A novel TFG mutation causes Charcot-Marie-Tooth disease type 2 and impairs

TFG function

Supplemental materials

Appendix e-1

e-Methods for linakage analysis

The 22 individuals indicated by dots in Figure 1A were recruited for linkage analysis.

The genotyping of them with ~300,000 markers was performed by the Illumina

Infinium assay using the HumanCytoSNP-12 BeadChip (Illumina, San Diego, CA).1,2

The average call rate per SNP was 98.3%. PedCheck was used to assess the

Mendelian consistency.3 Incompatibilities at 112 (0.04%) markers were detected and

therefore removed from the data. Since presence of linkage disequilibrium (LD) may

inflate multipoint linkage statistics,4,5 SNPs within a 50-SNP window that had

variance inflation factor (VIF) greater than 2 (corresponding to r2 > 0.5) were pruned

out using PLink.6,7 After the quality control and the LD-based pruning, the number of

remaining markers was 3,355. Merlin (version 1.1.2) was then used to assess

information content of these markers and to perform multipoint parametric linkage

analysis.8 The disease allele frequency was set to 0.00001. The penetrance for

homozygous normal, heterozygous, and homozygous affected were set to 0.0001,

1.000, and 1.000 respectively.

e-Methods for in vitro functional studies

Expression plasmids. A fragment containing full-length coding region of TFG was

subcloned into the pcDNA3.1(-) vector (Invitrogen, Grand Island, NY ) to generate

TFG expression plasmids (table e-2). In some experiments, full length TFG was also

subcloned into pFLAG-CMV-5a (Sigma, St. Louis, MO) or pcDNA 3.1/Myc-His

vector for expression of FLAG-tagged or Myc-tagged TFG. The mutations c.806G>T

(p.Gly269Val) and c.854C>T (p.Pro285Leu) were introduced into the expression

plasmids, separately, by using QuikChange Site-Directed Mutagenesis method

(Stratagene, Santa Clara, CA) (table e-2).

Cell culture and transfection. HEK293 and HeLa cells were maintained in DMEM

medium supplemented with 10% fetal bovine serum in a humidified incubator at 37°C

under 5% CO2. Transient transfection was performed using the calcium phosphate

precipitation method.9,10 For endogenous TFG depletion, siRNA specifically targeting

the 3’UTR of TFG was transfected by using Lipofectamine 2000  (Invitrogen) (table e-

2).

Western blot analysis and protein solubility studies. Forty-eight hours post-

transfection, cells were lysed with RIPA buffer. The lysates were used for blotting of

total proteins and the amount of the protein was quantified using a Bradford-based

assay kit (Bio-Rad, Hercules, CA). To determine the protein solubility profile,

sequential extractions were performed. Transfected cells were lysed in RIPA buffer

and the cell lysates were centrifuged generating the soluble fraction. The pellet was

further solubilized using urea buffer (7M urea, 2M thiourea, 1% ASB-14, 40mM Tris,

pH 8.5) to recover insoluble fraction. Sixty microgram of protein extract was

separated by 10% SDS-PAGE and transferred to PVDF membranes. After the

blocking step with 5% nonfat dry milk, the membrane was incubated with primary

antibodies followed by HRP–conjugated secondary antibodies (table e-3). Detection

was performed with a standard enhanced chemiluminescence method. Quantification

analysis was performed by using NIH Image J software.

Real-time quantitative PCR (RT-qPCR) and ER stress detection. To measure the

TFG mRNA levels in the transfected HEK293 cells, total RNA from the harvested

cells was prepared using TRIzol method (Invitrogen). Reverse transcription (RT) was

carried out using the QuantiTect Reverse Transcription kit (Qiagen, Valencia, CA).

The RT-qPCR assays were performed using a 7500 Fast Real-Time PCR System (Life

Technologies, Grand Island, NY) in a 96-well format using the Fast SYBR® Green

Master Mix (Life Technologies). The relative gene expression was normalized against

GAPDH expression.

To investigate the effect of Gly269Val mutant on the unfolded protein response,

biomarkers of ER stress, such as expression of BiP11 and CHOP12 and alternative

splicing of XBP-1,13 were examined in the transfected HEK293 cells. For RT-qPCR

analysis of XBP-1 splicing, RT product was used as a template with primers specific

to spliced XBP-1 and GAPDH.13 For analyzing expression of BiP and CHOP, a RT-

qPCR was performed using primers specific for BiP and CHOP with GAPDH as a

reference. The sequences of the primers used in this study are shown in table e-2.

