite (CfP)Undescribed Haliotis iris parasite (NZAP)

U20319U47852AY449714AY449712AF492442

AY450419–421AY450422NAAY450423NA

Undescribed Pandalus platyceros parasite (SPP)Allogromia sp.Ammonia sp.Ammonia beccariiReticulomyxa filosa

AY449715–716X86093†NAU07937†AJ132367†

AY450424AJ132370–371AJ132372–373NAAJ132374–375

Cercomonas longicaudaCercomonas sp.—ATCC50317Cercomonas sp.—ATCC50318Chlorarachnion reptansChlorarachnion sp.

AF101052U42449U42450U03477NA

NAAF363534AF363536NAAF363528

Euglypha rotundaHeteromita globosaMassisteria marinaUnidentified cercozoan speciesPhagomyxa bellerocheae

X77692U42447AF174374UEU130858AF310903†

NANANANANA

Phagomyxa odontellaePlasmodiophora brassicaeAchlya bisexualisBolidomonas pacificaCafeteria roenbergensis

AF310904†U18981†M32705AF167154AF174364

NANAX59936NANA

Cafeteria sp.Chrysosaccus sp.Chrysosphaera parvulaChrysoxys sp.Ciliophrys infusionum

AF174366AF123300AF123299AF123302L37205

NANANANANA

Costaria costataFucus vesiculosusHyphochytrium catenoidesLagynion scherffeliiOchromonas danica

X53229U97110AF163294AF123288M32704

X59937X98885NANANA

Phytophthora megaspermaPhytophthora infestansRhizidiomyces apophysatusSkeletonema costatumC9G

X54265NAAF163295X85395AF474172

NAM59715NANANA

Labyrinthula sp.QPXUlkenia profundaAjellomyces capsulatusApusomonas proboscidea

AB022105AF261664L34054Z75307L37037

NANANAU17498NA

Candida glabrataKluyveromyces lactisNeurospora crassaPneumocystis cariniiSaccharomyces cerevisiae

X51831X51830X04971S83267J01353

AF069746M25826U78026L21183V01288

Acanthamoeba castellanii AF251938 V00002, J01016


TABLE III. Continued.

Taxon SSU rRNA gene Actin gene

Chilomonas parameciumChlamydomonas reinhardtiiEmiliania huxleyiNitella flexilis

L28811M32703M87327U05261

NAD50839S64188NA

Chondrus crispusStylonema alsidiiMarteilia refringensAlexandrium fundyenseAmphidinium carterae

Z14140AF168633AJ250699†U09048AF009217

U03676NANANAU84289

Gonyaulax spiniferaHematodinium sp.Lepidodinium viridePfiesteria piscicidaProrocentrum minimum

AF052190AF286023AF022199AF077055Y16238

NANANANAU84290

Symbiodinium corculorumSymbiotic dinoflagellate BBSR 323Perkinsus chesapeakiPerkinsus marinusPerkinsus olseni

L13717U52356AF042707AF042708L07375

NANANAU84287NA

Babesia bovisCaryospora bigeneticaColpodella sp.Cryptosporidium parvumEimeria tanella

L19078AF060975AY142075, AY449717AF115377U40264

NANANAM86241NA

Parvilucifera infectansSarcocystis hominisTheileria parvaToxoplasma gondiiAnophyroides haemophila

AF133909AF006470L02366U03070U51554

NANANAU10429NA

Didinium nasutumEntodinium caudatumEuplotes crassusFrontonia vernalisOxytricha nova

U57771U57765AY007438U97110X03948

NAAF078106J04533NAM22480

Oxytricha trifallaxParamecium tetraureliaProrodon viridisStrombidium purpureumTetrahymena pyriformis

AF164121X03772U97111U97112M98021

NAAF043608NANAX05195

Tetrahymena thermophilaAcanthometra sp.Arthracanthid 206Haliommatidium sp.Encephalitozoon cuniculi

X56165AF063240AF063239AF018159L17072

M13939NANANANA

Encephalitozoon hellumEntamoeba histolyticaEuglena gracilisTrichomonas foetusTrichomonas vaginalis

M87327X65163M12677M81842U17510

AF031701M19871AF057161NAAF237734

Trypanosoma bruceiHaliotis irisCrassostrea virginicaCyrenoida floridanaHelcion pellucidus

AJ009141AF492441L78851†NANA

M20310NAX75894†AY452511–512†AY452513†

Lepidochitona cinereusPandalus platycerosPhysa parkeriRuditapes decussatusStictodora lariTeredo navalis

NANANAAF29512†NANA

AY452514–515†AY452516†AY485722†AY452517–518†AY452519–521†AY452522†

* NA, sequence not available.† Sequences used for analyses, but not included in trees presented.


