multiple functions of mfa-1, a putative pheromone ... · sitophila (fgsc 2216 and 2217), neurospora...

EUKARYOTIC CELL, Dec. 2002, p. 987–999 Vol. 1, No. 61535-9778/02/$04.00�0 DOI: 10.1128/EC.1.6.987–999.2002Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Multiple Functions of mfa-1, a Putative Pheromone Precursor Gene ofNeurospora crassa

Hyojeong Kim,1 Robert L. Metzenberg,2 and Mary Anne Nelson1*Department of Biology, The University of New Mexico, Albuquerque, New Mexico 87131,1 and Department of Biological Sciences,

Stanford University, Stanford, California 943052

Received 29 April 2002/Accepted 20 August 2002

A putative pheromone precursor gene of Neurospora crassa, mfa-1 (which encodes mating factor a-1), wasidentified as the most abundant clone in starved mycelial and perithecial cDNA libraries. Northern analysisdemonstrated high mfa-1 expression in all mating type a tissues and suggested low expression levels in mat Atissues. The mfa-1 gene was expressed as an approximately 1.2-kb transcript predicted to encode a 24-residuepeptide, followed by a long 3� untranslated region (3� UTR). The predicted MFA1 sequence showed 100%sequence identity to PPG2 of Sordaria macrospora and structural similarity (a carboxy-terminal CAAX motif)to many hydrophobic fungal pheromone precursors. Mutants with a disrupted open reading frame (ORF) inwhich the critical cysteine residue had been changed to a nonprenylatable residue, tyrosine (YAAX mutants),were isolated, as were mfa-1 mutants with intact ORFs but multiple mutations in the 3� noncoding region(CAAX mutants). The 3� UTR is required for the full range of mfa-1 gene activity. Both classes of mutantsshowed delayed and reduced vegetative growth (which was suppressed by supplementation with a minuteamount [30 �M] of ornithine, citrulline, or arginine), as well as aberrant sexual development. When crossedas female parents to wild-type males, the CAAX and YAAX mutants showed greatly reduced ascosporeproduction. No ascospores were produced in homozygous mfa-1 crosses. As males, YAAX mat a mutants wereunable to attract wild-type mat A trichogynes (female-specific hyphae) or to initiate sexual development, whileCAAX mat a mutants were able to mate and produce sexual progeny despite their inability to attract mat Atrichogynes. In the mat A background, both CAAX and YAAX mutants showed normal male fertility butdefective vegetative growth and aberrant female sexual development. Thus, the mfa-1 gene appears to havemultiple roles in N. crassa development: (i) it encodes a hydrophobic pheromone with a putative farnesylatedand carboxymethylated C-terminal cysteine residue, required by mat a to attract trichogynes of mat A; (ii) it isinvolved in female sexual development and ascospore production in both mating types; and (iii) it functions invegetative growth of both mating types.

In heterothallic fungi, mating occurs only between haploidcells of opposite mating types; the mating is initiated by cell-specific pheromone and receptor combinations (9, 36). Thespecific recognition launches a complex mitogen-activated pro-tein kinase (MAPK) cascade, the pheromone response path-way. To date, two types of pheromone precursor genes havebeen identified in the fungi; the MFa and MF� genes of Sac-charomyces cerevisiae are the best-studied examples (39). TheMFa gene encodes a short peptide with a C-terminal CAAXmotif (C � cysteine, A � aliphatic, and X � any amino acidresidue); the mature a-factor mating pheromone is highly hy-drophobic due to prenylation at the cysteine residue, which isalso carboxymethylated. The MF� gene encodes a precursorcontaining multiple repeats of a pheromone sequence bor-dered by Kex2 protease processing sites; the mature �-factor isunmodified and hydrophilic. These critical features of phero-mone precursor genes are conserved in other fungi.

Pheromone precursor genes have been identified through-out the fungal kingdom. In addition to S. cerevisiae, otherheterothallic ascomycetes also contain pheromone precursorgenes (19, 31, 58, 68), as do heterothallic basidiomycetes (4, 9,14, 42, 61), homobasidiomycetes (36, 46), and a homothallic

ascomycete (50). However, both classes of pheromone precur-sor genes have been identified in ascomycetes, while only oneclass of precursor genes (Mfa-like) has been identified in ba-sidiomycetes. The presence of pheromone precursor genes inhomothallic fungi suggests that their products may have func-tions beyond that of attracting a mate; this supposition hasbeen supported by recent studies. In some fungi, pheromonesplay a role in postfusion events as well as cell-cell recognitionand fusion. Specifically, pheromones have been implicated inthe induction of meiosis in Schizosaccharomyces pombe, stim-ulation of filamentous growth in Ustilago maydis, and internu-clear recognition in Schizophyllum commune and Podosporaanserina (18, 22, 61). The suggested requirement of phero-mones for postfertilization events such as karyogamy and mei-osis may explain the presence of pheromones in homothallicspecies (9, 22, 50).

Neurospora crassa, a heterothallic filamentous fungus withtwo mating types, mat a and mat A, undergoes more complexsexual development than do the yeasts (38). Under conditionsof nitrogen starvation, light, and low temperature N. crassaforms a spherical prefruiting body (protoperithecium) (48).This female reproductive structure extends a receptive hypha(trichogyne) toward a cell of the opposite mating type in aprocess mediated by pheromones (8). The trichogyne recruitsa single fertilizing (or male) nucleus; the fertilized protoperi-thecium then develops into a perithecium, or fruiting body,

* Corresponding author. Mailing address: Department of Biology,The University of New Mexico, Albuquerque, NM 87131. Phone: (505)277-2629. Fax: (505) 277-0304. E-mail: [email protected].

987

on January 29, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

http://ec.asm.org/

from which the haploid meiotic products (ascospores) areeventually ejected.

In this study, a pheromone precursor gene of N. crassa,mfa-1 (previously called poi-1 [for plenty of it]), was analyzedat the molecular and functional levels. The results showed thatthe mfa-1 gene encodes a pheromone belonging to the CAAXfamily of hydrophobic peptide pheromones, and that the pher-omone plays complex roles in N. crassa throughout sexualdevelopment (pre- and postfertilization) as well as in vegeta-tive growth.

MATERIALS AND METHODS

Neurospora strains and plasmids. The following N. crassa strains were used(where a refers to mat a and A refers to mat A): the wild-type 74 A (74-OR23-IVA [FGSC 2489]) and ORS a (FGSC 2490) strains and the mutant strains fl A(FGSC 4317), fl a (FGSC 4347), lys-1 inl A (FGSC 209), fmf-1 pyr-3 A (FGSC3108), qa-2 aro-9 inl al-2 a (RLM 63-01), Am44 (un-3 ad-3A nic-2 cyh-1 Am44

[FGSC 4570]) and am1 (ad-3B cyh-1 am1 [FGSC 4564]). A homothallic mat Aidiomorph Neurospora species, N. africana (FGSC 1740) was also used. (Strainswere from the Fungal Genetics Stock Center [FGSC], University of KansasMedical Center, Kansas City, and the laboratory of R. L. Metzenberg [RLM]).FGSC strains 4411, 4416, and 4450 through 4487 were also used to carry outrestriction fragment length polymorphism (RFLP) mapping.

A specialized plasmid, pMSN1 (43), containing the qa-2� gene of N. crassa,was used as a selective marker for transformants. The pGEM3zf(�) vector(Promega, Madison, Wis.) was used in subcloning an approximately 2.9-kb XhoIfragment of mfa-1� genomic DNA from a genomic cosmid clone (X23C8, theOrbach/Sachs pMOcosX library obtained from FGSC). The cosmid clone wasused in RFLP mapping and complementation experiments as well. cDNA clones(NP2A8, NP2B4, NP2B5, NP2A12, NM3F9, and NM4D3) from the NeurosporaGenome Project (44), containing the longest mfa-1 inserts, were used in se-quence analyses, gene disruption experiments, and Southern and Northern anal-yses.

