n m ll aer molecular analysis of the ramra locus in ... · in clinical klebsiella pneumoniae...

FULL PAPER

New Microbiologica, 40, 2, 135-138, 2017, ISN 1121-7138

Molecular analysis of the ramRA locus in clinical Klebsiella pneumoniae isolates with reduced susceptibility to tigecycline Cristina Belmar Campos1, Martin Aepfelbacher1, Moritz Hentschke1,2

1Institute of Medical Microbiology, Virology and Hygiene, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany;2MVZ Labor Dr. Fenner und Kollegen, Hamburg, Germany

INTRODUCTION

A recent study found K. pneumoniae (together with K. oxy-toca) to be the fourth most frequent overall pathogen and Klebsiella the second most frequent genus of the family of enterobacteriaceae (after Escherichia coli) involved in catheter-associated blood stream infections, catheter-asso-ciated urinary tract infections, surgical site infections and ventilator-associated pneumonias (Sievert et al., 2013). With this in mind, the rapid emergence of multidrug re-sistance in K. pneumoniae is particularly worrisome. Af-ter the worldwide spread of enterobactericeae resistant to fluoroquinolones and third generation cephalosporines in recent decades, the dissemination of carbapenemase-pro-ducing strains pushes the antibiotic resistance crisis to a new level (Pitout et al., 2015). The few remaining treat-ment options for carbapenemase-positive K. pneumoniae often comprise only colistin and/or tigecycline.While susceptibility rates for tigecycline generally have remained high for many bacterial species since its in-troduction (Hoban et al., 2015), carbapenem-resistant K. pneumoniae exhibit considerable resistance rates (Sader et al., 2015). Over the last few years, several tigecycline resistance mechanisms have been described in K. pneu-moniae. One is over-expression of the efflux pump AcrAB because of the inactivation of the repressor RamR, which regulates RamA, a transcriptional activator of the acrAB genes (Hentschke et al., 2010; Rosenblum et al., 2011;

Corresponding author:Cristina Belmar CamposE-mail: [email protected]

©2017 by EDIMES - Edizioni Internazionali Srl. All rights reserved

Bialek-Davenet et al., 2011; Bialek-Davenet et al., 2013). Other mechanisms described in individual studies include overexpression of the efflux pump KpgABC due to an up-stream insertion of an IS5 element (Nielsen et al., 2014) and mutations in the gene for ribosomal protein S10, rpsJ (Villa et al., 2014). Recently, mutational inactivation of the protease Lon was found to result in resistance to tigecy-cline (Fang et al., 2016). Data on the role of RarA and the oqxRAB locus in tigecycline resistance are currently con-troversial (Veleba et al., 2012; Bialek-Davenet et al., 2015). While mutations in the putative transcriptional acrAB reg-ulator acrR have been described in tigecycline-resistant K. pneumoniae strains (Sheng et al., 2014; Rosenblum et al., 2011), its causative role has not been verified experimen-tally so far. Recent studies on larger collections of tige-cycline-resistant strains confirm mutational inactivation of RamR as a major cause of tigecycline resistance, while the role of other described mechanisms remains less clear (Sheng et al., 2014; Wang et al., 2015; He et al., 2015) In this study we molecularly characterized the ramRA lo-cus in six non-duplicate K. pneumoniae strains, which ex-hibited reduced susceptibility to tigecycline.

METHODSBacterial isolates and antimicrobial susceptibility testingK. pneumoniae isolates displaying inhibition zone diam-eters of less than 18 mm in the disc diffusion test (disc content 15 µg) were collected and characterized. Minimal inhibitory concentrations (MICs) for tigecycline were an-alyzed by broth microdilution (following the methodolo-gy of DIN EN ISO 20776-1) using commercially available plates (MERLIN Diagnostika GmbH, Bornheim-Hersel, Germany) and Mueller-Hinton II broth (BBL, BD Biosci-ence, Sparks, MD) prepared on the same day (less than 12 h old). The tigecycline concentrations on the plates ranged

Key words:Tigecycline, RamR, efflux, resistance.