TABLE IV. Summary of jackknife support values for phylogenetic analyses with various data sets.*

SSU SSUX SSU1ACT SSUX1ACTX SSU1ACTX SSUX1ACT SSU1ACTaa SSUX1ACTaa

CiliophoraDinozoaApicomplexaAlveolataStramenopiles

100100—5267

9995—7369

95100—5480

9894—7877

100100—6478

8896——75

100100—7072

9997—7775

LabyrinthulidsFungiChlorophytes(FUN 1 CHL)

100979078

91888677

969397—

8672—53

94927468

976891—

94988679

94847166

HaplosporidiaCercozoa(HAP 1 CERC)

9110061

67100

64

83100—†

90100

79

94100

63

929975

95100

74

8710081

* SSU, all SSU rDNA nucleotides aligned by CLUSTALW; SSUX, SSU rDNA nucleotides aligned by CLUSTALW, with 798 poorly aligned nucleotide positionsremoved; ACT, all actin gene nucleotides aligned by CLUSTALW; ACTX, actin gene nucleotides aligned by CLUSTALW, with the third positions of codonsremoved.

† No alternative grouping of the Haplosporidia was supported by this analysis.

combined with actin amino acid sequences but excluding the798 sites corresponding to SSU rDNA insertions in the haplos-poridian sequences. Intermediate between these values were theanalyses using all SSU rDNA data and either the actin aminoacid sequences with 74% support for the cercozoan–haplospor-idian clade or the actin nucleotide sequences with third posi-tions excluded with 63% support for the cercozoan–haplospor-idian clade. Overall, both these analyses rendered high levelsof support for other known eukaryotic groups (Table IV). TheSSU rDNA data combined with the actin amino acid sequences,when subjected to a full parsimony search, yielded 4 trees withequal length of 17,977, a consistency index (CI) of 0.306, anda retention index (RI) of 0.557, the strict consensus of whichis illustrated in Figure 1. Foraminifera SSU rRNA gene se-quences could not be confidently aligned with the other se-quences and, therefore, were not used in these analyses. Theconsensus tree of 122 equally parsimonious trees with a lengthof 1,153 (CI 5 0.440; RI 5 0.555) resulting from analysis withthe actin amino acid data set is shown in Figure 2.

For parsimony analyses examining the in-group relationshipsof the Haplosporidia, 8 cercozoan taxa were used as the out-group (Fig. 3). Use of SSU rDNA data alone yielded a singletree with length 3,838 (CI 5 0.600; RI 5 0.658). Use of SSUrDNA in combination with translated actin amino acids alsorendered a single tree, identical in topology to the SSU rDNAtree, with length 4,172 (CI 5 0.607; RI 5 0.649). Use of SSUrDNA in combination with actin nucleotides yielded 2 treeseach with length 5,213 (CI 5 0.572; RI 5 0.589). The consen-sus of those 2 trees disagreed with the other analyses in movinga clade composed of H. pickfordi and Haplosporidium lusitan-icum to a sister group position with Haplosporidium louisianaas opposed to with Haplosporidium costale. The undescribedhaplosporidian parasite from Cyrenoida floridana consistentlygrouped within the described Minchinia species. All combineddata set analyses agreed on a variety of other findings includingthat (1) Minchinia is monophyletic (if the parasite from C. flor-idana is considered a Minchinia species); (2) Urosporidium ismonophyletic; (3) the nonspore-forming ‘‘microcell’’ parasiteswithin the Haplosporidia, e.g., Bonamia spp. and M. roughleyi,are monophyletic and sister to Minchinia; (4) Haplosporidium

as currently constituted is paraphyletic; and (5) the earliest lin-eages in Haplosporidia are the yet to be described parasite spe-cies recently obtained from prawns and from abalone.