Media and culture conditions. N. crassa cultures were maintained on solidVogel’s minimal medium N (66) with 1.5% sucrose plus any needed supple-ments. Strains were vegetatively grown either in liquid Vogel’s medium, on solidmedium in petri dishes (100 mm), or in race tubes (50 cm in length and 18 mmin diameter). All crosses were carried out on crossing medium containing 1%sucrose and any needed supplements (67). In growth of cultures for vegetativeand perithecial RNA isolation, conidia were inoculated at 106/ml and strainswere grown as described by Nelson and Metzenberg (43). For RNAs from matingconditions, strains were grown as floating mycelial mats on liquid crossing me-dium and incubated without agitation at 25°C in the light for 3 to 6 days. Forpreparation of perithecial RNAs, the fluffy strain fl a or fl A was grown oncrossing plates covered with sterile Miracloth circles (Calbiochem) and fertilizedwith a heavy conidial suspension of the opposite mating type, 74 A or ORS a,respectively. Either 7 or 9 days after fertilization, the perithecia were scrapedfrom the crossing plates, immediately frozen, and ground in liquid nitrogen,using a mortar and pestle. N. africana cultures were maintained on Vogel’s slantswith 1.5% sucrose. For preparation of N. africana perithecial RNAs, a freshculture was finely crushed using a sterile mortar and pestle, evenly spread oncrossing plates covered with sterile Miracloth circles, and grown for 7 or 9 days.The perithecia scraped from the plates were treated as described above.

DNA sequencing and sequence analyses. The cDNA and genomic mfa-1 se-quences were determined using the dideoxy chain termination method (55),using the Applied Biosystems (ABI) PRISM dye terminator kit (Perkin-Elmer)and the ABI model 377 DNA sequencer. To identify potential homologs, theDNA sequence of the mfa-1 gene and its derived protein sequence were com-pared with the DNA and protein databases available through the NationalCenter for Biotechnology Information, using the BLAST algorithms (1, 2). Themfa-1 sequences were also analyzed using the DNAsis software package. Puta-tive components of the pheromone response MAPK pathway were identified byanalysis of the nearly complete N. crassa genome sequence available from theWhitehead Institute Center for Genome Research (http://www-genome.wi.mit.edu/annotation/fungi/neurospora/).

Preparation of genomic DNA and RNA. Genomic N. crassa DNA was isolatedas described previously (63). Total RNA was isolated using the PURESCRIPTRNA isolation kit (Gentra Systems, Minneapolis, Minn.), per the manufacturer’sinstructions.

Northern and Southern hybridization blots. Northern and Southern blot pro-cedures were performed as described previously (54). The constitutively ex-pressed glutamate dehydrogenase (am) gene (34) was used as a control in allNorthern blots. Probes were prepared using the random priming method (25),with the Pharmacia Biotech oligolabeling kit.

Heterologous Southern hybridizations (zoo blots). In order to identify poten-tial mfa-1 homologs in other fungi, low-stringency hybridization was performed.The ascomycetes used in the zoo blots were as follows: Gelasinospora reticulo-spora (FGSC 960), Gelasinospora tetrasperma (FGSC 966), Neurospora tetra-sperma (FGSC 1270 and 1271), N. africana (FGSC 1740), Neurospora galapago-sensis (FGSC 1739), Neurospora intermedia (FGSC 2316 and 1940), Neurosporasitophila (FGSC 2216 and 2217), Neurospora terricola (FGSC 1889), Sordariafimicola (FGSC 2918), Sordaria macrospora (FGSC 4818), and Anixiella subline-olata (FGSC 5508). The N. crassa 74 A strain was included as a positive control.Genomic DNAs from the various fungal species were digested with XhoI, elec-trophoresed in 0.9% agarose gels, and then transferred to nylon membranes. Theblots were probed overnight at 55°C and washed at low stringency (two 15-minwashes in 2� SSC [1� SSC is 0.15 M NaCl plus 0.015 M sodium citrate] at roomtemperature, followed by two 20-min washes at 50°C). These blots allowed thedetection of sequences showing at least 55 to 65% nucleotide sequence identity(10).

RFLP mapping of the mfa-1 gene. The map location of a cosmid encodingmfa-1 was determined using the RFLP technique (41, 45). This method usesRFLPs as genetic markers and examines the ordered progeny from a cross of amultiply marked laboratory strain (multicent-2 a, in Oak Ridge genetic back-ground) with a wild-collected strain (Mauriceville-1c A). For this analysis, thecosmid encoding mfa-1 was linearized with a restriction enzyme, labeled, andhybridized with Southern blots of digested genomic DNAs from the mappingstrains.

Gene disruption experiments (repeat-induced point [RIP] mutation method).The pMSN1 plasmid and mfa-1 cDNA were cotransformed into freshly har-vested conidia of the qa-2 aro-9 inl al-2 a (RLM 63-01) strain via electroporation(15). The qa-2� transformants were selected based on their ability to growwithout the aromatic amino acid supplement required by qa-2 aro-9 double-mutant strains. Single-colony isolates of the primary transformants were judgedto be homokaryotic if they failed to produce conidia requiring the aromaticamino acid supplement (43). Transformants containing only two copies of mfa-1(an endogenous mfa-1� and one extra copy introduced by transformation) wereidentified by Southern hybridization. The selected transformants were thencrossed with lys-1 inl A (FGSC 209), which has an auxotrophic mutation (lys-1)mapping near the mfa-1 gene and contains no duplicated mfa-1 sequences. Theprogeny of these crosses were plated on medium lacking the lysine required bythe auxotrophic normal sequence strain, consequently enriching for progenycontaining the potentially disrupted mfa-1 gene (43).

Sequence analysis of mfa-1 mutants. The sequences of meiotic progeny withputative disrupted mfa-1 genes were examined. A 2.5-kbp fragment including theendogenous mfa-1 gene of selected progeny was amplified by PCR. Approxi-mately 0.5 �g of genomic DNA was amplified with primers 1 and 2 (5� TGAGAGAATAGGATAGCCCG 3� and 5� ACCTAACCTGGCCGAAACAG 3�).The PCR product was verified by agarose gel electrophoresis, purified using theQIAquick spin PCR purification kit (Qiagen), and sequenced using nested prim-ers 3, 4, 5, and 6 (5� TAAGAACGTCCGTCTCCTCC 3�, 5� GTCTTACGAAGAGGCATACG 3�, 5� GGGAAACGATGCACAACTTC 3�, and 5� AAGGAAGATCCTCACCGCTC 3�, respectively) with the ABI PRISM dye terminator kit(Perkin-Elmer) and ABI model 377 DNA sequencer. Primers 1 to 4 were de-signed from the flanking sequences of the mfa-1 gene, and primers 5 and 6 werefrom the mfa-1 cDNA sequence. The mfa-1 sequences were compared with thewild-type mfa-1 sequence to identify specific mutations.

Linear growth tests. Growth rates of the mfa-1 mutant strains were tested onminimal, complex (supplemented with 0.5% yeast extract), and low-nitrogen(Westergaard) media at either 25 or 30°C, using race tubes (21).

Fertility tests. To examine the role of the mfa-1 gene in sexual development,mfa-1 mutant strains were crossed to wild type as either the female (protoperi-thecial) or male (fertilizing) parent to detect dominant mating-specific defects(43). When used as a male, a small drop of mfa-1 conidial suspension was spottedonto fluffy (fl A and fl a) strains grown on plates with crossing medium. The fluffymutants feature high fertility and the inability to produce macroconidia (40).These crosses also served to identify the mating type of the mutants, as peritheciawere formed on the fl A or the fl a plates. When used as females, the mutantswere grown in crossing slants and fertilized with conidia of the opposite matingtype. The mfa-1 strains were crossed to sibling strains to detect recessive muta-tions affecting sexual development (43).

988 KIM ET AL. EUKARYOT. CELL


.org/D

ownloaded from

http://ec.asm.org/

Mating response tests. Attraction between trichogynes of one mating type andconidia of the opposite mating type was assayed to investigate pheromone func-tion in the mfa-1 mutants. An agar strip covered by dense growth of fl a or fl Awas placed next to a 2% agar strip, and a heavy suspension of wild-type or mfa-1conidia was streaked on the 2% agar approximately 5 mm from the fluffy strain.Mating responses were monitored to determine if the conidia could stimulate thedirected growth of trichogynes at this distance and to localize the sites of peri-thecial production.

