mot3, a zn finger transcription factor that modulates gene … · 1998. 5. 27. · mot3...

Copyright 1998 by the Genetics Society of America

Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression andAttenuates Mating Pheromone Signaling in Saccharomyces cerevisiae

Anatoly V. Grishin, Michael Rothenberg,1 Maureen A. Downs and Kendall J. BlumerDepartment of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110

Manuscript received January 13, 1998Accepted for publication March 4, 1998

ABSTRACTIn the yeast Saccharomyces cerevisiae, mating pheromone response is initiated by activation of a G protein-

and mitogen-activated protein (MAP) kinase-dependent signaling pathway and attenuated by severalmechanisms that promote adaptation or desensitization. To identify genes whose products negativelyregulate pheromone signaling, we screened for mutations that suppress the hyperadaptive phenotype ofwild-type cells overexpressing signaling-defective G protein b subunits. This identified recessive mutationsin MOT3, which encodes a nuclear protein with two Cys2-His2 Zn fingers. MOT3 was found to be a dosage-dependent inhibitor of pheromone response and pheromone-induced gene expression and to requirean intact signaling pathway to exert its effects. Several results suggested that Mot3 attenuates expressionof pheromone-responsive genes by mechanisms distinct from those used by the negative transcriptionalregulators Cdc36, Cdc39, and Mot2. First, a Mot3-lexA fusion functions as a transcriptional activator.Second, Mot3 is a dose-dependent activator of several genes unrelated to pheromone response, includingCYC1, SUC2, and LEU2. Third, insertion of consensus Mot3 binding sites (C/A/T)AGG(T/C)A activatesa promoter in a MOT3-dependent manner. These findings, and the fact that consensus binding sites arefound in the 59 flanking regions of many yeast genes, suggest that Mot3 is a globally acting transcriptionalregulator. We hypothesize that Mot3 regulates expression of factors that attenuate signaling by the phero-mone response pathway.

THE pheromone response pathway of the yeast Sac- gradients, allowing mating to occur preferentially be-tween partners that produce high levels of pheromonecharomyces cerevisiae is controlled by a complex inter-

play of positive and negative regulators of signal trans- or to resume proliferation if mating is unsuccessful(Jackson et al. 1991; Segall 1993; Bardwell et al.duction (Bardwell et al. 1994). Secreted oligopeptide

mating pheromones (a-factor and a-factor) induce the 1994). Desensitization or adaptation in yeast can occurby several mechanisms, including pheromone proteoly-expression of genes required for mating, inhibit cell

proliferation, and trigger a differentiation program nec- sis (Ciejek and Thorner 1979; MacKay et al. 1988),receptor phosphorylation and downregulation ( Jen-essary for conjugation of haploid yeast cells of opposite

mating type. Pheromones exert their effects by activat- ness and Spatrick 1986; Reneke et al. 1988; Chen andKonopka 1996), G protein deactivation by a putativeing a conserved signal transduction pathway consisting

of cell surface receptors, a heterotrimeric guanine nu- GTPase-activating protein Sst2, a member of the regula-tors of G protein signaling (RGS) family (Dohlman etcleotide-binding protein (G protein), and a mitogen-

activated protein (MAP) kinase cascade, ultimately im- al. 1996), and MAP kinase dephosphorylation by dualspecificity and tyrosine-specific protein phosphatasespinging on a cyclin-dependent kinase inhibitor (Far1)

that induces growth arrest and a transcription factor (Doi et al. 1994; Zhan et al. 1997). Because the expres-sion of several of these negative regulatory factors is(Ste12) that activates expression of pheromone-respon-

sive genes. pheromone-inducible, transcriptional regulation islikely to be an important part of the adaptive process.Negative regulation of the pheromone response path-

way allows cells to adapt or become desensitized to a We have shown previously that adaptation is promotedstrongly in wild-type cells that overexpress signaling-signal of constant intensity. This is thought to be impor-

tant for cells to respond chemotropically to pheromone defective G protein b subunits (Grishin et al. 1994).The mechanism of this “hyperadaptive” phenotype maybe novel because it does not involve pheromone degra-dation, receptor phosphorylation or endocytosis, Sst2,Corresponding author: Anatoly Grishin, Department of Cell Biology

and Physiology, Washington University School of Medicine, 660 S. or the dual-specificity phosphatase encoded by MSG5.Euclid Ave., Box 8228, St. Louis, MO 63110-1093. From our previous studies we hypothesized that overex-E-mail: [email protected]

pression of mutant Gb subunits in wild-type cells pro-1 Present address: University of California School of Medicine, SanFrancisco, CA 94143. motes an adaptive process that attenuates pheromone

Genetics 149: 879–892 ( June, 1998)

880 A. V. Grishin et al.

TABLE 1

Yeast strains used in this study

Strain Genotype Source or reference

W303-1B MATa ade2 his3 ura3 leu2 trp1 R. Rothstein

W303az1 W303-1B mot3::URA3 This workAG56 MATa ade2 his3 ura3 leu2 trp1 sst1D Grishin et al. (1994)AG56-5AG56-46AG56-58AG56-80 Hyperadaptation-defective derivatives of AG56 This workAG56-102AG56-119AG56-138AG56-143AG62 Diploid of cross between AG56 3 W303-1B This workAG62z Diploid of cross between AG64 3 W303az1 This workAG64 AG56 mot3::URA3 This workAG65a AG56 mot3::ura3 This workAG66 AG65 ste2::LEU2 This workAG67 AG65 ste4::URA3 This workAG68 AG65 ste18-1 This workAG69 AG65 ste20::URA3 This workAG70 AG65 ste11::URA3 This workAG71 AG65 ste7-A1 This workAG72 AG65 ste12::LEU2 This work31K MATa ade8 ura3 trp1 arg4 This workL40 MATa ade2 his3 leu2 trp1 gal4 gal80 S. Hollenberg

LYS2::(lexAop)4-HIS3 URA3::(lexAop)8-lacZDC14b MATa his1 Weiner et al. (1993)DC17b MATa his1 Weiner et al. (1993)

a A Ura2 derivative of AG64 selected on SD with 5-fluoroorotic acid (0.1%).b Mating type testers.

marked derivative pRS425 FUS1-lacZ (FUS1-lacZ ; McCaffreyresponse. As part of an effort to define this adaptiveet al. 1987); pMR1300 (KAR3-lacZ ; Meluh and Rose 1990).mechanism, we report the identification of mutationsOther newly constructed promoter-lacZ fusions were made by

that abrogate the hyperadaptive phenotype. This has using BamHI and EcoRI-cut YEp357R (Myers et al. 1986) asidentified the MOT3 gene, a previously uncharacterized a recipient for PCR-generated promoter DNA fragments with

the following endpoints relative to translation starts: 2517 togene that encodes a member of the Cys2-His2 Zn finger1132 (CUP1), 2245 to 1243 (FUS3), 2811 to 160 (SST2),family of transcription factors. We present evidence thatand 2335 to 1182 (AGA1), resulting in plasmids pAG33,Mot3 is a transcriptional regulator of several yeast genes,pAG34, pAG35, and pAG36. b-Galactosidase levels for these

possibly including those involved in attenuating the ac- plasmids have been reported by others or confirmed by ustivity of the pheromone response pathway. (unpublished results) to correlate with transcript levels.

pAG37 was constructed by inserting four lexA operators (Kel-

eher et al. 1992) into the SalI site upstream of the GAL1promoter of pD-lacZ R37 (Singer et al. 1990). To constructMATERIALS AND METHODSpAG38, the oligonucleotides (CTAGAAGCAGGCATTAC