In several cases, more than 1 actin gene type was amplifiedfrom DNA of a haplosporidian species. Multiple paralogs werefound in H. louisiana, Minchinia chitonis, Minchinia teredinis,and Minchinia tapetis. Only a single type of actin gene wasidentified from Haplosporidium nelsoni, H. costale, and Uros-poridium crescens, and no actin gene that could be confidentlyidentified as a parasite sequence was successfully amplifiedfrom H. lusitanicum, H. pickfordi, or from the Australian Uros-poridium sp. found in Stictodora lari (trematode) of Battilariaaustralis (whelk), although 10–27 DNA clones were sequencedfrom each of these samples. As sequences were obtained, phy-logenetic analyses were conducted to identify orthologousgenes for inclusion in the overall phylogenetic analyses. Manyhaplosporidian actin gene sequence fragments were found tocontain introns. Introns were found in at least 1 actin gene par-alog from each of the haplosporidian taxa from which actingenes were able to be amplified, except from H. nelsoni, andU. crescens. Orthologs and paralogs of parasite origin wereidentified by phylogenetic analyses with known actin gene se-quences from hosts and other protozoans. The genes with in-trons as well as the single intronless actin genes isolated fromH. nelsoni and U. crescens were determined to be orthologous(Table II) and were used in the comprehensive phylogeneticanalyses. Intron positions were conserved among the haplos-poridian actin genes, with 4 different intron positions identifiedat positions corresponding to the amino acids 131, 172, 224,and 304 of the human aortic actin gene (GenBank NMp005159).The total number of introns within the amplified gene fragmentranged from 1 to 4 (Table II). Individual actin genes from thedescribed haplosporidian species contained 1–3 introns, and theintrons were found at all 4 of the positions in the actin gene ofthe haplosporidianlike spot prawn parasite. Intron lengthsranged from very short introns of 17–33 nucleotides, up to 222nucleotides. The introns were flanked by typical splice junctionsequences with ‘‘GT’’ at the 59 end and ‘‘AG’’ at the 39 end ofall introns.


FIGURE 1. Strict jackknife consensus of 4 equal length trees resulting from parsimony analysis with the SSU rDNA and actin amino acid dataset. Analysis was done on the complete taxonomic data set with 798 poorly aligned nucleotide positions in the SSU rDNA removed. Jackknifesupport values are given at the nodes. Dashed lines indicate clades that did not have jackknife support values above 50.


FIGURE 2. Strict jackknife consensus of 122 equal length trees resulting from parsimony analysis with the actin amino acid data set. Analysiswas done on actin sequences from 47 taxa. Jackknife support values are given at the nodes. Dashed lines indicate clades that did not havejackknife support values above 50.


FIGURE 3. Strict jackknife consensus trees of parsimony analyses conducted with the reduced taxonomic data set that included the cercozoansand haplosporidians for examination of relationships within the phylum Haplosporidia. Jackknife support values are given at the nodes. A. Treeresulting from analysis of the SSU rDNA sequence data. Tree statistics: length (L) 5 3,838, consistency index (CI) 5 0.600, retention index (RI)5 0.658. B. Strict consensus of 2 trees of equal length resulting from analysis of the SSU rDNA and actin gene sequence data. Tree statistics: L5 5,213, CI 5 0.572, RI 5 0.589. C. Tree resulting from analysis of the SSU rDNA and actin amino acid sequence data. Tree statistics: L 54,172, CI 5 0.607, RI 5 0.649.


DISCUSSION

This combined actin–SSU rRNA data set, including the datafor several haplosporidian taxa collected during this study andadditional data already in GenBank, places Haplosporidia in aposition of recent common ancestry with cercozoans and notwithin the Alveolata as previously hypothesized on the basis ofthe SSU rRNA gene data alone (Siddall et al., 1995; Flores etal., 1996). This study includes not only an additional gene andmany additional haplosporidian taxa but also several more pro-tistan SSU rRNA and actin gene sequences that were not avail-able for those studies. The haplosporidians grouped with theforaminiferans and cercozoans in analyses based on actin se-quences alone, although jackknife support for this relationshipwas below 50% (Fig. 2). We did not, however, include the fo-raminiferan SSU rDNA sequences in any of the analyses be-cause we did not have confidence in alignments that includedthese divergent sequences. Keeling (2001) found that the Fo-raminifera and Cercozoa were closely related in actin and tu-bulin gene phylogenies. Any more definitive conclusions re-garding the relationships between Haplosporidia and Forami-nifera, however, will require additional data.