Complementation of the mfa-1 defect. Transformation of an mfa-1 YAAX mata mutant with genomic mfa-1� DNA (X23C8 genomic cosmid clone) was carriedout via electroporation (15). Freshly harvested conidia of a YAAX mat a mutantwere transformed with the genomic cosmid clone containing the mfa-1� gene inthe pMOcosX vector (obtained from the FGSC). The pMOcosX vector containsan ampicillin resistance gene as a selective marker in Escherichia coli and ahygromycin B resistance gene (Hyr) as a selective marker in N. crassa (47).Transformants were selected based on their resistance to the fungicide hygro-mycin B (220 �g/ml) and tested for complementation of vegetative and sexualdefects of the mfa-1 mutant.

RESULTS

Representation of the mfa-1 cDNA in cDNA libraries. Themfa-1 gene was identified by the Neurospora Genome Project

at the University of New Mexico as the gene that is the mosthighly expressed under starved conditions (44). In the project,three cDNA libraries were initially constructed using mRNAisolated from conidial (germinating asexual spores), starvedmycelial (branching hyphae), and perithecial (fruiting body)tissues (44). An additional cDNA library, the Westergaardlibrary, was subsequently constructed to represent unfertilizedsexual or protoperithecial tissue (24). More recently, two“time-of-day-specific” cDNA libraries (morning and eveninglibraries) were constructed and analyzed to address the expres-sion of genes in mycelial tissues of N. crassa over the course ofthe circadian day (69). The four developmental cycle-specificcDNA libraries were constructed using RNAs extracted fromthe mat A wild-type strain 74 A (24, 44), and the two time-of-day-specific cDNA libraries were constructed using RNAsfrom selected circadian rhythm cycle mutant strains in a mat abackground (bd; a and bd; a; frq7 [69]).

Analysis of the unsubtracted libraries showed that mfa-1clones account for 4.6% of the starved mycelial library (43 of

FIG. 1. Genomic nucleotide and predicted amino acid sequences of the putative N. crassa pheromone precursor gene, mfa-1. The potentialTATA box is noted. The 5� end of the longest cDNAs and the polyadenylation sites are underlined in boldface type; the site of polyadenylationwas identical in all mfa-1 cDNA clones. A good consensus ATG start site is highlighted, and the translation termination codon is indicated by anasterisk. The deduced amino acids are shown above the sequence of the coding region. The prenylation signal (CAAX) is underlined.

VOL. 1, 2002 MULTIPLE FUNCTIONS OF THE NEUROSPORA mfa-1 GENE 989


.org/D

ownloaded from

http://ec.asm.org/

937 isolates) and 5.5% of the perithecial library (121 of 2,196isolates), both of which represent starved conditions. NeithercDNA has been identified in the conidial, Westergaard, ormorning or evening libraries.

Sequence analyses. Selected mfa-1 cDNA inserts and sub-cloned genomic mfa-1 DNA were sequenced. The genomicmfa-1 sequence and the derived amino acid sequence of theMFA1 protein are shown in Fig. 1. The mfa-1 gene encodes atranscript of approximately 1.2 kb, as deduced by the longestcDNA sequences; it is not interrupted by an intron. A potentialTATA box in the promoter region of the mfa-1 gene is notedin Fig. 1. A good Kozak sequence (37) for the initiation oftranslation is present at the proposed mfa-1 start codon (initalics): ATCAACATG. The 24 codon mfa-1 open readingframe (ORF) shows typical Neurospora codon bias (52).

The mfa-1 mRNA has two unusual features: (i) it is mostly

noncoding and (ii) it has an unusual predicted secondary struc-ture. The predicted 24-residue ORF begins with an AUG atposition 53 and ends with a UAA codon at position 125 in the1.2-kb transcript, resulting in a 3� untranslated region (3�UTR) of more than 1 kb. The predicted mfa-1 mRNA second-ary structure, obtained using the Vienna-RNA-Package-1.3(with help from Peter Stadler at the University of Vienna,Vienna, Austria) (29, 30) is shown in Fig. 2. The long stablehairpins are atypical of mRNA (P. Stadler, personal commu-nication).

To identify potential mfa-1 homologs, the DNA sequenceswere compared with the NCBI nucleotide and protein data-bases, using BLASTN and BLASTX, respectively. The proteinsequences from putative ORFs were compared with the NCBIprotein database (using BLASTP and PSI-BLAST). The re-sults of these sequence analyses showed more than 80% se-

FIG. 2. Predicted secondary structure of mRNA of the mfa-1� (wild type), mfa-1(1), and mfa-1(9) alleles. The mfa-1(1) strain is a CAAXmutant (with an intact ORF), and mfa-1(9) is a YAAX strain (with a mutated ORF). Vienna-RNA-Package-1.3 was used with parameters for 37°C(29, 30). Courtesy of Peter Stadler at the University of Vienna.



.org/D

ownloaded from

http://ec.asm.org/

quence identity with the ppg2 gene of S. macrospora (50) and100% nucleotide identity within its predicted coding region.No other significant homologies were observed. An unusuallylong 3� UTR is also present in some other fungal pheromoneprecursor genes, including MF1-1 of Magnaporthe grisea, mfa2of Ustilago hordei, and ppg2 of S. macrospora (4, 50, 58).

The predicted MFA1 protein contained a CAAX motif at itscarboxy terminus that is common in fungal hydrophobic pher-omone precursors (Fig. 3). In characterized mature pheromones,the C-terminal cysteine is prenylated and carboxymethylatedduring posttranslational processing; these modifications areessential for their biological activity (12, 19, 35, 61).

Presence of mfa-1 homologs in other filamentous ascomyce-tes. Heterologous hybridizations of the mfa-1 probe with di-gested ascomycete genomic DNAs showed that there is a singlecopy of the mfa-1 gene in the N. crassa genome, and that manyother Neurospora species and their closely related ascomycetespecies also have an mfa-1 homolog in their genomes (Fig. 4).Striking homogeneity (or constancy) was observed within Neu-rospora species, in that bands of the same size were recognizedin both mating types of N. tetrasperma and N. sitophila. How-ever, in N. intermedia, fragments containing the mfa-1 homologwere of different sizes in the mat A (FGSC 2316) and mat a(FGSC 1940) strains; although both strains were isolated fromFlorida (Clewiston and LaBelle, respectively) on the same day,they are thought to be of independent genetic background(David Perkins, personal communication). Interestingly, themfa-1 pheromone precursor gene was maintained in the truehomothallic species G. reticulospora, N. africana, N. galapago-sensis, S. fimicola, S. macrospora, and A. sublineolata.

Mapping of mfa-1. To determine whether mfa-1 represents anewly identified gene or one previously characterized, thechromosomal location of mfa-1 was determined using theRFLP method (41, 45). The mfa-1 gene was mapped to theright arm of linkage group V, with an RFLP pattern identicalto that of cyh-2, sod-2, and vma-1. The region did not includeany previously identified sexual developmental mutants (49).

Expression of the mfa-1 gene. The mfa-1 cDNA was themost abundant clone in starved mycelial and perithecial cDNAlibraries of N. crassa (as discussed above). Northern analysiswas carried out to examine the expression of mfa-1 in otherconditions. A forced heterokaryon containing both the mat aand mat A loci was used to mimic mating conditions (43). Also,since protoperithecia form efficiently only on the surface, onlythe stationary cultures (floating mycelial mats) grown on cross-ing medium would be expected to contain significant levels oftranscripts specific to sexual development. Expression in theAm44 sterile mutant (56), the fmf-1 (for female and male fer-tility-1) mutant (33), and the sterile am1 mutant (27) was alsoexamined.

Northern analysis showed high levels of mfa-1 expression inthe heterokaryotic (mat a/mat A) strain grown under nitrogenstarvation conditions (Fig. 5A, lane 2) and in vegetative andsexual tissues of the wild-type mat a strain (Fig. 5B, lanes 2 to4 and Fig. 5C, lane 1). In the wild-type ORS a strain, mfa-1expression in unfertilized sexual tissue (protoperithecia, Fig.5B, lane 4) was higher than that in exponentially growingvegetative tissue (Fig. 5B, lane 3) but similar to that in germi-nating conidia (Fig. 5B, lane 2). Interestingly, while the mfa-1mRNA was abundant in protoperithecia, its level was greatly

FIG. 3. Derived amino acid sequences of the MFA1 pheromone precursor from N. crassa (Nc) and its homologs in other fungal species: S.macrospora (Sm) (50), S. cerevisiae (Sc) (12), S. pombe (Sp) (19), C. parasitica (Cp) (68), M. grisea (Mg) (58), U. maydis (Um) (61), and U. hordei(Uh) (4). The CAAX motifs are indicated in boldface type, and the known mature pheromone sequences are underlined.