SUMMARY

Mutations in ramR, a negative regulator of ramA which stimulates transcription of acrA/-B encoding the multidrug efflux pump AcrAB-TolC, were recently shown to result in reduced susceptibility to tigecycline in Klebsiella pneumoniae. We analysed six non-duplicate K. pneumoniae isolates with elevated MICs to tigecycline. All isolates showed transcriptional up-regulation of ramA and acrB as demonstrated by North-ern blot and quantitative real-time PCR. Sequencing of the ramR gene revealed deletions in five of the isolates and a premature stop codon in one isolate. Transformation of the wild-type ramR gene but not of any of the detected mutant ramR genes into a ramR-mutant K. pneumoniae strain restored tigecycline susceptibility and repressed ramA and acrB transcription to wild type levels. Thus, our study confirms the role of inactivating mutations in the ramR gene in tigecycline resistance.

Received November 11, 2016 Accepted January 22, 2017

C. Belmar Campos, M. Aepfelbacher, M. Hentschke136

from 0.015625 mg/L to 2 mg/L. MICs were interpreted ac-cording to EUCAST clinical breakpoints: Tigecycline: <1.0 mg/L = susceptible; 2.0 mg/L = intermediate; >2.0 mg/L = resistant.

DNA manipulationsThe ramR genes of all isolates including 367 bp of up-stream and 199 bp of downstream genomic sequences were amplified from bacterial genomic DNA using the primers ramR-For: CTGCAG-TGCCCGGTGAACCCTGG-CGT and ramR-Rev: CTGCAG-ATTTGCTGATTCAGCAG-CGAC. The PCR products were then directly sequenced using the same primer pair as for amplification and were inserted after restriction digestion into the PstI-site of the pACYC177 vector. Sequence verified clones were then transformed by electroporation into a previously characterized ramR-mutant strain VA14743 (Hentschke et al., 2010), which harbours an insertion of a Cytosine between nucleotides 137 and 138 (g.137_138insC) re-sulting in an inactivating frameshift mutation. Norther-nblot hybridization probes for ramA, acrB and rrsE were generated by amplifying the respective gene fragments by PCR from bacterial genomic DNA using the follow-ing primers: ramA: ramA-Nor-probe-F: ATGACGATTTC-CGCTCAGGTGA and ramA-Nor-probe-R: CAGTGGGC-GCGACTGTGGTTC; acrB: acrB-Nor-probe-F: TTAATAC-CCAGACCGGATGC and acrB-Nor-probe-R: TGGCCG-CGGGCCAGTTAGGCGGTA; rrsE: rrsE-Nor-probe-F: TTGACGTTACCCGCAGAAGAA and rrsE-Nor-probe-R: TCTACAAGACTCTAGCCTGCCA. The PCR products were subsequently ligated into the TA-vector pGEMTeasy (Promega, Mannheim, Germany).

Northern blottingTotal RNA isolation from mid-log phase bacterial liquid cultures in Luria broth was performed using the RNeasy kit (Qiagen, Hilden, Germany). 2 µg of total RNA were run in a 1% agarose gel containing 1.2% formaldehyde for one hour. The RNA was then passively blotted to a Porablot nylon membrane (Macherey-Nagel, Düren, Germany) in 20x SSC (3M NaCl, 0.3 M Tri-Sodium-citrate dehydrate). Hybridization probes of ramA, acrB and rrsE were gen-erated by cutting the respective cloned fragments out of the pGEMTeasy vector (see above) with the restriction enzyme EcoRI and subsequent labelling with [a-32P]dCTP (Hartmann-Analytic, Braunschweig, Germany) using the Megaprime DNA labelling system (GE-Healthcare). The nylon membranes were first prehybridized at 65°C under constant rotation in a glass tube in 10 ml Speed-HybII (7% SDS, 10% PEG 20000, 0.22 M NaCl, 1.5 mM EDTA, 15 mM sodium phosphate and 200 µg/ml sonicated salmon sperm DNA (Roche, Mannheim, Germany) for 1 hour. 500.000 cpm/ml specific probe was then added to the Speed-Hy-bII buffer and hybridization was continued overnight. The membranes were then washed three times in 2x SSC/0.1% SDS at 65°C for 15 min and were subsequently exposed to Kodak MS autoradiograph films.