Although previous studies have suggested that Haplosporidiaand Cercozoa are closely related (Cavalier-Smith, 2002; Cava-lier-Smith and Chao, 2003), this is the first study to demonstratemoderate support (JK 5 74) for this affinity. Cavalier-Smith(2002) stated that the Haplosporidia are members of the Cer-cozoa but presented absolutely no data on which to evaluatethis claim. Cavalier-Smith and Chao (2003) had only weak sup-port (BS 5 20 with Marteilia refringens included in the analysisand BS 5 60 with it removed) for inclusion of the Haplospor-idia within the Cercozoa. Although that study also suggestedthat M. refringens was related to the haplosporidians, the resultsof this study were consistent with the results of Berthe et al.(2000), in that we found no support for this relationship in anyof our analyses. The fact that there is strong support in thisstudy for many other accepted taxonomic groupings, includingthe stramenopiles, alveolates, labyrinthulids, fungi, chlorophy-tes and cercozoans (see Table IV), lends support to the validityof these results. Moreover, the use of combined data from these2 loci provided more support for grouping Haplosporidia withCercozoa, than either locus did alone and with support valuessimilar to those seen for Alveolata and Stramenopiles arisingat comparable depths in the resulting tree. In addition, if theCercozoa are accepted as a phylum, then the results of thisstudy hypothesize that the Haplosporidia are also a distinct phy-lum, rather than included within the Cercozoa as hypothesizedby Cavalier-Smith and Chao (2003).

This phylogenetic study based on molecular data from 2 in-dependent DNA sequences, namely SSU rRNA and actin genesequences, generally supports the earlier taxonomic assign-ments within the group Haplosporidia that were largely basedon spore morphologies (Sprague, 1979; Ormieres, 1980; Mc-Govern and Burreson, 1990; Perkins, 1990, 1991, 2000). Mono-phyly of Urosporidium and Minchinia was supported in thisstudy. Haplosporidium is paraphyletic and falls intermediate tothe more basal Urosporidium and the most derived genus Min-chinia, as previously hypothesized by Ormieres (1980).

Many of the more recent observations regarding taxa foundto have haplosporidian affinities and reassignments within the

group were supported by this study. The Bonamia spp. and M.roughleyi fell within the Haplosporidia, as had been observedin previous studies (Carnegie et al., 2000; Cochennec-Laureauet al., 2003). These ‘‘microcells’’ grouped together in this anal-ysis as a sister group to Minchinia. The results of this studystrongly suggest that the undescribed C. floridana parasite is aMinchinia species because it fell between M. chitonis and M.teredinis within a monophyletic Minchinia clade in all the anal-yses. In another study, the freshwater parasite Minchinia pick-fordae was assigned recently to Haplosporidium on the basisof spore ornamentation (Burreson, 2001) and renamed H. pick-fordi. Its removal from Minchinia was supported here. A hap-losporidianlike abalone parasite (Diggles et al., 2002; Hine etal., 2002; Reece and Stokes, 2003) fell at the base of the Hap-losporidia, sister to another haplosporidianlike parasite recentlyidentified in the spot prawn, Pandalus platyceros (Bower andMeyer, 2002). Overall, there was strong support (jackknife sup-port value 5 95) for monophyly of the group Haplosporidia,provided that Bonamia spp. and M. roughleyi are included.There was also strong support (jackknife support value 5 95)for the placement of the abalone and spot prawn parasites atthe base of the haplosporidian clade.

It is interesting to note that introns were found within actingenes from many of the haplosporidian species in this study.The presence and the position of introns often lent further sup-port to results of the phylogenetic analyses. Four intron posi-tions were identified within the haplosporidian actin genes, withthe number of introns within a particular gene fragment rangingfrom 1 to 3 within genes from the described species. At least1 actin gene paralog with introns was isolated from each of theMinchinia species. The actin gene from the undescribed C. flor-idana parasite contained an intron, consistent with its placementwithin this genus. Introns were also found in the spot prawnparasite actin gene at each of the 4 conserved positions foundin haplosporidian actin genes, lending additional support to thephylogenetic affinity of this spot prawn parasite with Haplos-poridia. Several of these introns were surprisingly short (17–33bp). Even these short introns, however, had characteristic splicejunction sequences and began at their 59 ends with the dinucle-otide GT and ended at their 39 ends with the dinucleotide AG.In addition, when the intron sequences were removed, the re-maining exon sequences could be translated in frame to yieldtypical actin amino acid sequences, further supporting the va-lidity of even the shortest introns. Introns were also found inactin genes from a cercozoan species (Keeling, 2001), the groupfound to be sister to Haplosporidia in the combined data setanalysis, although the intron positions differed from those seenin the haplosporidian actin genes. To our knowledge, actingenes have not yet been isolated from Bonamia spp., M. rough-leyi, or the abalone parasite, and although we attempted, we didnot successfully isolate actin genes from the Australian Uros-poridium sp., H. pickfordi, or H. lusitanicum. It is quite likelythat several actin gene paralogs from these parasites have yetto be isolated. Phylogenetic analyses with these sequences aswell as characterization of the intron structure may lend addi-tional insight into relationships within the group.