.org/D

ownloaded from

http://ec.asm.org/

increased in 7-day-old perithecia and even more so in 9-day-old perithecia (Fig. 5B, lanes 5 and 6, respectively). No expres-sion was detected in the mat am1 sterile mutant (Fig. 5B, lane1) (27), and little or no expression was observed in the wild-type mat A strain (Fig. 5A, lane 6, and Fig. 5C, lane 2). How-ever, the expression of the mfa-1 homolog was high in sexualtissues of the true homothallic species N. africana, which con-tains only the mat A idiomorph (Fig. 5C, lane 4) (26).

The mat a locus of N. crassa contains a single gene, mat a-1,that encodes a putative transcriptional regulator (62). TheMATa1 protein contains the high mobility group DNA bindingdomain (32) and is thought to regulate expression of genesrequired for mating interactions, including the production ofpheromones (59). This protein specifically binds CAAAG se-quences in DNA (38), as do other high mobility group boxproteins such as STE11 of S. pombe and Prf1 of U. maydis (28,64). The mfa-1 gene contains the CAAAG sequence in itspromoter region (from position 9 to position 13 in Fig. 1),suggesting that it may be directly controlled by MATa1.

Isolation of mfa-1 mutants. Mutants with disrupted or intactmfa-1 coding regions were isolated by the RIP mutation ap-proach (13, 57). A transformant containing two copies of themfa-1 gene (the endogenous copy plus one extra copy intro-duced by transformation) was crossed with a strain having anauxotrophic mutation (lys-1) near the mfa-1 gene. The progenyof the crosses were plated on medium lacking lysine supple-ment in order to enrich for progeny in which this region wasinherited from the transformed strain, with potential disrup-tions of the endogenous mfa-1 gene. Seven potential mfa-1mutants were initially recognized based on their extremelypoor vegetative growth, and their mfa-1 alleles were examinedfor the presence of typical RIP mutations (GC-to-AT transi-

tions). One mutant allele containing 33 typical RIP-generatedtransitions, all 3� to the coding region, was identified and des-ignated mfa-1(1) a [where (1) a indicates allele 1, mat a]. Sincemfa-1 mutants with disrupted ORFs were desired, the mfa-1(1)a strain (still containing the ectopic copy of mfa-1) was used asthe male parent in a second RIP cross. Eight more mfa-1mutants, in strains of both mating types, were isolated from thesecond RIP cross; they were designated mfa-1(2) through mfa-1(9). Subsequently, the mfa-1(9) mutant (which contained theectopic copy of mfa-1 and was mat a) was used for a thirdround of RIP, and nine additional mutants were isolated [mfa-1(10) through mfa-1(18)].

Analysis of mfa-1 mutant sequences. The nucleotide se-quence of the mfa-1 gene was determined for all 18 mutantstrains, and two distinct classes of mfa-1 mutants were identi-fied. CAAX mutants [e.g., mfa-1(1)] had intact ORFs but mul-tiple mutations in the 3� UTRs (Fig. 6). In YAAX mutants[e.g., mfa-1(9)], the critical cysteine of the CAAX motif waschanged to tyrosine, and additional mutations were present inthe 3� UTRs. The initial CAAX isolate, mfa-1(1), had 33 tran-sitions (32 G3A transitions and 1 C3T transition) on thesense strand, suggesting that more than one round of RIP hadoccurred (13). Mutants mfa-1(2) through mfa-1(18) were gen-erated from the second and third round of RIP crosses, and allhad additional transition mutations, ranging from a total of 83to more than 200. The first YAAX isolate, mfa-1(9) a, was aprogeny of mfa-1(1) a and had 147 transitions (67 G3A and80 C3T); this allele had the initial 33 transitions plus 6 addi-tional transitions within the ORF, as well as 108 additionaltransitions in the 3� UTR (Fig. 6). A progeny of mfa-1(9) a,mfa-1(10) A, contained 155 transitions (68 G3A and 87

FIG. 4. Zoo blot probed with mfa-1. (A) N. crassa (2489); (B) G. reticulospora (960); (C) G. tetrasperma (966); (D and E) N. tetrasperma (1270and 1271); (F) N. africana (1740); (G) N. galapagosensis (1739); (H and I) N. intermedia (2316 and 1940); (J and K) N. sitophila (2216 and 2217);(L) N. terricola (1889); (M) S. fimicola (2918); (N) S. macrospora (4818); (O) A. sublineolata (5508). Numbers in parentheses indicate the FGSCstrain number.



.org/D

ownloaded from

http://ec.asm.org/

C3T), corresponding to the original 147 transitions present inmfa-1(9) a, as well as 8 new transition mutations.

Eight mfa-1 mutants, mfa-1(1) a through mfa-1(8) A, had anintact ORF of 24 codons (CAAX mutants). The 10 additionalisolates [mfa-1(9) a and its progeny] had six identical transi-tions within the coding region, among which one at position114 in the cDNA sequence (TGC to TAC) changed the essen-tial cysteine residue of the CAAX motif to a presumably non-functional tyrosine residue (Fig. 6). Thus, CAAX mutantsmight be hypomorphs (partially functional), while YAAXstrains would be expected to be null mutants.

Characterization of mfa-1 mutant phenotypes. (i) Vegetativegrowth. Both CAAX and YAAX mfa-1 mutants showed de-layed germination and reduced vegetative growth on Vogel’sminimal medium. At 25 or 30°C, linear growth rates were threeto four times lower than that of the wild type; growth wasslightly improved at 37°C. When supplemented with 0.5%yeast extract, the mutants showed growth rates similar to thatof wild type. Individual components of yeast extract weretested, and it was determined that supplementation with orni-thine, citrulline, or arginine suppressed the mfa-1 growth de-fect, while addition of lysine reduced the growth rate. A minuteamount (�30 �M) of ornithine, citrulline, or arginine wassufficient to suppress the mfa-1 growth defect, while muchhigher levels (e.g., 5 mM) are required to supplement typicalarginine auxotrophs, such as arg-1 (49). The arginine analogsN-omega-nitro-L-arginine methyl ester and L-canavanine didnot differentially affect the growth of wild-type and mfa-1strains (not shown).

(ii) Sexual development and the mating response. Fertilityof the mfa-1 mutants was examined. Female fertility was de-layed and drastically reduced to approximately the same de-gree in CAAX and YAAX mfa-1 mutants crossed to wild type,irrespective of their mating type. However, male fertility variedgreatly, depending both on the presence of the critical CAAXmotif and the mating type of the mutants. For CAAX a, resultswere almost normal if the mutant was spotted directly on thefemale; no trichogyne attraction was observed if spotted at adistance. For YAAX a, males were sterile and rarely fertilized;if the males did fertilize, sexual development aborted veryearly. For CAAX A or YAAX A, male fertility was normal,with trichogyne attraction like that of the wild type.

Under the standard low-nitrogen conditions, protoperithe-cial development was delayed and the number of protoperi-thecia was reduced approximately 1,000-fold in all mfa-1 mu-tants. In crosses of mutants acting as females to wild typesacting as males, the fertilized protoperithecia developed toperithecia after a delay of a day or two. The perithecia weresmaller than those of wild-type crosses, yet a small number ofviable ascospores was produced. Germination of the asco-spores from crosses of mfa-1 acting as female by wild typesacting as male was no higher than 30%, while the correspond-ing number from homozygous wild-type crosses was 95 to 99%.

In crosses of mfa-1 mutants of mating type A acting as maleto wild-type or fluffy strains acting as female, the mutants (bothCAAX A and YAAX A) attracted distant trichogynes (�5 mmaway), perithecia were formed without a delay along the bor-der of the fl a strain, and these produced fertile ascospores(Fig. 7). However, in crosses of mutants of mating type a actingas males (CAAX a and YAAX a), both mutants failed toattract trichogynes. CAAX mutants were able to mate andundergo sexual development, but only if they were placeddirectly onto the wild-type female or only after the wild-typefemale had grown over the streak of CAAX a conidia (Fig. 7),whereas YAAX mutants of mating type a (YAAX a) wereunable to either attract or mate with fl A trichogynes, althoughoccasionally a few perithecia were formed when 74 A waspresented as the female.