Quantitative real-time PCRInitially RNA was treated with DNAse I (Roche, Mann-heim, Germany) to digest residual bacterial genomic DNA. Reverse transcription of 100 ng RNA was carried out using the SuperScript kit from Invitrogen (Karlsruhe, Germa-ny). The resulting cDNA was diluted 1:5 for ramA and acrB qRT-PCRs and then further diluted 1:1000 for rrsE qRT-

PCR. SYBR Green qRT-PCR were performed using the qPCR Core SYBR Green I kit (Eurogentec, Seraing, Bel-gium) with the same primers described above for the am-plification of the northern blot hybridization probes with the exception of ramA-rev-qPCR: CAGCCGTTGCAGATG-CCATTTC on a Rotor Gene Q cycler (Qiagen, Hilden, Ger-many). The PCR protocol was as follows: 45 cycles: 20 s 95°C, 20 s 60°C, 30 s 72°C. Data analysis was performed following the 2-DDCT method (Livak & Schmittgen, 2001).

RESULTS AND DISCUSSION

Six tigecycline non-susceptible K. pneumoniae isolates (BK1761 from blood culture, VA11109 from a rectal screening swab, VA16315 from an abdominal swab and UR8928, UR10985 and UR14832 from urine) with tigecy-cline MICs of 2 mg/L (UR8928, VA11109, UR10985) and >2 mg/L (BK1761, VA16315, UR14832) were identified by our diagnostic service and analysed (Table 1). All strains were isolated from inpatients of the University Medical Center Hamburg-Eppendorf between July 2009 and August 2011.First, expression levels of ramA and acrB in the non-sus-ceptible strains were investigated by Northern blot (Fig-ure 1) and by qPCR (Table 1). All six isolates displayed highly up-regulated ramA- and acrB expression levels as compared to the previously characterized wildtype strain VA21516 (Hentschke et al., 2010). The degree of up-regu-lation of ramA and acrB in the resistant strains was com-parable to the previously described tigecycline-resistant ramR mutant strain VA14743 (lane two, see Methods sec-tion for description of the strain (Hentschke et al., 2010). In order to explore whether the up-regulation of ramA and acrB is due to ramR inactivation we amplified and se-quenced all ramR genes and the respective promoter re-gions. All six non-duplicate isolates with up-regulated ex-pression levels of ramA and acrB, harboured mutations in

Figure 1 - Expression levels of ramA and acrB in tigecy-cline-resistant K. pneumoniae strains. RNA levels were an-alyzed by Northern blot. VA21516-WT served as wildtype control and VA14743-MUT served as a previously charac-terized mutant control. Subsequent hybridization with an rrsE probe controlled for loading of equal amounts of RNA.

Reduced tigecycline susceptibility in Klebsiella pneumoniae 137

Figure 2 - Wildtype but not mutated ramR genes from tige-cycline-resistant strains repress ramA and acrB expression. The non-susceptible strain VA14743 was transformed with empty vector, mutated or wildtype ramR alleles and expres-sion levels of ramA and acrB were analyzed by Northern blotting.

the ramR gene as compared to the wildtype sequence (K. pneumoniae subsp. pneumoniae MGH 78578 (CP000647)) (Table 1). All identified mutations most likely result in functional loss of the gene product (five deletions and one premature stop codon). The six different mutated ramR genes together with the promoter regions (see Methods section for details) were amplified and inserted into the pACYC177 vector and then transformed into the previously characterized ramR mu-tant strain VA14743. Like the empty pACYC177 vector, none of the six mutated ramR genes could significantly lower the MIC of 2.0 mg/L to tigecycline of the transformed strain (Table 1). In contrast, complementation with wild-type ramR (with the silent polymorphism g.C165T, p.Thr-55→Thr) lowered the MIC of VA14743 to wildtype levels of 0.25 mg/L. Furthermore, while ramA and acrB expression was strongly repressed in VA14743 by complementation with a wildtype ramR allele, transformation of the empty vector or any of the mutated genes had no influence on the respective expression levels (Figure 2 and Table 1). These results indicate that all identified mutations are function-ally inactivating. Our study confirms that mutations in ramR are an import-ant cause of tigecycline resistance in K. pneumoniae and underscores the relevance of drug efflux as a resistance mechanism. Our complementation experiments employ-ing not only a wildtype allele but also the mutated ramR genes show that the identified ramR mutations sufficiently explain the tigecycline non-susceptible phenotype. While a number of alternative tigecycline resistance mecha-nisms in K. pneumoniae have been described, their epi-demiological relevance is currently unclear (Sheng et al.,

Table 1 - Characterisation of strains used in this study.