Overall, the results of this molecular study raise interestingquestions regarding spore formation for taxa within the groupHaplosporidia. Spores have not been observed for either thespot prawn or abalone parasites that lie at the base of the clade


(Bower and Meyer, 2002; Diggles et al., 2002; Hine et al.,2002), suggesting that the ancestral state included a lack of theability to form spores and that spore formation arose along thelineage to the Urosporidium, Haplosporidium, and Minchiniagenera. Spores have not been observed, however, for the Bon-amia spp. and M. roughleyi, which in the phylogenetic analysesfell between the spore-forming genera Minchinia and Haplos-poridium. This hypothesizes a loss of the ability to form sporesin the microcell group. It is possible, however, that the lifestages of these undescribed basal parasites identified to date andthe microcells are intermediate stages of previously undiscov-ered haplosporidians and that the spore stages have not yet beenobserved. Alternatively, the ancestor to the Haplosporidia hadthe ability to form spores, but this was lost in the lineages tothe spot prawn and abalone parasites, as well as in the lineageto the microcells, whereas the other taxa have retained this abil-ity.

Relationships within the group Haplosporidia hypothesizedby the molecular phylogenetic analyses provide a frameworkfor assessing proposed relationships within the group based onmorphology. Perkins (2000) assigned species to Minchinia ifthey had spore extensions that were visible with the light mi-croscope and to Haplosporidium if the spore ornamentation wasnot visible with the light microscope. Most other researchershave followed Ormieres’ (1980) criteria and assigned speciesto Minchinia if the spore ornamentation was composed of ep-ispore cytoplasm and to Haplosporidium if the spore ornamen-tation was derived from the spore wall (McGovern and Burre-son, 1990; Hine and Thorne, 1998; Azevedo et al., 1999; Bur-reson, 2001). The molecular phylogenetic analyses presentedhere support the importance of ornamentation origin. All thespecies included in the analysis that have ornamentation com-posed of epispore cytoplasm (Minchinia spp.) formed a mono-phyletic group. The species that have ornamentation derivedfrom the spore wall (Haplosporidium spp.) formed a paraphy-letic clade, suggesting that more genera are necessary to en-compass the morphological diversity in species with sporewall–derived ornamentation. Unfortunately, at present, there areinsufficient data on spore wall ornamentation for many of thehaplosporidian species to propose new generic assignments. Asknowledge increases, it will be interesting to assess the con-cordance between molecular and morphological data sets.

ACKNOWLEDGMENTS

The authors thank Brenda S. Kraus, Kathleen Apakupakul, and KarenHudson for technical support and Antonio Villalba, Barbara Nichols,Susan Bower, Gary Meyer, Ben Diggles, and John Walker for providingsamples. This work was supported by grant BIO-DEB-9629487 fromthe U.S. National Science Foundation. VIMS contribution 2617.

LITERATURE CITED

ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS, AND D. J. LIPMAN.1990. Basic local alignment search tool. Journal of Molecular Bi-ology 215: 403–410.

AZEVEDO, C., J. MONTES, AND L. CORRAL. 1999. A revised descriptionof Haplosporidium amoricanum, parasite of Ostrea edulis L. fromGalicia, northwestern Spain, with special reference to the spore-wall filaments. Parasitology Research 85: 977–983.

BERTHE, F. C. J., F. LE ROUX, E. PEYRETAILLADE, P. PEYRET, D. RODRI-GUEZ, M. GOUY, AND C. P. VIVARES. 2000. Phylogenetic analysis ofthe small subunit ribosomal RNA of Marteilia refringens validates

the existence of phylum Paramyxea (Desportes and Perkins, 1990).Journal of Eukaryotic Microbiology 47: 288–293.

BOWER, S. M., AND G. R. MEYER. 2002. Morphology and ultrastructureof a protistan pathogen in the haemolymph of shrimp (Pandalusspp.) in the northeastern Pacific Ocean. Canadian Journal of Zo-ology 80: 1055–1068.