Complementation of a YAAX a mutant by transformationwith genomic mfa-1� was tested. A male-sterile (YAAX a)strain, mfa-1(18) a, was transformed with a genomic mfa-1�

FIG. 5. Expression of the mfa-1gene and the constitutively ex-pressed am (glutamate dehydrogenase) gene. (A) Expression of mfa-1in mat A strains and mat a/mat A heterokaryons. RNAs in lanes 1, 2,and 3 were prepared from a mat a tol/mat A tol heterokaryon, andRNAs in lanes 4, 5, and 6, were from Am44, fmf-1 mat A, and 74 A (wildtype), respectively. The strains were grown with or without agitationunder these conditions: with shaking in vegetative medium (lane 1),with shaking in crossing medium (lane 2), and without agitation incrossing medium (lanes 3 to 6). (B) Expression of mfa-1 in mat astrains and in perithecia. RNA in lane 1 was prepared from the sterileam1 mutant, grown with agitation in vegetative medium for 14 h. RNAsin lanes 2 to 4 were prepared from ORS a (wild type), grown underthese conditions: with agitation in vegetative medium for 5 h (lane 2),with agitation in vegetative medium for 14 h (lane 3), and withoutagitation in crossing medium for 5 days (lane 4). RNAs in lanes 5 and6 were prepared from a cross of fl a with 74 A, prepared from peri-thecia harvested 7 days (lane 5) or 9 days (lane 6) after fertilization.Ethidium bromide staining of the separated rRNA is shown. (C) Ex-pression of mfa-1 in sexual tissues of N. crassa (lanes 1 and 2) and N.africana (lanes 3 and 4). RNAs in lanes 1 and 2 were prepared from theN. crassa ORS a and 74 A wild-type strains, respectively, grown withoutagitation in crossing medium for 5 days. RNAs in lanes 3 and 4 wereprepared from N. africana grown without agitation in crossing mediumfor 3 or 5 days, respectively.



.org/D

ownloaded from

http://ec.asm.org/

FIG. 6. Sequence comparison of mfa-1� (wild type) and the mfa-1(1), mfa-1(9), and mfa-1(10) alleles. The wild-type sequence is shown, andthe changes in the mfa-1 mutants are noted below (dashes indicate identical nucleotides). The highlighted region indicates the putative ORF withits initiation and termination codons underlined; the asterisk indicates the polyadenylation site.



.org/D

ownloaded from

http://ec.asm.org/

clone, and 100 transformants were selected based on theirhygromycin resistance. Fertility and mating responses wereassayed as described above, and 30 transformants with com-plementing mfa-1� genes were identified. Southern analysisverified acquisition of the mfa-1� DNA (not shown). Thetransformants, used as male parents, were able to attract andmate with fl A strains, and ascospores were produced. Whilethe male sexual defects were fully reversed, the vegetativedefects were not suppressed by the complementation; perhapsa higher level of mfa-1� activity is required for normal vege-tative growth than is needed by the male parent in the sexualcycle. When CAAX a, CAAX A, or YAAX A mutants wereused as male parents to fertilize CAAX or YAAX mutants ofthe opposite mating type, a few perithecia developed aftersome delay. However, development in those perithecia abortedat an early stage before ascogenous hyphae developed, result-ing in very small, empty perithecia that never formed beaks orproduced ascospores. When the YAAX a mutant was used asthe male parent to fertilize CAAX A or YAAX A strains, thecrosses were sterile; on those rare occasions when fertilizationoccurred, sexual development ceased very early.

DISCUSSION

mfa-1 is a gene encoding the precursor of a presumptivehydrophobic hormone. Sequence analysis of the mfa-1 geneshowed 100% sequence identity with a pheromone precursorgene, ppg2, of S. macrospora (50), which encodes a 24-amino-acid S. cerevisiae a-factor-like peptide pheromone (3). In S.

cerevisiae, a-factor precursors undergo complex amino- andcarboxy-terminal posttranslational processing (20): S-farnesy-lation at the cysteine residue by Ram2p and Ram1p (farnesyl-transferase � and �, respectively), proteolysis of AAX residuesby Rce1p (or Afc1p; AAX protease), carboxymethylation ofthe exposed cysteine by Ste14p (methyltransferase), and two-step proteolysis of the amino terminus by Ste24p (aminopep-tidase 1) and Axl1p or Ste23p (both aminopeptidase 2). Themature pheromone is exported directly across the membranevia Ste6p, an ATP-dependent transporter. BLAST searchesthrough NCBI and the Whitehead Institute Center for Ge-nome Research indicated that the N. crassa genome containshomologs of all known genes for the processing and transportof the budding yeast a-pheromone (Table 1).

The mfa-1 gene has multiple roles in sexual development. Inheterothallic fungi, pheromones play an important role in mat-ing by facilitating recognition between strains of opposite mat-ing type and by launching the complex pheromone responseMAPK pathway. Recent studies have suggested that fungalpheromones are required for postfertilization events as well,such as internuclear recognition for karyogamy and/or meiosis(9, 22, 50). Even though it is homothallic, S. macrospora con-tains the mfa-1 homolog ppg2 and expresses it in perithecia athigh levels which peak around the time ascospores are matur-ing and being ejected (50). Also, mfa-1 (or its homolog) istranscribed in sexual tissues of the homothallic N. africana,which does not contain the mat a sequence (Fig. 5C).

In order to analyze the function(s) of the pheromone pre-

FIG. 6—Continued.



.org/D

ownloaded from

http://ec.asm.org/

cursor gene of N. crassa, apparent null mutants (YAAX, inwhich the essential cysteine residue was changed to tyrosine)and hypomorphs (CAAX, with an intact ORF but multiplemutations in the 3� UTR) were isolated. The developmentallyregulated expression of mfa-1 and the pleiotropic nature ofmfa-1 mutants suggest that mfa-1 has multiple functions in thedevelopment of N. crassa, expanding the range of known pher-omone functions. While normal levels of mfa-1 mRNA weredetected in a CAAX a strain, no expression was detected in aYAAX a strain (not shown).

YAAX mutant strains of mating type a, used as males, wereunable to attract and to mate with mat A trichogynes, whichsuggests that the cysteine residue is absolutely essential forprenylation and therefore for the pheromone function ofmfa-1, as shown for other CAAX pheromones of fungi. S.cerevisiae a-factor lacking the farnesyl group shows 1,000-foldreduced pheromone activity (12). In U. maydis, unfarnesylatedanalogs of Uhmfa1 and Uhmfa2 are inactive, while farnesy-lated analogs of modified amino acid sequence do induce mat-ing with cells of opposite mating type (35).

Pheromones in fungi have been considered mating type-specific. Based on Northern analysis of RNA from well-nour-ished vegetative cells, the expression of mfa-1 appeared to bemating type a specific; that is, it required the presence of themat a gene (Fig. 5B). Paradoxically, the unsubtracted cDNAlibrary from starved mycelia of mat A wild type containedmfa-1 as the most abundant clone (4.6% to date) (44). Inaddition, the mfa-1 gene or its homolog was highly expressed insexual tissues of homothallic N. africana, which contains onlythe mat A idiomorph (Fig. 5C) (26). This species has no needto attract or be attracted to a mate, and it makes no trichogy-nes. These results show that mfa-1 is expressed, possibly at aspecific time(s) of development, in mat A strains of Neurosporaand suggest that mfa-1 has at least one important function inaddition to that of promoting fertilization. Furthermore, theseverely reduced fertility of mfa-1 mutants and the extremelyhigh accumulation of mfa-1 mRNA in maturing perithecia(Fig. 5B, lanes 5 and 6) suggest that mfa-1 is required evenafter karyogamy and/or meiosis in the sexual development ofN. crassa. Also, it was recently shown that expression of theprobable pheromone receptor genes of N. crassa is not matingtype specific (51).