Strains and media: Yeast strains used in this study are listed AAGGCACTGACAGGTAAAACAGGTAAAGGCA and CTAGTin Table 1. Growth media (YPD, YPG, supplemented SD, and GCCTTTACCTGTTTTACCTGTCAGTGCCTTGTAATGCCTsporulation media) were prepared as described previously GCTT; Mot3 binding sites are underlined) were annealed and(Sherman 1991). SGal contains galactose (2%) and sucrose the resulting duplex inserted into the XbaI site of pAG33.(0.2%) instead of glucose. Synthetic a-factor (Washington pAG40 was constructed by inserting a 2.4-kb EcoRI-SalI frag-University Protein Chemistry Laboratory, St. Louis, MO) was ment encompassing the entire MOT3 gene and its promoteradded to media to a final concentration of 1 mm, unless indi- into EcoRI and SalI-cut pFAT-RS3039b9 (provided by D. Gott-

cated otherwise. schling, Fred Hutchinson Cancer Center, Seattle, WA). ToPlasmids: The following plasmids were used as promoter- construct pAG44, the 39 part of MOT3 was amplified with

lacZ fusion reporters: pLGD312s (CYC1-lacZ ; Guarente and primers CCGCTCGAGTCATCAGACCATAAATATATCC andHoar 1984), pBM2773 (SUC2-lacZ), pBM2636 (HXT1-lacZ ), CGGGATCCTTGTTAAATGAGTGGGAAGGG and clonedpBM2717 (HXT2-lacZ ), pBM2819 (HXT3-lacZ ), pBM2800 into XhoI and BamHI-cut pET-15b (Novagen). pAG41 was con-(HXT4-lacZ), pBM2832 (LEU2-lacZ ; Ozcan and Johnston structed by amplifying the complete MOT3 open reading1996a), pJJ13 (PCK1-lacZ ; Mercado and Gancedo 1992); pD- frame (ORF) with primers GGATCCGGACATATCATATTT

GAG and ATCGATTTTGTTGTGACTAACAATAAGGTT andlacZ R37 (GAL1-lacZ ; Singer et al. 1990); pSL307 and its LEU2-

881Mot3 Transcription Factor of Yeast

cloning the PCR product into BamHI and ClaI-cut pGFP- phates (dNTPs), if necessary. For experiments designed todefine a consensus Mot3 binding site, a set of labeled probesC-FUS (Niedenthal et al. 1996). pAG42 was constructed

by amplifying the entire MOT3 coding sequence with pri- having the same specific activity was prepared in the followingway. Oligonucleotides with the sequences GCAACCAGXXXXmers GGAATTCGGGACATATCATATTCGAGCAATGAATG

CGG and GGATCCTTGTTAAATGAGTGGGAAGGG and by XXGACGACAACAACTGTGCTGCTGA, where XXXXXX arevariants of the sequence CAGGCA (2 pmol each) were an-cloning the amplification product into EcoRI and BamHI-cut

pSH2-1 (Ma and Ptashne 1987). pBM3306 (Ozcan and John- nealed to 0.1 pmol of the primer TCAGCAGCACAGTTGTTGTCGTC, which had been 59-end-labeled (the same prepara-ston 1996b) and pAG3-26 (Grishin et al. 1994) were de-

scribed previously. A YCp50-based yeast genomic DNA library tion of labeled primer was used to generate each probe); theprimer was extended with Klenow polymerase and dNTPs.(Rose et al. 1987) was used to clone the MOT3 gene.Binding reactions (20 ml) contained labeled probe (20,000Genetic methods: Ethylmethane sulfonate (EMS) mutagen-Cerenkov counts; 0.1 ng or less), purified His-tagged Mot3DNesis, crosses, and asci dissection were performed as described(0.2 mg, unless indicated otherwise) or His-tagged Goa (0.2previously (Guthrie and Fink 1991). Hyperadaptation-defec-mg), bovine serum albumin (1 mg), competitor DNA as indi-tive mutants that retain the ability to overexpress signaling-cated, Tris pH 7.5 (10 mm), KCl (50 mm), MgCl2 (10 mm),defective Gb subunits were identified based on their ability toZnSO4 (10 mm), and glycerol (10%). Samples were incubatedadopt shmoo-like morphologies when grown on galactose.15 min at 308 and separated by electrophoresis through 4%Based on our previous studies (Grishin et al. 1994), this partialpolyacrylamide gels (80:1 acrylamide:bis) in 0.53 Tris-acetate-constitutive activation of the pathway apparently occurs be-EDTA (TAE) buffer. Gels were dried and exposed to X-raycause mutant Gbg complexes sequester Ga subunits, liberatingfilm; alternatively, images were acquired on a Phosphorimagersufficient wild-type Gbg complexes to cause partial constitutiveII and quantified using ImageQuant software (Molecular Dy-activation of the pathway. Spheroplasts were fused in the pres-namics, Sunnyvale, CA). Methylation interference experi-ence of polyethylene glycol according to published methodsments used as a probe a double-stranded oligonucleotide cor-(van Solingen and van der Platt 1977). One of the parentsresponding to the region of the CYC1 promoter between basescarried pAG3-26 and the other parent carried YCp50, allowing2195 and 2119 (relative to the translational start). This 59-fusion diploids to be selected by plating on media lackinglabeled DNA was treated with dimethyl sulfate and subjecteduracil and histidine. Gene disruptions were performed by us-to EMSA, as described above. Samples were fractionated elec-ing the one-step replacement technique (Rothstein 1991).trophoretically through a 1.5% agarose gel in 0.53 TAEThe plasmid pBMK8 (provided by D. Levin, Johns Hopkinsbuffer; shifted and unshifted bands were located by autoradi-University) was used to disrupt MOT3 with URA3. This plasmidography and excised. These DNA samples were cleaved atis a derivative of YEp352 (Hill et al. 1986) carrying a 3-kbguanosine residues by using Maxam-Gilbert chemistry andgenomic BamHI-SphI MOT3 fragment in which a central NotI-resolved on sequencing gels.NheI 800-bp portion of the coding sequence (encoding amino

Pheromone response assays: Quantitative mating tests, haloacids 116–424, which includes both Zn fingers) was replacedassays, morphological response assays, and measurement ofwith a 1.1-kb URA3 fragment. A 3-kb SphI-EcoRI fragment con-pheromone-induced gene expression were performed as de-taining the disrupted MOT3 gene was isolated and used forscribed previously (Grishin et al. 1994). The following assayone-step gene replacement. The STE20 gene was disrupted aswas also used to detect differences in adaptation capacity.follows. A 5.5-kb EcoRI-KpnI partial digestion product of yeastExponentially growing cultures were diluted to 500 cells/mlgenomic DNA carrying the STE20 gene was cloned into EcoRIin YPD and 100-ml aliquots of this diluted culture were dis-and KpnI-cut pRS314 (Sikorski and Hieter 1989) to makepensed into wells of a sterile 96-well plate. After variouspAG5. A 3.2-kb SphI-KpnI fragment encompassing the entireamounts of synthetic a-factor were added to the wells, theSTE20 gene was replaced with a 1.1-kb URA3 fragment, re-plate was covered and incubated at 308 for 2 days. The absencesulting in pAG6. pAG6 was cleaved with EcoRI and HindIIIof growth indicated the inability to adapt to a given phero-and used for one-step gene replacement. The STE4, STE11,mone concentration.and STE12 genes were disrupted using the following plasmids:

Other methods: RNA isolation from yeast and NorthernPstI and XhoI-cut pAG4 (Grishin et al. 1994), XbaI-cut pNC276blotting were performed as described (Flick and Johnston(Rhodes et al. 1990), and SacI and SphI-cut pSUL16 (Fields

1990). As a hybridization probe, a 32P-labeled 800-bp PstI-and Herskowitz 1987). All disruptions were confirmed bySacII fragment from MOT3 ORF was used. For fluorescencePCR or Southern blotting. Derivatives of the strain AG65 car-microscopy, wild-type cells (strain 31K) were transformed withrying ste18 or ste7 mutations were selected among spontaneouspAG41, transformants grown overnight in SD-uracil, and trans-pheromone-resistant mutants and identified by complementa-ferred into SD-uracil-methionine for 5–6 hr to induce expres-tion with M91p1 (STE18) (Whiteway et al. 1989) and pSTE7.2sion of the Mot3-GFP fusion protein. Cells were harvested by(STE7 ) (Teague et al. 1986), respectively.centrifugation at 1000 rpm, fixed with 3.8% formaldehyde forPurification of recombinant His-tagged Mot3DN protein,5 min, and stained with DAPI (0.1 mg/ml) for 15 min. Imageselectrophoretic mobility shift assays (EMSA), and methylationwere obtained using BX60 microscope (3100 objective)interference assays: Escherichia coli [BL21(DE3); Novagen] car-equipped with BX-FLA reflected light fluorescence attach-rying pAG44 were grown to late-log phase, and His-taggedment (Olympus, Lake Success, NY) and VE-470 camera (Op-Mot3DN (residues 339-490, including both Zn fingers) was tronics, Goleta, CA).purified by affinity chromatography on Ni21-NTA resin, as Nucleotide sequence accession number: The nucleotide se-described previously (Watson et al. 1996). Promoter DNA quence of the MOT3 gene was deposited in GenBank underfragments for EMSA were prepared by using T4 polynucleo- the accession number U25279 (Madison et al. 1998).tide kinase and [g-32P]ATP to end-label PCR fragments with

the following endpoints relative to translation starts: 2295 to140 (CYC1), 2636 to 134 (SUC2), 2462 to 142 (FUS1),

