RESULTS

TaqMan Rare Mutation Digital PCR Assays are optimized for use in the QuantStudio 3D Digital PCR System.

Figure 5. The QuantStudio 3D Digital PCR Platform

ABSTRACT Detection of rare mutations in tumor tissue and cell free DNA (cfDNA) allows for monitoring of tumor progression and regression for research purposes. cfDNA isolated from plasma combined with a sensitive detection method like digital PCR is non- invasive and enables earlier detection compared to conventional imaging techniques. Building on the TaqMan based Rare Mutation assay set for detection of rare mutations using digital PCR on the QuantStudio 3D Digital PCR System, we are now developing multiplex assays for simultaneous detection of several mutations. We selected relevant mutations in the EGFR and KRAS genes for our initial multiplex application: EGFR G719, EGFR exon 19 deletions, and KRAS G12/G13. These mutations may have implications for potential future targeted therapy. Primers and probes of singleplex Rare Mutation Assays were reformulated to generate multiplex assays detecting the EGFR and KRAS mutations. All multiplex assays were tested on template composed of wild-type genomic DNA background mixed with mutant plasmid reflecting each of the mutations detected by the multiplex assays. Initial experimental results were successful and showed excellent signal intensity and clear cluster separation when analyzed with the QuantStudio 3D AnalysisSuiteTM Cloud Software. The EGFR G719 mutations (COSM6239, COSM6253, COSM6252) were detected using a 3plex assay, EGFR exon 19 deletions (COSM12383, COSM12422, COSM12678, COSM6223, COSM6254, COSM6255) were detected using a 6plex assay, and KRAS G12/G13 mutations (COSM516, COSM517, COSM518, COSM520, COSM521, COSM522, COSM527, COSM532) were detected using an 8plex. Multiplexing assays for three relevant mutation loci proved feasible and presents an efficient way to assess the presence and the percentage of mutations at these loci.

INTRODUCTION We undertook a feasibility study multiplexing TaqMan Rare Mutation Assays covering three important mutational loci to accommodate limited amounts of sample frequently encountered in research involving cfDNA or biopsy material. We selected mutations in the EGFR and KRAS genes for our initial multiplex application: EGFR G719, EGFR exon 19 deletions, and KRAS G12/G13. These mutations may have implications for potential future targeted therapy.

MATERIALS AND METHODS Primers and probes of singleplex Rare Mutation Assays were reformulated and pooled to generate multiplex assays which give positive signal in the presence of any of the targeted EGFR or KRAS mutations. All multiplex assays were wet-lab tested on wild-type genomic DNA (Coriell Institute) mixed with mutant plasmid (Thermo Fisher Scientific) reflecting each of the mutations detected by the multiplex assays. Amounts of plasmids added reflected mutation rates of 10%, 1% and 0.1%. Thermal cycling on the ProFlex™ PCR System was performed according to the Quick Reference Protocol for Rare Mutation Analysis (publication # CO29568 1114, Thermo Fisher Scientific). Results were analyzed in QuantStudio 3D AnalysisSuite Cloud Software.

CONCLUSIONS In clinical research, mutations affecting the same codon or the same exon usually present with the same disease phenotype. Researchers therefore like to detect these targets with one assay to save on sample material and cost. In this study, we proved the feasibility of multiplexing TaqMan Rare Mutation Assays for three relevant mutation loci. All assays detected the respective mutations at sensitivity levels as low as 0.1%.

REFERENCES

•  The Hallmarks of Cancer. Hanahan D and Weinberg RA, 2000, Cell, Vol 100:57-70.

•  Mutations in the p53 Tumor Suppressor Gene: Important Milestones at the Various Steps of Tumorigenesis. Rivlin N et al., Genes & Cancer / vol 2 no 4 (2011), pp.466-474

•  Clinical pharmacogenomic testing of KRAS, BRAF and EGFR mutations by high resolution melting analysis and ultra-deep pyrosequencing. Borras E et al., BMC Cancer 2011, 11:406

•  Novel mutant-enriched Sequencing Identified High Frequency of PIK3CA Mutations in Pharyngeal Cancer. Qiu W et al., Int J Cancer. 2008 March 1; 122(5): 1189–1194.

•  PIK3CA Mutations Frequently Coexist with RAS and BRAF Mutations in Patients with Advanced Cancers. Janku F et al., PLoS ONE Volume 6 (7): 1-8

•  Detection of Circulating Tumor DNA in Early- and Late-Stage Human Malignancies. Bettegowda C et al., Sci Transl Med. 2014 February 19; 6(224)

ACKNOWLEDGEMENTS We thank Amy Cuneo and Rachel Formosa of Thermo Fisher Scientific for reviewing the document. For Research Use OnIy. Not for use in diagnostic procedures. © 2016 Thermo Fisher Scientific Inc. All rights reserved All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified. TaqMan is a registered trademark of Roche Molecular Systems, Inc., used under permission and license.

Thermo Fisher Scientific • 5791 Van Allen Way • Carlsbad, CA 92008 • www.lifetechnologies.com

Marion Laig, Bonnie Moy, Frances Chan, Le Lac, Ted Straub, Kamini Varma, David Keys Thermo Fisher Scientific, 180 Oyster Point Blvd., South San Francisco, CA

Multiplex TaqMan Assays for Rare Mutation Analysis Using Digital PCR

Table 1. Overview of Multiplex Assays

TaqMan Rare Mutation Assays were multiplexed for the EGFR and KRAS genes comprising between 3 and 7 individual assays. All Assays were wet-lab tested using wild-type genomic DNA with mutant plasmid spiked in, reflecting mutation rates of 10%, 1% and 0.1% and negative wild-type only control at 0%. Data were analyzed using QuantStudio® 3D AnalysisSuite™ Cloud Software. All multiplex assays successfully detected each of their individual target (Figure 1 – Figure 4).

Assay Performance of the EGFR exon 19 deletion assay tested against its 6 individual targets. Details of individual targets are depicted in Figure 2.

Figure 3. EGFR exon 19 deletions assay detects 6 individual mutations

Assay Performance of the KRAS G12/G13 assay tested against its 7 individual targets p.G12C, p.G12S, p.G12R, p.G12V, p.G12D, p.G12A and p.G13C.

Figure 4. KRAS G12/G13 assay detects 7 individual mutations

EGFR wild-type AATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAAT

EGFR-12383 AATTCCCGTCGCTATCAAGGAAC------------CATCTCCGAAAGCCAACAAGGAAAT

EGFR-6254 AATTCCCGTCGCTATCAAGGA---------------ATCTCCGAAAGCCAACAAGGAAAT

EGFR-12678 AATTCCCGTCGCTATCAAGGC---------------ATCTCCGAAAGCCAACAAGGAAAT

EGFR-6223 AATTCCCGTCGCTATCAAAAC---------------ATCTCCGAAAGCCAACAAGGAAAT

EGFR-6255 AATTCCCGTCGCTATCAAGGAA------------------CCGAAAGCCAACAAGGAAAT

EGFR-12422 AATTCCCGTCGCTATCAAGGAGC---------CAACATCTCCGAAAGCCAACAAGGAAAT

******************.. ********************

Assay Performance of the EGFR G719X assay tested against its three targets p.G719A, p.G719C and p.G719S

Figure 1. EGFR G719X assay

EGFR exon 19 carries several micro-deletions. Shown is the sequence alignment of deletions covered by the EGFR exon 19 deletions assay (see Figure 3).

Figure 2. EGFR Exon 19 Deletions Sequence Alignment