Possible conglutinin-like role for MFA1. One hypothesispostulates an additional role for MFA1 in “conglutination” inperithecial development, or the cementing together of hyphaeto stabilize the sclerotial structure of the maturing perithe-cium. This would require prenylation and could involve a sec-ond peptide (longer or shorter). An analogous situation mayoccur in S. cerevisiae, where a second peptide (a-factor relatedpeptide) is produced from the pro-a-factor (17). In Neuro-spora, the pheromone-like peptide, provisionally named con-glutinin, would interact with the normal pheromone receptorto constitute the “glue” that holds together a perithecium. Theconglutinin function would require that mfa-1 and the geneencoding the receptor both be expressed in female supportingtissue of the perithecium, whether that tissue is mat a or mat A.We suggest that when the female tissue is mat A, synthesis ofthe conglutinin is triggered by the processed pheromone fromthe mat a male, and that the regulation is positive and autog-enous. Thus, adjacent hyphae would stick together, since eachwould be coated with conglutinin and receptor, with both pro-teins being anchored in the plasma membrane. Presumably thecell walls of adjacent hyphae would have been resorbed at thesurfaces of contact, as has long been known to occur duringfusion of vegetatively growing hyphae (11).

The conglutinin hypothesis would account for these obser-vations: (i) the extremely high level of mfa-1 mRNA in normalperithecial tissue, (ii) the highly abnormal perithecial develop-

FIG. 7. Pheromone responses. Conidia of wild-type, mfa-1 CAAXa, YAAX a, and a YAAX a/mfa-1� transformant (A) and CAAX Aand YAAX A (B) were placed on 2% agar in close proximity to an flfemale of opposite mating type (at center). (A) Many peritheciaformed along the fl A border when ORS a or YAAX a/mfa-1� wasstreaked a slight distance away. Few perithecia formed when the fer-tilizing parent was CAAX a, and those formed only after the fl A strainhad grown over the streak of CAAX conidia. No perithecia formedwhen YAAX a was the male parent. (B) No defective mating responsewas observed when mfa-1 mat A strains were used as males.



.org/D

ownloaded from

http://ec.asm.org/

ment or absence thereof in homozygous mfa-1 crosses (if fer-tilization occurred at all, the sclerotial tissue would still becompletely deficient in conglutinin, so perithecia would fail todevelop), and (iii) the severely deficient sexual development inspecific heterozygous crosses. The crosses of mfa-1 mutants asmales to wild-type strains as females could be explained asfollows. In crosses of mat A as males (CAAX A or YAAX A)to wild-type mat a strains as females, attraction and fertilitywould be normal, since the mat A pheromone is presumablynormal and the wild-type mat a female would produce normalconglutinin. In crosses with a CAAX mat a strain as male,fertilization would be an uncertain matter. If a molecule ofproduct from the hypomorphic gene somehow got the processstarted, then the mat A, as female, would transcribe its normalmfa-1 gene, produce MFA1, process it to pheromone (or con-glutinin), and induce synthesis of more MFA1, with the resultthat the cross would be fertile. In crosses of YAAX a acting asmales to wild-type mat A as females, the male would be unableto attract and fuse with trichogynes. In the rare event thatfertilization were nevertheless to occur, the wild-type femalewould not be triggered to initiate synthesis of the MFA1 con-glutinin, with the result that the cross would be completelyinfertile. Finally, in crosses of CAAX or YAAX mutants actingas females to wild type as males, all female parents would behypomorphic (CAAX) or null (YAAX) in the capacity to makeMFA1, and thus little or no sexual development would beexpected.

mfa-1 may be involved in filamentous growth. In S. cerevi-siae, six different MAPK pathways have been identified, whichare involved in distinct physiological processes including mat-ing, spore formation, cell wall biosynthesis, and sensing of

hyperosmotic environments. Due to the high specificity of theconstituent protein kinases in their recognition of substrates,and to regulation at multiple levels, normally no significantfunctional crossover of kinases occurs in the MAPK pathways.Nevertheless, some components of the pheromone responseMAPK cascade for mating are known to be shared by threeother MAPK cascades, those controlling filamentous growth,cell wall integrity, and osmolyte synthesis (53). In particular,the fundamental elements of the pheromone response path-way—Ste20p (MAPK kinase kinase kinase), Ste11p (MAPKkinase kinase), Ste7p (MAPK kinase), Kss1p (MAPK), andSte12 (transcription factor)—are common to the filamentousgrowth pathway and the response to nutrient deprivation, andcross talk can occur under some experimental conditions. TheN. crassa genome contains homologs of all known fundamentalelements involved in the yeast pheromone response pathway(Table 1). As in yeast, some of the components may alsofunction in other MAPK cascade pathways in N. crassa, eithernormally or under special circumstances. These could includethe pathway controlling filamentous growth. In the heterobasi-diomycete U. maydis, pheromone alone is sufficient to inducefilamentous growth. Autocrine stimulation of the pheromoneresponse pathway is required for the maintenance of the fila-mentous form after the actual cell fusion (61). Downstreamcomponents of the MAPK cascade, activated by the MFA1pheromone (possibly via autocrine stimulation), may also berequired for filamentous growth of N. crassa.

All mutants isolated in this study showed great reduction invegetative growth and protoperithecial formation, both ofwhich involve filamentous differentiation. Although the vege-tative growth defect of mfa-1 mutants was largely reversed by

TABLE 1. N. crassa homologs of S. cerevisiae and S. pombe genes that encode components of the pheromone response MAPK pathway andthe posttranslational processing of a-factora

Function S. cerevisiae S. pombe N. crassa E value

Mating type regulatory protein A/ALPHA matM/matP mat a/mat A 1Mating factor MFA1 & 2 mfm1, 2 & 3 mfa-1 1Mating factor MF�1 & 2 map2 ccg-4 1Mating factor receptor STE2 mam2 Supercontig 9 1e-05Mating factor receptor STE3 map3 Supercontig 147 8e-03G protein � subunit GPA1 gpa1 gna-1 3e-62G protein � subunit STE4 git5 Supercontig 59 1e-49G protein subunit STE18 git11 Supercontig 128 6e-07PAK type kinase STE20 pak1 Supercontig 59 e-107Scaffold protein STE5 * Supercontig 39 7e-05MAPKKK STE11 byr2 Supercontig 8 4e-88MAPKK STE7 byr1 Supercontig 109 9e-57MAPK FUS3 spk1 Supercontig 234 e-109MAPK KSS1 spk1 Supercontig 234 e-107Transcription factor STE12 * Supercontig 59 3e-58MAPK FAR1 * Supercontig 39 3e-04Farnesytransferase � RAM2 cpp1 Supercontig 25 2e-21Farnesytransferase � RAM1 cwp1 Supercontig 180 5e-35‘AAX’ endoprotease RCE1 (AFC1) SPAC1687.02 Supercontig 8 1e-13Farnesyl cysteine carboxymethyltransferase STE14 mam4 Supercontig 329 1e-49Aminopeptidase1 STE24 SPAC3h1.05 Supercontig 180 1e-80Aminopeptidase2 AXL1 irp1 Supercontig 118 5e-36Aminopeptidase2 STE23 irp1 Supercontig 108 0.0ATP binding cassette (ABC) transporter STE6 mam1 Supercontig 61 e-122

a Amino acid sequences of the S. cerevisiae proteins were compared with N. crassa nucleotide databases (using tBLASTN) available through NCBI and/or WICGR(Whitehead Institute Center for Genome Research). E (expected) values of N. crassa are with respect to the corresponding S. cerevisiae proteins. An E value cutoffof 10�3 (e-3) was used except for the mating type and mating factor genes. Asterisks indicate that no homologs were identified in S. pombe.



.org/D

ownloaded from

http://ec.asm.org/

arginine, citrulline, or ornithine, mfa-1 is not likely to be di-rectly involved in the arginine or ornithine pathways, since aminute amount of supplement was sufficient to suppress thedefect, in sharp contrast to the nutritional needs of typicalarginine auxotrophs. However, other metabolites made fromornithine, particularly the hydroxamate siderophores neededfor transport of iron, are made in much smaller amounts, andthe demands on the supply of ornithine, and hence of arginine,are much lower (16). Many models could explain the stimula-tion by amino acids of the arginine cycle, and we suggest onlyone. It is conceivable that MFA1 is needed for the sensing andcorrection of transient nutritional deficits that arise duringordinary growth. Insufficient iron is a plausible example of adeficit, and MFA1 might have a role in requisitioning a smallfraction of the internal pool of ornithine toward the synthesisof siderophores. In the absence both of MFA1 and of anexternal supply of ornithine or arginine, siderophores andhence iron would become growth-limiting.