RESULTS2517 to 1132 (CUP1), 2410 to 113 (LEU2), 2263 to 217(FUS3), and 2811 to 160 (SST2). Double-stranded oligonucle- Isolation of suppressors of hyperadaptation: Hyper-otide probes were prepared by annealing two completely or

adaptation to pheromone promoted by overexpressionpartially overlapping complementary oligonucleotides, one ofof signaling-defective Gb subunits is independent of sev-which was labeled at the 59 end, and by filling in recessed 39

ends with Klenow polymerase and deoxynucleoside triphos- eral known adaptive mechanisms in yeast (Grishin et


al. 1994). We therefore reasoned that identifying geneswhose functions are required for hyperadaptation mayreveal new negative controls of the pheromone responsepathway. We used the following approach to isolate mu-tants in which the hyperadaptive phenotype is abro-gated. Wild-type MATa cells (AG56) overexpressing sig-naling-defective Gb subunits (from the inducible GALpromoter on pAG3-26) were treated with EMS to inducemutations and grown to form colonies. Approximately50,000 colonies were screened by replica plating formutants that have lost the ability to grow on mediacontaining a-factor at a concentration that inhibitsgrowth of normal but not hyperadaptive cells. Pheno-typic analysis indicated that the majority of these mu-tants failed to overexpress signaling-defective Gb sub-units, as expected (see materials and methods).However, eight isolates (AG56-5, -46, -58, -80, -102, -119,-138 and -143) were putative hyperadaptation-defectivemutants because they retained the ability to overexpressmutant Gb subunits. This was confirmed by performingpheromone-induced growth arrest (halo) assays underconditions where signaling-defective Gb subunits wereoverexpressed. The eight mutants responded relativelynormally to pheromone (halo sizes were normal), butthey failed to adapt rapidly (halos were clear instead ofbeing turbid; Figure 1 shows the halo phenotype ofmutant AG56-5, which was similar to that of the sevenother mutants). The failure to form turbid halos wasnot due to decreased viability upon treatment with pher-omone (data not shown).

To determine whether the mutations responsible forthe hyperadaptation defects were dominant or recessive

Figure 1.—Pheromone response phenotypes of wild-typeand to assign complementation groups, we fused sphe- cells, hyperadaptation-defective mutants, and MOT3-overex-roplasts of each mutant with spheroplasts of wild-type pressing cells. Pheromone-induced growth arrest (halo) assays

were performed using Sgal -histidine -uracil medium. a-Fac-MATa cells, or with spheroplasts of the other mutants.tor (1, 0.2, 0.04, 0.008, and 0.0016 mg, clockwise from top)The hyperadaptation phenotypes of the resultant fusionwas applied on nascent lawns. Plates were incubated 2 days atdiploid cells were determined by performing halo assays 308 and photographed. (A) Wild-type cells (AG56) containing

under conditions where signaling-defective Gb subunits control plasmids YCp50 and pRS313. (B) Wild-type cellswere overexpressed. All of the mutations appeared to (AG56) overexpressing signaling-defective Gb subunits (from

pAG3-26) and carrying YCp50. (C) Hyperadaptation-defectivebe recessive, because MATa/MATa diploids producedmutant (AG56-5) overexpressing signaling-defective Gb sub-by fusion of mutants with wild-type cells formed turbidunits (from pAG3-26) and carrying YCp50. (D) Hyperadapta-

halos (data not shown). Assays of diploids produced by tion-defective mutant (AG56-5) overexpressing signaling-pairwise fusions of the mutants defined two comple- defective Gb subunits (from pAG3-26) and carrying a genomicmentation groups: seven mutants belong to one com- library plasmid (pAG50DR) that corrects the hyperadaptation

defect. (E) A mot3::ura3 mutant (AG65) overexpressing signal-plementation group and one mutant belongs to theing-defective Gb subunits and carrying YCp50. (F) Wild-typeother complementation group (data not shown). Thecells (AG56) overexpressing MOT3 from 2m-based plasmidfollowing sections describe the identification and char- pAG40 and carrying YCp50.

acterization of the gene corresponding to the largercomplementation group; studies of the second comple-mentation group will be reported elsewhere.

Cloning, sequencing, and expression of MOT3: A mids caused pheromone resistance because they resultin expression of the a1/a2 repressor that turns off ex-YCp50-based yeast genomic DNA library was screened

for plasmids that corrected the hyperadaptation defect pression of mating-specific genes. The remaining plas-mid contained a 4.5-kb fragment from the right armof mutant AG56-5 (restored the ability of cells to form

colonies on plates containing a-factor). Of the eight of chromosome XIII. The minimum complementingregion of this 4.5-kb fragment (a 2.4-kb EcoRI-SalI sub-plasmids isolated, partial sequencing revealed that seven

contained either the MATa or HMLa genes. These plas- fragment) contained a single ORF corresponding to


Figure 3.—Adaptation phenotypes of wild-type, mot3::ura3mutant, and MOT3-overexpressing cells. Wild-type (AG56),mot3::ura3 (AG65), and MOT3-overexpressing (AG56 con-taining MOT3 on the high-copy plasmid pAG40) cells wereFigure 2.—Structure of Mot3 and its similarity to other Znanalyzed. Wells of a 96-well plate were inoculated with z100finger proteins. (A) Structural features of Mot3. Black, Zncells of the indicated genotypes in 100 ml of YPD, and thefingers; vertical lines, glutamine-rich region; shaded, aspara-indicated levels of a-factor were added. The plate was incu-gine-rich regions; hatched, region rich in proline residues.bated 2 days at 308 and photographed. Cells that adapted toThe positions of the N and the C termini are indicated (posi-a given level of pheromone grew to form turbid cultures,tions 1 and 490, respectively). (B) Alignment of the Zn fingerswhich appear black when photographed in transmitted light;of Mot3 with related Zn finger transcription factors. Aminocultures that did not adapt and failed to grow appear white.acid sequences are aligned to match the conserved cysteine

and histidine residues. Gaps were introduced to maximizesimilarity. Identical and similar residues are boxed in black.Asterisks mark residues involved in DNA recognition ac-

are responsible for the hyperadaptation defects of thecording to the Zn finger recognition code. PLAG1, humanoriginal mutants, we studied genetic linkage betweenZn finger protein (accession number U65002); ROAZ, rat Zn

finger protein (U92564); ZNF6, human transcription factor one of the mutations and the MOT3 locus. MOT3 was(S25409); ZFP64, mouse Zn finger protein (U49046); MAZ, disrupted with the URA3 gene (in W303-1B; the dis-human Zn finger protein (U33819). Numbers on the right ruptants were viable), and the resultant strain wasindicate positions of Zn fingers in the amino acid sequence

crossed with the mutant AG56-5. Twenty haploid MATaof each protein.Ura2 meiotic segregants derived from this cross weretransformed with a plasmid (pAG3-26) that overex-presses signaling-defective Gb subunits. The results ofhalo assays showed that all 20 Ura2 segregants wereYMR070W. This ORF encodes a polypeptide of 490hyperadaptation-defective (clear halos; data not shown),amino acids with two Cys2-His2 Zn finger motifs (consen-indicating that the original mutation in AG56-5 and thesus CX(2-4)CX(9)LX(2)HX(3-4)H (Klug and Rhodes 1987)mot3::URA3 disruption are tightly linked. We also foundin the C-terminal half of the molecule (Figure 2). Znthat mutants carrying the mot3::URA3 allele and thefingers of this class form DNA binding domains of aoriginal AG56-5 mutant displayed equivalent defects inlarge family of transcription factors (Evans and Hol-

hyperadaptation, as indicated by halo assays (Figurelenberg 1988), which suggests that the cloned gene1E). Therefore, MOT3 appeared to be defective in theencodes a transcription factor. The Zn fingers are mostoriginal mutants. Subsequently, the properties of mot3similar to those of several mammalian Zn finger tran-mutations were studied using mot3 disruption strains.scription factors, including MAZ and Zfp64 (Figure 2).