Isolate MIC*,§:Tigecycline ramR Rel. ramA

Expression#Rel. acrb

Expression#Origin,

reference

Klebsiella pneumoniae VA21516-WT 0,25 S Wildtype 1 1 (Hentschke et al., 2010)

Klebsiella pneumoniae VA14743-MUT 2 I g.137_138insC 83.9 9.2 (Hentschke et al., 2010)

Klebsiella pneumoniae UR8928 2 I g.347_356del 20.0 11.2 Urine, this study

Klebsiella pneumoniae UR10985 2 I g.346_359del 22.6 3.3 Urine, this study

Klebsiella pneumoniae VA11109 2 I g.147delG 37.3 5.5 Anal swab, this study

Klebsiella pneumoniae UR14832 >2 R g.485delC 59.7 4.6 Urine, this study

Klebsiella pneumoniae VA16315 >2 R g.505G>T; p.169E>Stop

56.1 9.2 Abdomen, this study

Klebsiella pneumoniae BK1761 >2 R g.221_252del 14.2 3.3 Blood, this study

Klebsiella pneumoniae VA14743(ramR-12262-WT) 0.25 S NA 1 1 (Hentschke et al., 2010)

Klebsiella pneumoniae VA14743(pACYC177) >2 R NA 20.6 12.3 (Hentschke et al., 2010)

Klebsiella pneumoniae VA14743(ramR-8928) >2 R NA 88.7 29.5 this study






*tested by broth microdilution, in mg/L; §S=susceptible, I=intermediate, R=resistant; according to EUCAST clinical breakpoints (www.eucast.org); #measured by quantita-tive RT-PCR, shown as x-fold expression levels of VA21516 for the clinical strains and as x-fold expression levels of VA14743(ramR-12262-WT) for the transformed strains. NA: Not applicable.

C. Belmar Campos, M. Aepfelbacher, M. Hentschke138

2014; Wang et al., 2015; He et al., 2015). Further confirma-tion of the dominant role of the RamAR-AcrAB regulon in tigecycline resistance may encourage the development of drugs inhibiting either the efflux pump AcrAB or its acti-vating transcription factor RamA, which is a direct tar-get of RamR. This may restore the activity of tigecycline in resistant isolates. RamA may in principle be amenable to pharmacological inhibition as it is, at least in Salmo-nella, a ligand-regulated transcription factor (Nikaido et al., 2008). RamA also represents a particularly interesting pharmacological target because it is additionally involved in pathogenicity regulation (De Majumdar et al., 2015).

ReferencesBialek-Davenet S., Marcon E., Leflon-Guibout V., Lavigne J. P., Bert F.,

Moreau R., Nicolas-Chanoine M.H. (2011). In vitro selection of ramR and soxR mutants overexpressing efflux systems by fluoroquinolo-nes as well as cefoxitin in Klebsiella pneumoniae. Antimicrob. Agents. Chemother. 55, 2795-2802.

Bialek-Davenet S., Leflon-Guibout V., Tran Minh O., Marcon E., Moreau R., Nicolas-Chanoine M.H. (2013). Complete deletion of the ramR gene in an in vitro-selected mutant of Klebsiella pneumoniae overexpressing the AcrAB efflux pump. Antimicrob. Agents. Chemother. 57, 672-673.

Bialek-Davenet S., Lavigne J.P., Guyot K., Mayer N., Tournebize R., Brisse S., Leflon-Guibout V., Nicolas-Chanoine M.H. (2015). Differential con-tribution of AcrAB and OqxAB efflux pumps to multidrug resistance and virulence in Klebsiella pneumoniae. Antimicrob. Agents. Chemoth-er. 70, 81-88.

De Majumdar S., Yu J., Fookes M., McAteer S.P., Llobet E., Finn S., Spence S., Monahan A., Kissenpfennig A., Ingram R.J., Bengoechea J., Gally D.L., Fanning S., Elborn J.S., Schneiders T. (2015). Elucidation of the RamA regulon in Klebsiella pneumoniae reveals a role in LPS regula-tion. PLoS Pathog. 11, e1004627.

Fang L., Chen Q., Shi K., Li X., Shi Q., He F., Zhou J., Yu Y., Hua X. (2016). Stepwise increase in tigecycline resistance in Klebsiella pneumoni-ae associated with mutations in ramR, lon and rps J. PLoS One. 11, e0165019.