The 3� UTR of mfa-1 is required for the full range of func-tion. Partial male fertility defects of CAAX mat a mutantssuggested that the 3� untranslated region of mfa-1 may berequired for the full range of pheromone activity. The se-quences of 3� untranslated regions have been implicated incontrol of mRNA localization (5, 6, 60), as well as in control ofmRNA stability and of translational efficiency (7, 23, 65).mRNA species that must be located very precisely within thecell often have long 3� UTRs, and the mRNA itself may con-tain signals, targeting it to preferred subcellular sites. The1.2-kb mfa-1 transcript is mostly noncoding (over 80% is 3�UTR), and it has an unusual predicted secondary structure,containing several long double-stranded regions. When com-pared to the wild type, the predicted mRNA secondary struc-tures of CAAX and YAAX alleles showed noticeable differ-ences. If MFA1 indeed acts as a conglutinin in peritheciumformation, precise mRNA localization could be important.Thus, CAAX mutants might be hypomorphs because much ofthe MFA1 product is not correctly localized, even if it is madein normal amounts. Long 3� UTRs have also been identified inthe hydrophobic pheromone precursor genes of other filamen-tous fungi, including MF1-1 of M. grisea (75% of the 0.8-kbtranscript [58]), ppg2 of S. macrospora (80% of the 1.0-kbtranscript [50]), and mf2-1 of Cryphonectria parasitica (86% ofthe 0.7-kb transcript [68]), suggesting that mRNA localizationmight be important in those organisms.

In summary, the mfa-1 gene appears to play complex andessential roles in the vegetative growth and sexual develop-ment of N. crassa. It encodes a hydrophobic pheromone, re-quired for mat a, acting as a male, to attract and fuse with a matA trichogyne. It may also encode a peptide, conglutinin, iden-tical in part or in entirety with the mat a pheromone, that isessential for perithecial maturation in both mating types. Fi-nally, the mfa-1 gene is involved in vegetative and protoperi-thecial development in both mating types, and its 3� UTR isrequired for the full range of mfa-1 function.

ACKNOWLEDGMENTS

We thank David Perkins and Peter Stadler for personal communi-cations.

This research was supported by NSF grant MCB-9874488 to M.A.N.and NIH grants GM47374 to M.A.N. and GM08995 to R.L.M.

REFERENCES

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990.Basic local alignment search tool. J. Mol. Biol. 215:403–410.

2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. H. Zhang, Z. Zhang, W.Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a newgeneration of protein database search programs. Nucleic Acids Res. 25:3389–3402.

3. Anderegg, R. J., R. Betz, S. A. Carr, J. W. Crabb, and W. Duntze. 1988.Structure of Saccharomyces cerevisiae mating hormone a-factor: identifica-tion of S-farnesyl cysteine as a structural component. J. Biol. Chem. 263:18236–18240.

4. Anderson, C. M., D. A. Willits, P. J. Kosted, E. J. Ford, A. D. Martinez-Espinoza, and J. E. Sherwood. 1999. Molecular analysis of the pheromoneand pheromone receptor genes of Ustilago hordei. Gene 240:89–97.

5. Bashirullah, A., R. L. Cooperstock, and H. D. Lipshitz. 1998. RNA local-ization in development. Annu. Rev. Biochem. 67:335–394.

6. Beach, D. L., E. D. Salmon, and K. Bloom. 1999. Localization and anchoringof mRNA in budding yeast. Curr. Biol. 9:569–578.

7. Beelman, C. A., and R. Parker. 1995. Degradation of messenger RNA ineukaryotes. Cell 81:179–183.

8. Bistis, G. N. 1983. Evidence for diffusible, mating-type-specific trichogyneattractants in Neurospora crassa. Exp. Mycol. 7:292–295.

9. Bolker, M., and R. Kahmann. 1993. Sexual pheromones and mating re-sponses in fungi. Plant Cell 5:1461–1469.

10. Braun, E. L., E. K. Fuge, P. A. Padilla, and M. Werner-Washburne. 1996. Astationary-phase gene in Saccharomyces cerevisiae is a member of a novel,highly conserved gene family. J. Bacteriol. 178:6865–6872.

11. Buller, A. H. R. 1933. Researches on fungi, vol. 5. Longman, London, UnitedKingdom.

12. Caldwell, G. A., S.-H. Wang, C.-B. Xue, Y. Jiang, H.-F. Lu, F. Naider, andJ. M. Becker. 1994. Molecular determinants of bioactivity of the Saccharo-myces cerevisiae lipopeptide mating pheromone. J. Biol. Chem. 269:19817–19825.

13. Cambareri, E. B., B. C. Jensen, E. Schabtach, and E. U. Selker. 1989.Repeat-induced G-C to A-T mutations in Neurospora. Science 244:1571–1575.

14. Casselton, L. A., and N. S. Olesnicky. 1998. Molecular genetics of matingrecognition in basidiomycete fungi. Microbiol. Mol. Biol. Rev. 62:55–70.

15. Chakraborty, B. N., and M. Kapoor. 1990. Transformation of filamentousfungi by electroporation. Nucleic Acids Res. 18:6737.

16. Charlang, G., and N. P. Williams. 1983. Siderophore transport mutants (sit)in Neurospora crassa. Neurospora Newsl. 30:6–7.

17. Chen, P., J. D. Choi, R. Wang, R. J. Cotter, and S. Michaelis. 1997. A novela-factor-related peptide of Saccharomyces cerevisiae that exits the cell by aSte6p-independent mechanism. Mol. Biol. Cell 8:1273–1291.

18. Chikashige, Y., D. Q. Ding, Y. Imai, M. Yamamoto, T. Haraguchi, and Y.Hiraoka. 1997. Meiotic nuclear reorganization: switching the position ofcentromeres and telomeres in the fission yeast Schizosaccharomyces pombe.EMBO J. 16:193–202.

19. Davey, J. 1992. Mating pheromones of the fission yeast Schizosaccharomycespombe: purification and structural characterization of M-factor and isolationand analysis of two genes encoding the pheromone. EMBO J. 11:951–960.

20. Davey, J., K. Davis, M. Hughs, G. Ladds, and D. Powner. 1998. The pro-cessing of yeast pheromone. Semin. Cell Dev. Biol. 9:19–30.

21. Davis, R. H., and F. J. DeSerres. 1970. Genetic and microbiological researchtechniques for Neurospora crassa. Methods Enzymol. 17:79–143.

22. Debuchy, R. 1999. Internuclear recognition: a possible connection betweeneuascomycetes and homobasidiomycetes. Fungal Genet. Biol. 27:218–223.

23. Decker, C. J., and R. Parker. 1994. Mechanisms of messenger RNA degra-dation in eukaryotes. Trends Biochem. Sci. 19:336–340.

24. Dolan, P. L., D. O. Natvig, and M. A. Nelson. 2000. Neurospora proteome2000. Fungal Genet. Newsl. 47:7–24.

25. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNArestriction endonuclease fragments to high specific activity. Annu. Rev. Bio-chem. 132:6–13.

26. Glass, N. L., and M. L. Smith. 1994. Structure and function of a mating-typegene from the homothallic species Neurospora africana. Mol. Gen. Genet.244:401–409.

27. Griffiths, A. J. F., and A. M. DeLange. 1978. Mutations of the a mating-typegene in Neurospora crassa. Genetics 88:239–254.

28. Hartmann, H. A., R. Kahmann, and M. Bolker. 1996. The pheromoneresponse factor coordinates filamentous growth and pathogenicity in Ustilagomaydis. EMBO J. 15:1632–1641.

29. Hofacker, I. L., M. Fekete, C. Flamm, M. A. Huynen, S. Rauscher, P. E.Stolorz, and P. F. Stadler. 1998. Automatic detection of conserved RNAstructure elements in complete RNA virus genomes. Nucleic Acids Res.26:3825–3836.