MOT3 negatively regulates pheromone signaling: ToThe yeast gene product has other features of a transcrip-determine whether MOT3 influences pheromone re-tion factor, including regions rich in glutamine or pro-sponses in cells that do not overexpress signaling-line (Tjian and Maniatis 1994), and high concentra-defective Gb subunits, we examined the effects of mot3tion of positively charged and polar amino acids in themutations on several signaling-related phenotypes. First,Zn finger domain (Klug and Rhodes 1987). We namedin quantitative mating assays or halo assays, mot3 mutantsthe gene MOT3 because subsequent experiments indi-were indistinguishable from isogenic wild-type controlscated that it is a modulator of t ranscription. Northern(data not shown). However, because it can be difficultblotting revealed that MOT3 was expressed at similar

levels regardless of cell type or pheromone exposure to detect modest differences in adaptation phenotypesby halo assay, a second type of adaptation assay was used(data not shown).

To determine whether mutations in the MOT3 gene (see materials and methods). The results indicated


Figure 4.—Effects ofMOT3 on pheromone re-sponses. Dose-response cur-ves for a-factor-induced ex-pression of SST2-lacZ (A)and FUS1-lacZ (B). Thestrains used were AG56(WT), AG65 (mot3D), andAG56[pAG40] (2m-MOT3).Cells grown to early logphase (Klett 5 10) in appro-priately supplemented SDmedia were incubated for2 hr at the indicated phero-mone concentrations priorto assaying b-galactosidaseactivity. Squares, mot3D; cir-cles, 2m-MOT3; diamonds,wild type.

that wild-type cells were able to grow (adapt) at a two- stimulated adaptation, as judged by the formation ofsmaller, turbid halos (Figure 1F) and by the ability offold higher concentration of a-factor than could mot3

mutants (Figure 3). Similarly, mot3 mutants were three- cells to grow in liquid media containing higher concen-trations of a-factor (Figure 3). These lines of evidencefold more sensitive to pheromone, as indicated by dose-

response curves for pheromone-induced morphological suggest that MOT3 is a dosage-dependent regulator ofpheromone signaling and/or adaptation.changes (shmoo formation; data not shown).

MOT3 overexpression had the opposite effects. It MOT3 represses expression of pheromone-inducedgenes and activates expression of other yeast genes:markedly decreased sensitivity to pheromone and/or

TABLE 2

Effects of MOT3 disruption and overexpression on gene expression

b-Galactosidase activity (Miller units)

Reporter Growth condition mot3D WT 2m-MOT3

Repressed reporters:SST2-lacZ SD 70 6 10 25 6 3 10 6 2FUS1-lacZ SD 14 6 2 5.3 6 1 1.6 6 0.3AGA1-lacZ SD 28 6 4 5.0 6 1 1.3 6 0.1FUS3-lacZ SD 33 6 2 14 6 2 5.5 6 1KAR3-lacZ SD 6.2 6 1 3.8 6 0.5 2.2 6 0.3

Activated reporters:SUC2-lacZ SGal 1 0.1% glucose 3.2 6 1 12 6 2 33 6 4CYC1-lacZ SGal 9.0 6 2 33 6 3 118 6 11LEU2-lacZ SD 34 6 5 77 6 10 180 6 20HXT2-lacZ SGal 1 0.1% glucose 60 6 5 65 6 5 500 6 100HXT3-lacZ SD (4% glucose) 500 6 100 550 6 100 1100 6 150HXT4-lacZ SGal 1 0.1% glucose 130 6 20 150 6 25 380 6 50

Unaffected reporters:PCK1-lacZ SGal 3.9 6 2.3 4.4 6 0.8 NDa

HXT1-lacZ SD 75 6 15 75 6 20 75 6 20GAL1-lacZ SD ,1 ,1 ,1GAL1-lacZ SGal 350 6 20 365 6 20 350 6 20CUP1-lacZ SD 60 6 6 65 6 10 65 6 10

Unaffected reporter with introducedartificial Mot3 binding sites:CUP1 SD 60 6 6 272 6 30 NDa

(53 MBS)-lacZ b

a ND, not determined.b CUP1 promoter with five copies of a consensus Mot3 binding site (53 MBS).


mutants for a variety of phenotypes, including growthFigure 5.—Effects of rate in YPD, YPD 1 1 m KCl, YP 1 glycerol, and synthetic

MOT3 onCYC1 and SUC2 tran- media; growth at 378 or 148; sensitivity to heat shockscript levels. Total RNA (10 mg

(458 for 30 min); survival rate after transfer from 1 mper lane) from AG64 (mot3D),sorbitol to water; survival upon irradiation with short-AG56 [YCp50] (WT), and

AG56 [YEp352-MOT3] was wave ultraviolet light at 20 mJ/cm2; survival in stationarytreated with glyoxal, electro- phase; and effects on cell morphology or sporulationphoresed through a 1.2% aga- efficiency. Wild-type cells and mot3 mutants were indis-rose gel, and transferred to a

tinguishable with regard to these phenotypes (data notcharged Nylon membrane.shown). However, when isogenic wild-type and mot3 mu-Northern blots were hybrid-

ized to end-labeled 50-mer tants were continuously cocultivated in YPD for 100antisense oligonucleotides cor- generations, the proportion of mutant cells droppedresponding to coding se- from 50 to 30%, indicating a slight selective disadvan-quences of the indicated

tage conferred by the disruption.genes. Radioactivity present inMOT3 requires an intact signaling pathway to affecteach band was measured using

a Phosphorimager; relative ra- expression of pheromone-induced genes: Previous in-dioactivity values are shown be- vestigations have revealed that basal expression of pher-low each panel. omone-induced genes is controlled in part by mecha-

nisms that require an intact signaling pathway, as wellas mechanisms that do not (Bardwell et al. 1994). Todetermine which of these mechanisms may be affected

Consistent with the effects of MOT3 on pheromone- by MOT3, we constructed a set of isogenic strains ininduced growth arrest and morphological changes, we which a mot3::ura3 disruption was combined with reces-found that MOT3 negatively regulates expression of sive mutations affecting various components of thepheromone-induced genes. In mot3 mutants, basal and pheromone response pathway [G protein b- and g-sub-pheromone-induced (at low pheromone concentra- units (ste4 and ste18 mutations, respectively), a PAKtion) expression of FUS1-lacZ and SST2-lacZ reporters homolog (ste20 mutation), an MEKK homolog (ste11was increased (Figure 4). Similar increases in basal gene mutation), MEK homolog (ste7 mutation), or the phero-expression were observed with several other pheromone-regulated transcription factor (ste12 mutation)].mone-inducible promoters (AGA1, FUS3, and KAR3) These strains were used to measure the basal expressiondriving expression of lacZ (Table 2), indicating that a of a pheromone-inducible reporter (FUS1-lacZ). Unlikemot3 mutation is likely to have similar effects on most, what we observed with cells containing an intact signal-if not all, pheromone-induced promoters. Conversely, ing pathway, disruption of MOT3 failed to increase basalMOT3 overexpression inhibited expression of phero- gene expression when the pathway was disrupted atmone-induced genes about threefold, as indicated by the G protein level or points downstream (Table 3).shifts in dose-response curves (Figure 4B) and basal Therefore, the effects of a mot3 mutation were similar toexpression levels (Table 2).