Immunofluorescence studies. Forty-eight hours post-transfection, cells were fixed in

4% paraformaldehyde, permeablized with 0.2% Tween-20 and blocked with 1% BSA

before incubation in primary antibody overnight at 4°C (table e-3). Bound primary

antibodies were detected using Alexa-conjugated secondary antibodies. Images were

captured with an Olympus FluoView FV10i confocal laser scanning fluorescence

microscopy system with a 60X oil immersion objective (Olympus, Tokyo, Japan).

Cell viability assay. MTT colorimetric assay was used to assess the cell viability of

transfected HEK293 cells. Forty-eight or 72 hours post-transfection, MTT solution (5

mg/ml) was added to growing cultures and incubated at 37˚C for 4 h. The formed

formazan dye from metabolically active viable cells was dissolved in DMSO and the

absorbance of dissolved formazan at 570 nm was measured using a Tecan Infinite-

M1000 plate reader (Tecan, San Jose, CA).

Investigating protein secretory pathway by the secreted Gaussia luciferase assay.

The Gaussia luciferase (Gluc) is a secreted reporter and has been utilized to monitor

protein secretory pathway.14,15 The secreted Gluc activities in the culture medium from

transfected cells expressing both Gluc and Firefly luciferase (Fluc) can be

quantitatively measured and normalized by the corresponding internal Fluc activities

in the cell lysates to assess the protein secretory efficiency. Thus, we co-transfected

HEK293 cells with a plasmid expressing Gluc (pCMV-Gaussia Luc; Thermo

Scientific), a plasmid encoding Fluc (pCMV-Red Firefly Luc; Thermo Scientific) and

along with TFG wild-type or mutant vector constructs. Forty-eight hours post-

transfection, for each set of readings, cell-free conditioned medium was assayed for

Gluc activity, which was then normalized to their corresponding Fluc activity of the

cell lysate.

siRNA-mediated TFG depletion studies. For depleting endogenous TFG, the siRNA

specifically targeting the 3’UTR of TFG (table e-2) was transfected into HEK293

cells and the efficiency of TFG depletion was evaluated by western blot analysis. For

investigating the effect of TFG depletion on cell viability, HEK293 cells transfected

with wild-type TFG or mutant TFG constructs or empty vectors were simultaneously

treated with 75 nM siRNA in a 96-well plate. Forty-eight or 72 hours post-

transfection, cell viability was measured by MTT assay. For evaluating the effect of

TFG depletion on protein secretory pathway, HEK293 cells in a 96-well plate were

co-transfected with siRNA (75 nM), Gluc and Fluc reporter plasmids (60 ng of each),

and along with empty vector, wild-type TFG, or mutant TFG constructs (60 ng). The

normalized secreted Gluc activities were analyzed at 48 hours after transfection.

Appendix e-2

e-Results

Clinical features of the patient IV-2

The clinical features of the proband (IV-2) are used to examplify the disease in this

family. IV-2 is a 36-year-old man who had manifested slowly progressive weakness

of distal lower limbs since the age of 28 years. He started to walk at a normal age.

Physical examination at age 36 revealed high-arched feet, hammer toes, generalized

areflexia, atrophy and weakness of the intrinsic muscles of the hands (score 4/5 in

Medical Research Council Scale), feet (2/5) and also the muscles in the legs, resulting

in impaired dorsiflexion and plantar flexion of the feet (4 and 4+/5). Despite a lack of

sensory complaints, mildly diminished sensation for all modalities in regions distal to

the ankles was observed. Nerve conduction studies demonstrated the presence of an

axonal sensorimotor polyneuropathy with normal NCVs but reduced amplitudes.

Gly269Val TFG mutants do not provoke ER stress or increase cellular toxicity.

The accumulated cytoplasmic protein aggregates might provoke ER stress or lead to

cellular toxicity. Thus, we examined whether the Gly269Val TFG mutants undermine

cell viability. MTT assay was used to assess the cell viability of HEK293 cells

transfected with vectors expressing wild-type TFG, Gly269Val TFG, or empty vector.