30. Hofacker, I. L., and P. F. Stadler. 1999. Automatic detection of conservedbase pairing patterns in RNA virus genomes. Comput. Chem. 23:401–414.

31. Imai, Y., and M. Yamamoto. 1994. The fission yeast mating pheromone



.org/D

ownloaded from

http://ec.asm.org/

P-factor: its molecular structure, gene structure, and ability to induce geneexpression and G1 arrest in the mating partner. Genes Dev. 8:328–338.

32. Jantzen, H.-M., A. Admon, S. P. Bell, and R. Tjian. 1990. Nucleolar tran-scription factor hUBF contains a DNA-binding motif with homology toHMG proteins. Nature 344:830–836.

33. Johnson, T. E. 1979. A Neurospora mutation that arrests perithecial devel-opment as either male or female parent. Genetics 92:1107–1120.

34. Kinnaird, J. H., M. A. Keighren, J. A. Kinsey, M. Eaton, and J. R. S.Fincham. 1982. Cloning of the am (glutamate dehydrogenase) gene of Neu-rospora crassa through the use of a synthetic DNA probe. Gene 20:387–396.

35. Kosted, P. J., S. A. Gerhardt, C. M. Anderson, A. Stierle, and J. E. Sherwood.2000. Structural requirements for activity of the pheromones of Ustilagohordei. Fungal Genet. Biol. 29:107–117.

36. Kothe, E. 1999. Mating types and pheromone recognition in the homobasi-diomycete Schizophyllum commune. Fungal Genet. Biol. 27:146–152.

37. Kozak, M. 1987. An analysis of 5�-noncoding sequences from 699 vertebratemessenger RNAs. Nucleic Acids Res. 15:8125–8148.

38. Kronstad, J. W., and C. Staben. 1997. Mating type in filamentous fungi.Annu. Rev. Genet. 31:245–276.

39. Kurjan, J. 1993. The pheromone response pathway in Saccharomyces cerevi-siae. Annu. Rev. Genet. 27:147–179.

40. Lindegren, C. C., V. Beanfield, and R. Barber. 1939. Increasing the fertilityof Neurospora by selective inbreeding. Bot. Gaz. 100:592–599.

41. Metzenberg, R. L., J. N. Stevens, E. U. Selker, and E. Morzycka-Wrob-lewska. 1984. A method for finding the genetic map position of cloned DNAfragments. Neurospora Newsl. 31:35–39.

42. Moore, T. D. E., and J. C. Edman. 1993. The alpha mating type locus ofCryptococcus neoformans contains a peptide pheromone gene. Mol. Cell.Biol. 13:1962–1970.

43. Nelson, M. A., and R. L. Metzenberg. 1992. Sexual development genes ofNeurospora crassa. Genetics 132:149–162.

44. Nelson, M. A., S. Kang, E. L. Braun, M. E. Crawford, P. L. Dolan, P. M.Leonard, J. Mitchell, A. M. Armijo, L. Bean, E. Blueyes, T. Cushing, A.Errett, M. Fleharty, M. Gorman, K. Judson, R. Miller, J. Ortega, I. Pavlova,J. Perea, S. Todisco, R. Trujillo, J. Valentine, A. Wells, M. Werner-Wash-burne, S. Yazzie, and D. O. Natvig. 1997. Expressed sequences from conidial,mycelial and sexual stages of Neurospora crassa. Fungal Genet. Biol. 21:348–363.

45. Nelson, M. A., and D. D. Perkins. 2000. Restriction polymorphism maps ofNeurospora crassa: 2000 update. Fungal Genet. Newsl. 47:25–39.

46. O’Shea, S. F., P. T. Chaure, J. R. Halsall, N. S. Olesnicky, A. Leibbrandt,I. F. Connerton, and L. A. Casselton. 1998. A large pheromone and receptorgene complex determines multiple B mating type specificities in Coprinuscinereus. Genetics 148:1081–1090.

47. Orbach, M. J. 1994. A cosmid with a HyR marker for fungal library construc-tion and screening. Gene 150:159–162.

48. Perkins, D. D., and E. G. Barry. 1977. The cytogenetics of Neurospora. Adv.Genet. 19:133–285.

49. Perkins, D. D., A. Radford, and M. S. Sachs. 2001. The Neurospora com-pendium: chromosomal loci. Academic Press, San Diego, Calif.

50. Poggeler, S. 2000. Two pheromone precursor genes are transcriptionally

expressed in the homothallic ascomycete Sordaria macrospora. Curr. Genet.37:403–411.

51. Poggeler, S., and U. Kuck. 2001. Identification of transcriptionally expressedpheromone receptor genes in filamentous ascomycetes. Gene 280:9–17.

52. Radford, A., and J. H. Parish. 1997. The genome and genes of Neurosporacrassa. Fungal Genet. Biol. 21:258–266.

53. Roberts, C. J., B. Nelson, M. J. Marton, R. Stoughton, M. R. Meyer, H. A.Bennett, Y. D. D. He, H. Y. Dai, W. L. Walker, T. R. Hughes, M. Tyers, C.Boone, and S. H. Friend. 2000. Signaling and circuitry of multiple MAPKpathways revealed by a matrix of global gene expression profiles. Science287:873–880.

54. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratorymanual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

55. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

56. Saupe, S., L. Stenberg, K. T. Shiu, A. J. F. Griffiths, and N. L. Glass. 1996.The molecular nature of mutations in the mt A-1 gene of the Neurosporacrassa A idiomorph and their relation to mating-type function. Mol. Gen.Genet. 250:115–122.

57. Selker, E. U. 1990. Premeiotic instability of repeated sequences in Neuro-spora crassa. Annu. Rev. Genet. 24:579–613.

58. Shen, W. C., P. Bobrowicz, and D. J. Ebbole. 1999. Isolation of pheromoneprecursor genes of Magnaporthe grisea. Fungal Genet. Biol. 27:253–263.

59. Shiu, P. K. T., and N. L. Glass. 2000. Cell and nuclear recognition mecha-nisms mediated by mating type in filamentous ascomycetes. Curr. Opin.Microbiol. 3:183–188.

60. Singer, R. H. 1993. RNA zipcodes for cytoplasmic addresses. Curr. Biol.3:719–721.

61. Spellig, T., M. Bolker, F. Lottspeich, R. W. Frank, and R. Kahmann. 1994.Pheromones trigger filamentous growth in Ustilago maydis. EMBO J. 13:1620–1627.

62. Staben, C., and C. Yanofsky. 1990. Neurospora crassa a mating-type region.Proc. Natl. Acad. Sci. USA 87:4917–4921.

63. Stevens, J. N., and R. L. Metzenberg. 1982. Preparing Neurospora DNA:some improvements. Neurospora Newsl. 29:27–28.

64. Sugimoto, A., Y. Iino, T. Maeda, Y. Watanabe, and M. Yamamoto. 1991.Schizosaccharomyces pombe STE11� encodes a transcription factor with anHMG motif that is a critical regulator of sexual development. Genes Dev.5:1990–1999.

65. Tanguay, R. L., and D. R. Gallie. 1996. Translational efficiency is regulatedby the length of the 3� untranslated region. Mol. Cell. Biol. 16:146–156.

66. Vogel, H. J. 1956. A convenient growth medium for Neurospora (medium N).Microbiol. Genet. Bull. 13:42–43.

67. Westergaard, M., and H. K. Mitchell. 1947. Neurospora V. A syntheticmedium favoring sexual reproduction. Am. J. Bot. 34:573–577.

68. Zhang, L., and R. A. Baasiri. 1998. Viral repression of fungal pheromoneprecursor gene expression. Mol. Cell. Biol. 18:953–959.

69. Zhu, H., M. Nowrousian, D. Kupfer, H. V. Colot, G. Berrocal-Tito, H. S. Lai,D. Bell-Pedersen, B. A. Roe, J. J. Loros, and J. C. Dunlap. 2001. Analysis ofexpressed sequence tags from two starvation, time-of-day-specific libraries ofNeurospora crassa reveals novel clock-controlled genes. Genetics 157:1057–1065.



.org/D

ownloaded from

http://ec.asm.org/

multiple functions of mfa-1, a putative pheromone ... · sitophila (fgsc 2216 and 2217), neurospora...

Documents