To determine whether MOT3 specifically regulatespheromone-inducible genes, we examined the expres- TABLE 3sion of genes unrelated to pheromone response or mat- Effects of ste mutations on basal expression ofing. As shown in Table 2 and Figure 5, the expression FUS1-lacZ in mot3 null mutantsof several genes was affected by MOT3. Surprisingly, theeffects of MOT3 on these promoters were opposite of Basal b-galactosidase activitywhat was observed with pheromone-responsive promot- (Miller units)

Relevanters. A mot3 mutation decreased expression from thegenotype pSL307 pRS425-FUS1-lacZ

CYC1, SUC2, and LEU2 promoters an average of three-STE 5.3 6 1 5.0 6 1fold. Conversely, MOT3 overexpression increased ex-ste4::URA3 ,1pression from the CYC1, SUC2, LEU2, HXT2, HXT3,ste7-A1 ,1and HXT4 promoters, with HXT2 being induced mostste11::URA3 ,1strongly (eightfold). However, the expression of otherste12::LEU2 ,1

genes, including PKC1, HXT1, GAL1, and CUP1, was ste18-A1 ,1unaffected by MOT3. Therefore, MOT3 represses pher- ste20::URA3 ,1omone-inducible genes and activates a subset of genes

mot3::ura3 (AG65) cells and isogenic ste mutant derivativesunrelated to pheromone signaling or mating.were transformed with pSL307 or pRS425-FUS1-lacZ, depending

Because MOT3 regulates a significant proportion of on the disruption. Cultures used for b-galactosidase assaysthe promoters we examined, it may affect expression were grown to mid-log phase (Klett 5 40) in SD-uracil or SD-

leucine.of many yeast genes. Accordingly, we examined mot3


those of cdc36, cdc39, and mot2 mutations, which elevate binding domain (amino acids 1–87). To test for activatorfunction, we used a GAL1-lacZ reporter in which lexAbasal expression of pheromone-responsive genes in a

pathway-dependent manner (de Barros Lopes et al. binding sites replace the normal GAL1 upstream activa-tion sequence (UAS). As shown in Table 4, this reporter1990; Neiman et al. 1990; Cade and Errede 1994; Irie

et al. 1994; Leberer et al. 1994). This is distinct from was induced |fivefold in cells expressing the lexA-Mot3fusion protein. To test for repressor activity, we used athe effects of a mot1 mutation, which elevates basal tran-GAL1-lacZ reporter plasmid in which lexA binding sitesscription of pheromone-responsive genes indepen-were placed immediately upstream of the GAL1 UAS.dently of the pheromone response pathway (Davis etExpression from this reporter was unaffected by theal. 1992).presence of lexA-Mot3. In contrast, this reporter wasMot3-GFP localizes to the nucleus: We fused greenrepressed about twofold when Rgt1, a known repressorfluorescent protein (GFP) to the C terminus of Mot3protein, was fused to lexA. Expression of either lexA or(the chimeric protein was functional, as indicated by itsMot3 alone had no effect on either reporter. Theseability to correct the hyperadaptation defect of a mot3results suggest that Mot3 can function as a transcrip-null mutant). Mot3-GFP fluorescence was restrictedtional activator. They do not rule out that Mot3 canmostly to the nucleus, as indicated by costaining withalso function as a transcriptional repressor.DAPI (Figure 6), consistent with Mot3 functioning as a

DNA binding activity of Mot3: To determine whethertranscription factor.Mot3 is likely to function as a sequence-specific tran-Mot3 is a transcriptional activator: The precedingscription factor, we examined the ability of purified His-results indicate that Mot3 is a nuclear protein that re-tagged Mot3DN (residues 339–490, containing both Znpresses or activates gene expression, depending on thefingers) to bind DNA in electrophoretic mobility shiftpromoter being examined. To investigate whether tran-assays (EMSA). Four promoter probes were used: CYC1,scriptional repressor and/or activator function is intrin-SUC2, and FUS1, which are affected by MOT3, and CUP1,sic to the Mot3 polypeptide, we determined whetherwhich is not. Promoter DNA fragments from all fourMot3 activates or represses gene expression when it isgenes bound His-tagged Mot3DN, as indicated by therecruited to a heterologous promoter. This was doneappearance of one or more slower migrating bands rela-by fusing Mot3 to the C terminus of the lexA DNAtive to unbound DNA probe bands. A control protein(His-tagged Goa purified in an identical manner) didnot bind the probes. Binding was specific because unla-beled probe DNAs were effective competitors, whereaspoly(dA)·poly(dT) and poly(dIdC)·poly(dIdC) werenot (Figure 7). Poly(dG)·poly(dC) was an effective com-petitor for binding to the SUC2 probe (Figures 7 and8) or other labeled probes (data not shown), suggestingthat Mot3 binding sites may be GC-rich.

Although all four promoters we tested bound His-tagged Mot3DN, several pieces of evidence suggestedthat their relative binding affinities differ. First, theCYC1 and SUC2 probes were shifted to multiple retardedpositions, whereas FUS1 and CUP1 probes were onlyshifted to a single retarded position (Figure 7). Second,at a concentration of Mot3DN that was sufficient to bindnearly all of the CYC1 and SUC2 probes, only a fractionof the FUS1 or CUP1 probes was shifted (Figure 7).Third, competition experiments indicated that unla-beled CYC1 and SUC2 promoter fragments were effi-cient competitors for binding to a labeled SUC2 pro-moter fragment, whereas FUS1 and CUP1 fragmentswere inefficient competitors (Figure 8). Similarly, a frag-ment of the LEU2 promoter, which is positively regu-lated by MOT3, bound His-tagged Mot3DN relativelyefficiently (multiple shifted bands) and was an effectivecompetitor for binding to the SUC2 probe (data not

Figure 6.—Nuclear localization of Mot3-GFP. Wild-type shown). Therefore, efficient binding of Mot3DN to thecells (31K) containing pAG41 (top), pGFP-C-FUS (middle), CYC1, SUC2, and LEU2 promoters in vitro correlatedor YCp50 (bottom) were grown overnight in SD-uracil and

with the ability of MOT3 to stimulate expression of thesethen for 6 hr in SD -uracil -methionone. Cells were fixed withgenes, suggesting that Mot3 may bind these promotersformaldehyde, stained with DAPI, and observed under the

fluorescence microscope. to activate them.


TABLE 4

Effects of Mot3-lexA on expression from promoters containing lexA operators

Yeast Reporter DNA binding b-Galactosidase activitystrain constructa proteinb (Miller units)c

Test for activator function:L40 lexAop-GAL1DUAS-lacZ None 1.1 6 0.2L40 lexAop-GAL1DUAS-lacZ lexA1-87 1.3 6 0.2L40 lexAop-GAL1DUAS-lacZ lexA1-87-Mot3 5.2 6 0.6L40 lexAop-GAL1DUAS-lacZ Mot3 1.1 6 0.2

Test for repressor function:AG56 lexAop-GAL1-lacZ None 360 6 40AG56 lexAop-GAL1-lacZ lexA1-87 380 6 40AG56 lexAop-GAL1-lacZ lexA1-87-Mot3 360 6 40AG56 lexAop-GAL1-lacZ Mot3 350 6 40AG56 lexAop-GAL1-lacZ lexA1-87-Rgt1 200 6 20

a The reporter construct used to detect activator function in strain L40 is integrated, whereas that used todetect repressor activity in strain AG56 is caried on plasmid pAG37.

b DNA binding proteins were expressed from the following plasmids: pSH2-1 (lexA1-87), pAG42 (lexA1-87-Mot3), pBM3306 (lexA1-87-Rgt1), pAG40 (Mot3). Control cells contained pRS313 to allow growth in the absenceof histidine.

c b-Galactosidase activities were determined in cultures grown to Klett 40 in SD-histidine (UAS-less construct)or SGal-uracil-histidine (intact promoter construct).

Identification of a consensus Mot3 binding site: To (Choo and Klug 1997). The sequence of the Mot3 Znidentify promoter elements that may be bound by Mot3, fingers suggested that the Mot3 binding site is a 6-bpwe initially used the recognition code for Cys2-His2 Zn element in which the second, third, fourth, and sixthfinger proteins to deduce a putative Mot3 binding site positions are likely to be A, G, G, and G, respectively.