BURRESON, E. M. 2001. Spore ornamentation of Haplosporidium pick-fordi Barrow, 1961 (Haplosporidia), a parasite of freshwater snailsin Michigan, USA. Journal of Eukaryotic Microbiology 48: 622–626.

———, N. A. STOKES, AND C. S. FRIEDMAN. 2000. Increased virulencein an introduced pathogen: Haplosporidium nelsoni in the easternoyster Crassostrea virginica. Journal of Aquatic Animal Health 12:1–8.

CARLINI, D. B., K. S. REECE, AND J. E. GRAVES. 2000. Actin gene familyevolution and the phylogeny of coleoid cephalopods (Mollusca:Cephalopoda). Molecular Biology and Evolution 17: 1353–1370.

CARNEGIE, R. B., B. J. BARBER, S. C. CULLOTY, A. J. FIGUERAS, AND D.L. DISTEL. 2000. Development of a PCR assay for detection of theoyster pathogen Bonamia ostreae and support for its inclusion inthe Haplosporidia. Diseases of Aquatic Organisms 42: 199–206.

CAULLERY, M. 1953. Appendice aux Sporozoaires. Classe des haplos-poridies. In Protozoaires: Rhizopodes, Actinopodes, Sporozoaires,Cnidospories, P. P. Grasse (ed.). Traite de Zoologie, vol. I, no. 2.Masson et Cie, Paris, France, p. 922–934.

———, AND F. MESNIL. 1899. Sur le genera Aplosporidium (nov.) etl’ordre nouveau des Aplosporidies. Compte rendu des seances dela Societe de Biologie et de ses Filiales 51: 789–791.

CAVALIER-SMITH, T. 1993. Kingdom Protozoa and its 18 phyla. Micro-biological Reviews 57: 953–994.

———. 2002. The phagotrophic origin of eukaryotes and phylogeneticclassification of Protozoa. International Journal of Systematic andEvolutionary Biology 52: 297–354.

———, AND E. E. CHAO. 2003. Phylogeny of Choanozoa, Apusozoaand other Protozoa and early eukaryote megaevolution. Journal ofMolecular Evolution 56: 540–563.

COCHENNEC-LAUREAU, N., K. S. REECE, F. C. J. BERTHE, AND P. M. HINE.2003. Revisiting Mykrocytos roughleyi taxonomic affiliation leadsto the genus Bonamia (Haplosporidia). Diseases of Aquatic Organ-isms 54: 209–217.

CORLISS, J. O. 1994. An interim utilitarian (‘‘user-friendly’’) hierarchicalclassification and characterization of the protists. Acta Protozool-ogica 33: 1–51.

DESPORTES, I., AND N. N. NASHED. 1983. Ultrastructure of sporulationin Minchinia dentali (Arvy), an haplosporean parasite of Dentaliumentale (Scaphopoda, Mollusca): Taxonomic implications. Protisto-logica 19: 435–460.

———, AND F. O. PERKINS. 1990. Phylum Paramyxea. In Handbook ofProtoctista, L. Margulis, J. O. Corliss, M. Melkonian, and D. J.Chapman (eds.). Jones and Bartlett Publishing, Boston, Massachu-setts, p. 30–35.

DIGGLES, B. K., J. NICHOL, P. M. HINE, S. WAKEFIELD, N. COCHENNEC-LAUREAU, R. D. ROBERTS, AND C. S. FRIEDMAN. 2002. Pathology ofcultured paua (Haliotis iris) infected by a novel haplosporidian par-asite, with some observations on the course of disease. Diseases ofAquatic Organisms 50: 219–231.

FARRIS, J. S., V. A. ALBERT, M. KALLERSJO, D. LIPSCOMB, AND A. G.KLUGE. 1996. Parsimony jackknifing outperforms neighbor-joining.Cladistics 12: 99–124.

———. 1998. Xac. Program and documentation. Swedish Museum ofNatural History, Stockholm, Sweden.

FLORES, B. S., M. E. SIDDALL, AND E. M. BURRESON. 1996. Phylogenyof the Haplosporidia (Eukaryota: Alveolata) based on small subunitribosomal RNA gene sequence. Journal of Parasitology 82: 616–623.

HINE, M., AND T. THORNE. 1998. Haplosporidium sp. (Haplosporidia) inhatchery-reared pearl oysters, Pinctada maxima (Jameson, 1901),in north Western Australia. Journal of Invertebrate Pathology 71:48–52.