He F., Fu Y., Chen Q., Ruan Z., Hua X., Zhou H., Yu Y. (2015). Tigecycline susceptibility and the role of efflux pumps in tigecycline resistance in KPC-producing Klebsiella pneumoniae. PLoS One. 10, e0119064.

Hentschke M., Wolters M., Sobottka I., Rohde H., Aepfelbacher M. (2010). ramR mutations in clinical isolates of Klebsiella pneumoniae with re-

duced susceptibility to Tigecycline. Antimicrob. Agents. Chemother. 54, 2720-2723.

Hoban D.J., Reinert R.R., Bouchillon S.K., Dowzicky M.J. (2015). Glob-al in vitro activity of tigecycline and comparator agents: Tigecycline Evaluation and Surveillance Trial 2004-2013. Ann. Clin. Microbiol. An-timicrob. 14, 27.

Nielsen L.E., Snesrud E.C., Onmus-Leone F., Kwak Y.I., Avilés R., Steele E.D., Sutter D.E., Waterman P.E., Lesho E.P. (2014). IS5 element in-tegration, a novel mechanism for rapid in vivo emergence of tigecy-cline nonsusceptibility in Klebsiella pneumoniae. Antimicrob. Agents. Chemother. 58, 6151-6156.

Nikaido E., Yamaguchi A., Nishino K. (2008). AcrAB multidrug efflux pump regulation in Salmonella enterica serovar Typhimurium by RamA in response to environmental signals. J. Biol. Chem. 283, 24245-24253.

Pitout J.D., Nordmann P., Poirel L. (2015). Carbapenemase-Producing Klebsiella pneumoniae, a Key Pathogen Set for Global Nosocomial Dominance. Antimicrob. Agents. Chemother. 59, 5873-5884.

Rosenblum R., Khan E., Gonzalez G., Hasan R., Schneiders T. (2011). Ge-netic regulation of the ramA locus and its expression in clinical isolates of Klebsiella pneumoniae. Int. J. Antimicrob. Agents. 38, 39-45.

Sader H.S., Castanheira M., Flamm R.K., Mendes R.E., Farrell D.J., Jones R.N. (2015). Tigecycline activity tested against carbapenem-resistant En-terobacteriaceae from 18 European nations: results from the SENTRY sur-veillance program (2010-2013). Diagn. Microbiol. Infect. Dis. 83, 183-186.

Sheng Z.K., Hu F., Wang W., Guo Q., Chen Z., Xu X., Zhu D., Wang M. (2014). Mechanisms of tigecycline resistance among Klebsiella pneu-moniae clinical isolates. Antimicrob. Agents. Chemother. 58, 6982-6985.

Sievert D.M., Ricks P., Edwards J.R., Schneider A., Patel J., Srinivasan A., Kallen A., Limbago B., Fridkin S.; National Healthcare Safety Network (NHSN) Team and Participating NHSN Facilities. (2013). Antimicro-bial-resistant pathogens associated with healthcare-associated infec-tions: summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2009-2010. Infect. Control. Hosp. Epidemiol. 34, 1-14.

Veleba M., Higgins P.G., Gonzalez G., Seifert H., Schneiders T. (2012). Characterization of RarA, a Novel AraC Family Multidrug Resistance Regulator in Klebsiella pneumoniae. Antimicrob. Agents. Chemother. 56, 4450-4458.

Villa L., Feudi C., Fortini D., García-Fernández A., Carattoli A. (2014). Ge-nomics of KPC-producing Klebsiella pneumoniae sequence type 512 clone highlights the role of RamR and ribosomal S10 protein muta-tions in conferring tigecycline resistance. Antimicrob. Agents. Chemo-ther. 58, 1707-1712.

Wang X., Chen H., Zhang Y., Wang Q., Zhao C., Li H., He W., Zhang F., Wang Z., Li S., Wang H. (2015). Genetic characterisation of clinical Klebsiella pneumoniae isolates with reduced susceptibility to tigecy-cline: Role of the global regulator RamA and its local repressor RamR. Int. J. Antimicrob. Agents. 45, 635-640.

n m ll aer molecular analysis of the ramra locus in ... · in clinical klebsiella pneumoniae...

Documents