Because the other two positions of the putative recog-nition site could not be deduced by the Zn finger recog-

Figure 8.—Competition of various DNAs for binding His-tagged Mot3DN. Binding reactions were performed with a 32P-labeled DNA fragment from the SUC2 promoter, His-taggedMot3DN, and varying amounts of the indicated unlabeledFigure 7.—Electrophoretic mobility shift assays (EMSA)

using His-tagged Mot3DN and various promoter DNA frag- promoter DNA fragments as competitor DNAs. Promoter frag-ments used as probes and competitors were the same as thosements. DNA fragments derived from the indicated promoters

were amplified from genomic DNA using PCR. These frag- in Figure 7. Binding reactions were resolved on a native poly-acrylamide gel, and the amounts of label migrating at thements were end-labeled with 32P for use as probes or left

unlabeled for use as cold competitor DNAs. Binding reactions positions of bound and unbound probes were determinedusing a Phosphorimager. Data (average of three experiments,were resolved on acrylamide gels, and gels were dried and

subjected to autoradiography. Arrowheads indicate positions with individual points differing 20% or less) are presented asthe percentage of the probe that was unbound.of unbound probes.


nition code, and because Zn finger-DNA interactions reporter plasmid. This promoter was chosen becauseits transcription is independent of MOT3 (Table 2) andcould differ from predictions (Griesman and Pabo

1997), we determined the recognition sequence of Mot3 it lacks close matches to a consensus Mot3 binding site.We found that expression of this reporter was four- toempirically. First, we analyzed small fragments of one

of the promoters (CYC1) that appeared to contain multi- fivefold higher in wild-type cells than in mot3 mutants(Table 2). Thus, Mot3 binding sites can function asple Mot3 binding sites (yielded multiple shifted bands),

with the goal of identifying several single binding sites upstream activation sequences to drive gene expression.whose sequences could be compared. We started witha 335-bp CYC1 fragment (2295 to 140; designated here

DISCUSSIONand elsewhere relative to the translational start) thatyielded the EMSA pattern shown in Figure 7. Synthetic We have identified the MOT3 gene, which encodesDNA duplexes corresponding to smaller portions of this a member of the Cys2-His2 Zn finger protein family, infragment were used in EMSA to identify putative Mot3 a screen for mutations that abrogate the hyperadaptivebinding sites. This identified three 30-bp fragments phenotype of yeast cells overexpressing signaling-defec-(2195 to 2166, 2104 to 275, and 275 to 246), each tive G protein b subunits. We have shown that Mot3 iscontaining at least one Mot3 binding site (data not a nuclear DNA binding protein that can function as ashown). As predicted by the code, each of these DNAfragments contained the sequence AGG. However, nonematched the predicted NAGGNG motif, because theycontained A, T, or C at position 6. The fragment thatdisplayed the strongest binding (2195 to 2166; datanot shown) contained the sequence CAGGCA.

To determine whether the sequence CAGGCA in theCYC1 promoter actually binds Mot3, we used the methyl-ation interference assay. The probe was a synthetic du-plex spanning positions 2195 to 2119. The results indi-

Figure 9.—Methylation inter-cated that Mot3 binds the CAGGCA sequence, because ference mapping of a Mot3 bind-methylation of the two central guanosine residues of ing site in the CYC1 promoter. An

oligonucleotide corresponding tothis sequence interfered with Mot3 binding (Figure 9).a region of the CYC1 promoterTo define a Mot3 binding site further, we prepared(2195 to 2119; top strand) wasa set of duplex DNAs in which variants of the CAGGCA labeled at the 59 end and annealed

sequence were placed in a DNA fragment that otherwise with the unlabeled complemen-does not bind His-tagged Mot3DN, and used them as tary oligonucleotide. Guanosine

residues were methylated substoi-probes in EMSA experiments. The labeled probes wechiometrically with dimethylsul-used had the same specific activities (see materials

fate, and the double-strandedand methods), allowing direct comparisons of relative DNA fragment was subjected tobinding efficiencies to be made. Binding efficiencies EMSA using His-tagged Mot3DN.were expressed as the percentage of the total probe that DNAs migrating at the positions

of bound and free probe were ex-was shifted to a reduced mobility.cised individually from an agaroseThe results of these experiments are shown in Figuregel, extracted, and cleaved with pi-

10, leading to the following conclusions. First, the AGG peridine. Cleavage products werecore sequence (positions 2–4) was important because resolved on a sequencing gel. U,Mot3DN bound poorly to derivatives in which any posi- DNA from unshifted (free probe);

S, DNA from shifted (bound)tion in this sequence was altered (CBGGCA, CAHGCA,band. Arrowheads indicate twoor CAGHCA, where B is G, C, or T in equal proportion,guanosine residues whose methyl-

and H is A, C, or T in equal proportion). Second, an ation appears to inhibit the bind-A at position 6 was strongly preferred over other bases. ing of His-tagged Mot3DN. The se-Third, C, A, or T at position 1 and T or C at position 5 quence spanning these residues is

marked by the vertical line. Partpermitted relatively high affinity binding, with CAGGTAof the sequence is shown on theshowing the highest apparent affinity. The results there-left (59 end is at the bottom).

fore suggested that a consensus binding site for Mot3is (C.A.T)AGG(T.C)A.

Consensus Mot3 binding sites confer MOT3-depen-dent activation of a heterologous promoter: To establisha causal relationship between Mot3 binding and tran-scriptional regulation, we inserted five artificial Mot3binding sites into the CUP1 promoter in a CUP1-lacZ


transcriptional activator; we cannot rule out repressor binding sites should occur on average every 724 bp inthe yeast genome, such that many promoter regions arefunction for Mot3. Whereas Mot3 directly or indirectlylikely to contain at least one putative Mot3 binding site.represses expression of pheromone-responsive genes, itIndeed, examination of the promoter sequences of 45activates expression of several yeast genes unrelated toyeast genes, which control a variety of processes includ-pheromone response and mating. The implications ofing mating, proliferation, transcription, cytoskeletalthese findings in terms of the regulatory mechanismsfunction, and stress response, reveals that several con-that control gene expression and mating pheromonetain three or more consensus Mot3 binding sites (STE2,signaling in yeast are discussed below.FAR1, CLN1, MOT2, MYO1, and SSA4). Interestingly,Mot3 is a globally acting transcription factor: Basedthe 59-flanking region upstream of the MOT3 ORF hason several findings, Mot3 appears to be a globally actingthree sites, suggesting that autoregulation of the genetranscription factor that affects the expression of severalcould occur.yeast genes. First, a Mot3 binding site matching the

More strikingly, approximately half of the promotersconsensus sequence (C/T/A)AGG(T/C)A promoteswe studied that contain putative Mot3 binding sites areMot3-dependent transcriptional activation when pres-affected by MOT3. Three patterns of MOT3-dependentent in multiple copies in a promoter that otherwiseregulation have been found. Class 1 promoters (e.g.,is insensitive to Mot3. Based on this consensus, Mot3HXT2, HXT3, and HXT4) show relatively weak positiveregulation because they are unaffected by a mot3 nullmutation, but they are stimulated upon MOT3 overex-pression. Class 2 promoters (e.g., CYC1, SUC2, andLEU2) exhibit stronger positive regulation because theiractivities are decreased in mot3 mutants and increasedin cells overexpressing MOT3. The stronger positiveregulation of Class 2 promoters correlates with strongMot3 binding and multiple shifted bands in EMSA. Class2 promoters may be regulated more strongly becausethey apparently contain more consensus Mot3 bindingsites (three to five sites) than Class 1 promoters (one ortwo sites). We currently favor this explanation becauseother than the number of consensus Mot3 binding sites,there are no clear differences between Class 1 andClass 2 promoters in terms of the location of Mot3binding sites relative to TATA elements or binding sitesof other known transcription factors. However, becausewe do not know whether Mot3 binds either type ofpromoter in vivo, we cannot rule out that more complex,indirect effects of Mot3 are responsible for the differ-ences we observe between Class 1 and Class 2 promoters.