HINE, P. M., S. WAKEFIELD, B. K. DIGGLES, V. L. WEBB, AND E. W.MAAS. 2002. Ultrastructure of a haplosporidian containing Rickett-siae, associated with mortalities among cultured paua Haliotis iris.Diseases of Aquatic Organisms 49: 207–19.


KEELING, P. J. 2001. Foraminifera and Cercozoa are related in actinphylogeny: Two orphans find a home? Molecular Biology and Evo-lution 18: 1551–1557.

KUDO, R. R. 1971. Protozoology, 5th ed. Charles C. Thomas Publishing,Springfield, Massachusetts, 1,174 p.

MAIDAK, B. L., J. R. COLE, T. G. LILBURN, C. T. PARKER JR., P. R.SAXMAN, R. J. FARRIS, G. M. GARRITY, G. J. OLSEN, T. M. SCHMIDT,AND J. M. TIEDJE. 2001. The RDP-II (Ribosomal Database Project).Nucleic Acids Research 29: 173–174.

MCGOVERN, E. R., AND E. M. BURRESON. 1990. Ultrastructure of Min-chinia sp. from shipworms (Teredo spp.) in the Western North At-lantic, with a discussion of taxonomy of the Haplosporidiidae. Jour-nal of Protozoology 37: 212–218.

MEDLIN, L., H. J. ELWOOD, S. STICKEL, AND M. L. SOGIN. 1988. Thecharacterization of enzymatically amplified eukaryotic 16S-likerRNA-coding proteins. Gene 71: 491–499.

ORMIERES, R. 1980. Haplosporidium parisi n. sp., Haplosporidie para-site de Serpula vermicularis L. etude ultrastructurale de la spore.Protistologica 16: 467–474.

PERKINS, F. O. 1990. Phylum Haplosporidia. In: Handbook of Protoctis-ta, L. Margulis, J. O. Corliss, M. Melkonian, and D. J. Chapman(eds.). Jones and Bartlett Publishing, Boston, Massachusetts, p. 19–29.

———. 1991. ‘‘Sporozoa’’: Apicomplexa, Microsporidia, Haplospori-dia, Paramyxea, Myxosporidia, and Actinosporidia. In Microscopicanatomy of invertebrates, vol. 1, F. W. Harrison and J. O. Corliss(eds.). Wiley-Liss, New York, New York, p. 261–331.

———. 2000. Phylum Haplosporidia Caullery and Mesnil, 1899. InIllustrated guide to Protozoa, 2nd ed., J. J. Lee, G. F. Leedale, andP. Bradbury (eds.). Society of Protozoologists, Lawrence, Kansas,p. 1328–1341.

REECE, K. S., M. E. SIDDALL, E. M. BURRESON, AND J. E. GRAVES. 1997.Phylogenetic analysis of Perkinsus based upon actin gene sequenc-es. Journal of Parasitology 83: 417–423.

———, AND N. A. STOKES. 2003. Molecular analysis of a haplospori-dian parasite from cultured New Zealand abalone Haliotis iris. Dis-eases of Aquatic Organisms 53: 61–66.

RENAULT, T., N. A. STOKES, B. CHOLLET, N. COCHENNEC, F. BERTHE, AND

E. M. BURRESON. 2000. Haplosporidiosis in the Pacific oyster, Cras-sostrea gigas, from the French Atlantic coast. Diseases of AquaticOrganisms 42: 207–214.

SIDDALL, M. E., N. A. STOKES, AND E. M. BURRESON. 1995. Molecularphylogenetic evidence that the phylum Haplosporidia has an al-veolate ancestry. Molecular Biology and Evolution 12: 573–581.

SPRAGUE, V. 1979. Classification of the Haplosporidia. Marine FisheriesReview 41: 40–44.

SWOFFORD, D. L. 2002. PAUP*: Phylogenetic analysis using parsimony(*and other methods), version 10. Sinauer Associates, Sunderland,Massachusetts.

THOMPSON, J. D., D. G. HIGGINS, AND T. J. GIBSON. 1994. Improving thesensitivity of progressive multiple sequence alignment through se-quence weighting, position-specific gap penalties and weight matrixchoice. Nucleic Acids Research 22: 4673–4680.

molecular phylogeny of the …research.amnh.org/users/siddall/pub/haplosporida.pdf1111 j....

Documents