In contrast to Class 1 and Class 2 promoters, Class 3promoters (e.g., FUS1, FUS3, AGA1, SST2, and KAR3,which are all induced by mating pheromone) show mod-est negative regulation by MOT3. Their basal activitiesare increased in mot3 mutants and decreased in cellsoverexpressing MOT3. Whether Mot3 directly repressesthese promoters is unclear. Although we found that aMot3-lexA fusion lacks detectable repressor activity, therepressor activity of Mot3 could be promoter-specific.Indeed, in mot3 mutants the expression of genes withpromoter insertions of Ty or d-elements is elevated(Madison et al. 1998). Alternatively, Mot3 could func-

Figure 10.—Determination of a consensus binding site oftion indirectly to inhibit expression from pheromone-His-tagged Mot3DN. Labeled double-stranded oligonucleo-

tides containing the indicated 6-bp sequences were used as responsive promoters (see below).probes for EMSA with His-tagged Mot3DN. The percentage Finally, some promoters (e.g., CUP1, PCK1, HXT1,of each labeled probe migrating at the position of bound and GAL1) are unaffected by Mot3. All these promotersand unbound DNA was determined using a Phosphorimager.

lack matches (CUP1, GAL1) or have only one match(Top) Autoradiogram showing representative results. Arrow-(PCK1, HXT1) to the Mot3 consensus binding site weheads indicate the positions of the unbound probes. (Bottom)

Quantitation of the amount of each probe that was bound. have defined. The CUP1 promotor displays weak bind-


ing of Mot3 in EMSA, which may be explained by the and mot2 mutations all require an intact pheromonesignaling pathway to increase basal activity of pher-presence of a number of weaker noncanonical sites. It

is possible that low affinity binding of Mot3 to these omone-inducible promoters. However, whether Mot3regulates pheromone signaling by a mechanism similarpromotors is insufficient to cause detectable changes in

their expression. to that used by Cdc36, Cdc39, or Mot2 is presently un-clear because the biochemical functions of these pro-Consistent with its proposed function as a globally

acting transcription factor, Mot3 has been identified by teins remain to be determined.How might Mot3 negatively regulate the expressionothers as a high copy suppressor in two different con-

texts. MOT3 overexpression suppresses the cell wall in- of pheromone-inducible genes? Because currently thereis no direct evidence that Mot3 can act as a repressor,tegrity defect of mpk1D mutants (D. Levin, personal

communication), which are defective in a MAP kinase- we suggest that it negatively regulates signaling by induc-ing the expression of factors that inhibit pheromonedependent signaling pathway. MOT3 overexpression

also suppresses the lethal phenotype of mot1 spt3 double response. The target genes activated by Mot3 to inhibitsignaling are probably not GPA1, SST2, or MSG5, whichmutants (Madison et al. 1998), which are defective in

factors that regulate the distribution of TATA-binding encode known negative regulators of the pheromoneresponse pathway. This is suggested by our finding thatprotein (TBP) at strong vs. weak promoters (Collart

1996; Madison and Winston 1997). Mot3 inhibits rather than activates basal expression ofthese or other pheromone-inducible genes. Mot3 mayAlthough Mot3 is likely to affect the expression of a

number of yeast genes, it may have a modulatory rather therefore promote the expression of other negative reg-ulatory factors that impinge on the pheromone re-than an essential role in governing the efficiency of

transcription. We suggest this because mot3 null mutants sponse pathway. An example of such a negative factorexhibit only mild defects in growth rate, and because could be the G1 cyclin Cln2, whose overexpression hasnone of the Cys2-His2 Zn-finger proteins encoded by the been shown to inhibit the pheromone response pathwayyeast genome is an obvious structural homolog that at some point downstream of the G protein (Oehlen

might be functionally redundant with Mot3. Potentially, and Cross 1994).Mot3 is used to “fine tune” or coordinate expression of What is the role of Mot3 in mediating the hyperadap-a number of yeast genes. Mot3 could also be the major tive phenotype caused by overexpression of signal-transcriptional activator of genes that are important for ing-defective Gb subunits? One possibility is that mot3physiological functions we have not yet investigated. mutations suppress the hyperadaptive phenotype non-

Role of MOT3 in pheromone signaling: Disruption of specifically simply by increasing pheromone sensitivity,MOT3 has a relatively modest effect (two- to threefold) allowing the signal to be sustained longer. This is anon pheromone signaling. It increases pheromone sensi- unlikely explanation because the hyperadaptive pheno-tivity and the basal expression of pheromone-responsive type is not suppressed by other mutations, such as sst2promoters and causes a slight defect in adaptation. How- or receptor tail truncations, that increase pheromoneever, this does not necessarily indicate that Mot3 has a sensitivity much more dramatically (10- to 100-fold)relatively minor role in regulating pheromone signal- than mot3 mutations (Grishin et al. 1994). Alternatively,ing. For example, Mot3 could functionally overlap with certain target genes activated by MOT3 may be requiredstructurally distinct transcription factors, which to- specifically to mediate hyperadaptation. Defining thesegether exert a relatively prominent effect on phero- genes and characterizing their products may reveal newmone signaling. This would be analogous to the overlap- mechanisms that control the pheromone response path-ping functions of structurally distinct classes of protein way and other G protein and MAP kinase-dependentphosphatases (the dual-specificity phosphatase Msg5 signaling pathways.and the tyrosine phosphatases Ptp2 and Ptp3), which

We thank David Levin and Fred Winston for communicatingtogether have an important role in attenuating phero- results prior to publication; David Levin, Mark Johnston, Beverly

mone signaling by dephosphorylating the MAP kinase Errede, and Mark Rose for gifts of plasmids, and Mark Johnston

for critical reading of the manuscript. This work was supported byhomologs, Fus3 and Kss1 (Doi et al. 1994; Zhan et al.grants from the National Institutes of Health and the American Cancer1997).Society (K.J.B.). K.J.B. is an Established Investigator of the AmericanIn principle, Mot3 could be functionally redundantHeart Association.

with other transcriptional regulators, such as Cdc36,Cdc39, or Mot2, that are known to negatively regulatethe expression of pheromone-induced genes. Indeed,

LITERATURE CITEDthe effects of a mot3 mutation on pheromone-regulatedpromoters are similar to those caused by cdc36, cdc39,

Bardwell, L., J. G. Cook, C. J. Inouye and J. Thorner, 1994 Signalpropagation and regulation in the mating pheromone responseor mot2 mutations (de Barros Lopes et al. 1990; Neiman

pathway of the yeast Saccharomyces cerevisiae. Dev. Biol. 166: 363–et al. 1990; Cade and Errede 1994; Irie et al. 1994;379.

Leberer et al. 1994), all of which affect expression of aCade, R. M., and B. Errede, 1994 MOT2 encodes a negative regula-

tor ofgene expressionthat affects basal expression ofpheromone-number of yeast genes. Furthermore, mot3, cdc36, cdc39,


responsive genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 14: exported protein with homology to pepsin. Proc. Natl. Acad. Sci.USA 85: 55–59.3139–3149.

Chen, Q., and J. B. Konopka, 1996 Regulation of the G-protein- Madison, J. M., and F. Winston, 1997 Evidence that Spt3 function-ally interacts with Mot1, TFIIA, and TATA-binding protein tocouple alpha-factor pheromone receptor by phosphorylation.

Mol. Cell. Biol. 16: 247–257. confer promoter-specific transcriptional control in Saccharomycescerevisiae. Mol. Cell. Biol. 17: 287–295.Choo, Y., and A. Klug, 1997 Physical basis of a protein-DNA recogni-

tion code. Curr. Op. Struct. Biol. 7: 117–125. Madison, J. M., A. Dudley, C. Hongay and F. Winston, 1998 Iden-tification and analysis of Mot3, a zinc finger protein that bindsCiejek, E., and J. Thorner, 1979 Recovery of S. cerevisiae a cells

from G1 arrest by alpha factor phermone requires endopeptidase retrotransposon Ty LTR (d) in Saccharomyces cerevisiae. Mol. Cell.Biol. 18: 1879–1890.action. Cell 18: 623–635.

Collart, M. A., 1996 The NOT, SPT3, and MOT1 genes functionally McCaffrey, G., F. J. Clay, K. Kelsay and G. J. Sprague, 1987 Identi-fication and regulation of a gene required for cell fusion duringinteract to regulate transcription at core promoters. Mol. Cell.

Biol. 16: 6668–6676. mating of the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 7:2680–2690.Davis, J. L., R. Kunisawa and J. Thorner, 1992 A presumptive

helicase (MOT1 gene product) affects gene expression and is Meluh, P. B., and M. D. Rose, 1990 KAR3, a kinesin-related generequired for yeast nuclear fusion. Cell 60: 1029–1041.require for ivability in the yeast Saccharomyces cerevisiae. Mol. Cell.

Biol. 12: 1879–1892. Mercado, J. J., and J. M. Gancedo, 1992 Regulatory regions in theyeast FBP1 and PCK1 genes. FEBS Lett. 311: 110–114.de Barros Lopes, M., J. Y. Ho and S. I. Reed, 1990 Mutations in cell

division cycle genes CDC36 and CDC39 activate the Saccharomyces Myers, A. M., A. Tzagoloff, D. M. Kinney and C. J. Lusty, 1986Yeast shuttle and integrative vectors with multiple cloning sitescerevisiae mating pheromone response pathway. Mol. Cell. Biol.

10: 2966–2972. suitable for construction of lacZ fusions. Gene 45: 299–310.Neiman, A. M., F. Chang, K. Komachi and I. Herskowitz, 1990Dohlman, H. G., J. Song, D. Ma, W. E. Courchesne and J. Thorner,

1996 Sst2, a negative regulator of pheromone signaling in the CDC36 and CDC39 are negative elements in the signal transduc-tion pathway of yeast. Cell Reg. 1: 391–401.yeast Saccharomyces cerevisiae : expression, localization, genetic in-

teraction and physical association with Gpa1 (G protein alpha Niedenthal, R. K., L. Riles, M. Johnston and J. H. Hegemann, 1996Green fluorescent protein as a marker for gene expression andsubunit). Mol. Cell. Biol. 16: 5194–5209.

Doi, K., A. Gartner, G. Ammerer, B. Errede, H. Shinkawa et al., subcellular localization in budding yeast. Yeast 12: 773–786.Oehlen, L. J. W. M., and F. R. Cross, 1994 G1 cyclins Cln1 and1994 MSG5, a novel protein phosphatase promotes adaption to

pheromone response in S. cerevisiae. EMBO J. 13: 61–70. Cln2 repress the mating factor response pathway at Start in theyeast cell cycle. Genes Dev. 8: 1058–1070.Evans, R. M., and S. M. Hollenberg, 1988 Zinc fingers: gilt by

association. Cell 52: 1–3. Ozcan, S., and M. Johnston, 1996a Two different repressors collab-orate to restrict expression of the yeast glucose transporter genesFields, S., and I. Herskowitz, 1987 Regulation by the yeast mating-

type locus of STE12, a gene required for cell-type-specific expres- HXT2 and HXT4 to low levels of glucose. Mol. Cell. Biol. 16:5536–5545.sion. Mol. Cell. Biol. 7: 3818–3821.

Flick, J. S., and M. Johnston, 1990 Two systems of glucose repres- Ozcan, S., and M. Johnston, 1996b Rgt1p of Saccharomyces cerevisiae,a key regulator of glucose-induced genes, is both an activatorsion of the GAL1 promoter in Saccharomyces cerevisiae. Mol. Cell.

Biol. 10: 4757–4569. and a repressor of transcription. Mol. Cell. Biol. 16: 6419–6424.Reneke, J. E., K. J. Blumer, W. E. Courchesne and J. Thorner, 1988Greisman, H. A., and C. O. Pabo, 1997 A general strategy for select-

ing high-affinity zinc finger proteins for diverse DNA target sites. The carboxy-terminal segment of the yeast alpha-factor receptoris a regulatory domain. Cell 55: 221–234.Science 275: 657–661.

Grishin, A. V., J. L. Weiner and K. J. Blumer, 1994 Control of Rhodes, N., L. Connell and B. Errede, 1990 STE11 is a proteinkinase required for cell-type-specific transcription and signaladaptation to mating pheromone by G protein beta subunites of

Sacchraomyces cerevisiae. Genetics 138: 1081–1092. transduction in yeast. Genes Dev. 4: 1862–1874.Rose, M. D., P. Novick, J. H. Thomas, D. Botstein and G. R. Fink,Guarente, L., and E. Hoar, 1984 Upstream activation sites of the

CYC1 gene of Saccharomyces cerevisiae are active when inverted but 1987 A Saccharomyces cerevisiae genomic plasmid bank based ona centromere-containing shuttle vector. Gene 60: 237–243.not when placed downstream of the “TATA box.” Proc. Natl.

Acad. Sci. USA 81: 7860–7864. Rothstein, R., 1991 Targeting, disruption, replacement, and allelerescue: integrative DNA transformation in yeast. Meth. Enzymol.Guthrie, C., and G. R. Fink, 1991 Guide to Yeast Genetics and

Molecular Biology. Meth. Enzymol. 194: 1–933. 194: 281–301.Segall, J. E., 1993 Polarization of yeast cells in spatial gradients ofHill, J. E., A. M. Myers, T. J. Koerner and A. Tzagoloff, 1986

Yeast/E. coli shuttle vectors with multiple unique restriction sites. alpha mating factor. Proc. Natl. Acad. Sci. USA 90: 8332–8336.Sherman, F., 1991 Getting started with yeast. Meth. Enzymol. 194:Yeast 2: 163–167.

Irie, K., K. Yamaguchi, K. Kawase and K. Matsumoto, 1994 The 3–21.Sikorski, R. S., and P. Hieter, 1989 A system of shuttle vectors andyeast MOT2 gene encodes a putative zinc finger protein that

serves as a global negative regulator affecting expression of several yeast host strains designed for efficient manipulation of DNA inSaccharomyces cerevisiae. Genetics 122: 19–27.categories of genes, including mating-pheromone-responsive

genes. Mol. Cell. Biol. 14: 3150–3157. Singer, V. L., C. R. Wobbe and K. Struhl, 1990 A wide variety ofDNA sequences can functionally replace a yeast TATA elementJackson, C. L., J. B. Konopka and L. H. Hartwell, 1991 S. cerevisiae

alpha pheromone receptors activate a novel signal transduction for transcriptional activation. Genes Dev. 4: 636–645.Teague, M. A., D. T. Chaleff and B. Errede, 1986 Nucleotidepathway for mating partner discrimination. Cell 67: 389–402.

Jenness, D. D., and P. Spatrick, 1986 Down regulation of the alpha- sequence of the yeast regulatory gene STE7 predicts a proteinhomologous to protein kinases. Proc. Natl. Acad. Sci. USA 83:factor pheromone recpetor in S. cerevisiae. Cell 46: 345–353.

Keleher, C. A., M. J. Redd, J. Schultz, M. Carlson and A. D. 7371–7375.Tjian, R., and T. Maniatis, 1994 Transcriptional activation: a com-Johnson, 1992 Ssn6-Tup1 is a general repressor of transcription

in yeast. Cell 68: 709–719. plex puzzle with few easy pieces. Cell 77: 5–8.van Solingen, P., and J. B. van der Platt, 1977 Fusion of yeastKlug, A., and D. Rhodes, 1987 Zinc fingers: a novel protein fold

for nucleic acid recognition. Cold Spring Harbor Symp. Quant. spheroplasts. J. Bacteriol. 130: 946–947.Watson, N., M. E. Linder, K. M. Druey, J. H. Kehrl and K. J.Biol. 52: 473–482.

Leberer, E., D. Dignard, D. Harcus, M. Whiteway and D. Y. Blumer, 1996 RGS family members: GTPase-activating proteinsfor heterotrimeric G-protein alpha-subunites. Nature 383: 172–Thomas, 1994 Molecular characterization of SIG1, a Saccharo-

myces cerevisiae gene involved in negative regulation of G-protein- 175.Weiner, J. L., C. Guttierez-Steil and K. J. Blumer, 1993 Disrup-mediated signal transduction. EMBO J. 13: 3050–3064.

Ma, J., and M. Ptashne, 1987 A new class of yeast transcriptional tion of receptor-G protein coupling in yeast promotes the func-tion of an SST2-dependent adaptation pathway. J. Biol. Chem.activators. Cell 51: 113–119.

MacKay, V. L., S. K. Welch, M. Y. Insley, T. R. Manney, J. Holly 268: 8070–8077.Whiteway, M., L. Hougan, D. Dignard, D. Y. Thomas, L. Bell etet al., 1988 The Sacchraomyces cerevisiae BAR1 gene encodes an


al., 1989 The STE4 and STE18 genes of yeast encode potential Ptp2/Ptp3 and dual-specificity phosphatase Msg5 in Saccharomycesbeta and gamma subunits of the mating factor receptor-coupled cerevisiae. Genes Dev. 11: 1690–1702.G protein. Cell 56: 467–477.

Communicating editor: F. WinstonZhan, X. L., R. J. Deschenes and K. L. Guan, 1997 Differentialregulation of Fus3 MAP kinase by tyrosine-specific phosphatases

mot3, a zn finger transcription factor that modulates gene … · 1998. 5. 27. · mot3...

Documents