Compared with empty vector control, overexpression of neither wild-type TFG nor

the Gly269Val mutant had any significant effect on cell viability (figure e-6A),

suggesting that Gly269Val TFG did not have a significant cellular toxicity.

To investigate whether mutant TFG induces ER stress, the biomarkers of ER

stress, including expression of Bip and CHOP and alternative splicing of XBP-1, were

examined in the transfected HEK293 cells. Cells exposed to a stress stimulator

dithiothreitol (DTT) or transfected to express Arg89Cys myelin protein zero, a

previously identified ER stress-inducing mutant protein,16 were used as the positive

controls. As shown in figure e-6B, cells expressing Gly269Val TFG did not have a

significantly higher level of Bip or spliced XBP-1 compared with the cells expressing

wild-type TFG, suggesting that the Gly269Val TFG did not induce ER stress. To

investigate whether the Gly269Val TFG mutant increases the susceptibility of cells to

external ER stress, transfected cells were exposed to 1mM DTT and the expression of

ER markers were examined. Similarly, DTT treatment did not significantly alter the

levels of BiP, CHOP, or spliced XBP-1 in the cells expressing Gly269Val TFG when

compared with the cells expressing wild-type TFG (figure e-6C), indicating that the

Gly269Val TFG did not increase the cellular susceptibility to ER stress.

figure e-1. Photographs of the patient III-23 with the TFG p.Gly269Val mutation

and advanced CMT

Pronounced atrophy of intrinsic muscles of the hands (A-C) and muscles of the legs

(D) of the patient III-23 at age 57 years.

figure e-2. Linkage analysis

(A) The results of parametric multipoint linkage analysis on chromosome 3 of the

family with CMT2. (B) The only locus with a LOD score greater than 3 is on

chromosome 3, between rs17021771 (chr3:84796650) and rs6789667

(chr3:103526835), where TFG gene resides.

figure e-3. Time-course of TFG degradation

HEK293 cells were transfected with plasmids encoding either wild-type TFG or

Gly269Val TFG. At 48 hours post-transfection, the cells were treated with 100 g/ml

cyclohexamide (CHX) for 0, 1, 2, 4, or 8 hours and then harvested. Forty microgram

of total-protein cell extracts for each cell lysate were analyzed by immunoblotting

using TFG-specific antibody. Actin was used as an internal loading control. A

representative blot of three independent experiments is shown.

figure e-4. Intracellular localization of the wild-type and mutant Gly269Val TFG

proteins

(A) Representative confocal images of HEK293 cells co-transfected with plasmids

encoding TFG (either wild-type or p.Gly269Val mutant) and DesRed-ER (an ER

marker; Clontech). 48 hours post-transfection, the cells were stained with anti-TFG

antibody and green fluorophore-labeled secondary antibodies. Mutant Gly269Val did

not substantially change its subcellular localization and stayed mostly in the ER. (B)

Representative images of HEK293 cells co-transfected with plasmids encoding wild-

type or p.Gly269Val TFG and plasmids encoding Sec16B. Cells were immunostained

against TFG (Green) and Sec16B (Red). Similar Sec16B co-localization patterns were

seen in both wild-type and Gly269Val TFG. (C) Representative images of HEK293

cells co-transfected with plasmids encoding FLAG-tagged wild-type TFG (Green)

and Myc-tagged Gly269Val TFG (Red). The presence of both wild-type and

Gly269Val mutant TFG in the same punctate structures suggests that the Gly269Val

mutant did not lose their ability to assemble in an oligomeric complex with wild-type

TFG. Scale bars, 10 mm.

figure e-5. Overexpression of Gly269Val TFG in HEK293 cells does not have a

significant effect on protein secretion efficiency.

The secreted Gaussia luciferase (Gluc) activities in the culture medium of HEK293

cells co-transfected with plasmids expressing Gluc and Firefly luciferase (Fluc) were

measured and normalized with the control Fluc activities in the cell lysates to assess

the protein secretory efficiency. The normalized secreted Gluc activities were similar

in HEK293 cells transfected with wild-type (WT) or Gly269Val TFG constructs or

empty vectors. The value obtained for the empty vector-transfected cells was set as

100%. Results are presented as mean ± SEM from 12 independent transfections. The

“N.S.” means no statistically significant difference.

figure e-6. Cell viability and the unfold protein response (UPR)

(A) Cell viability was assessed using the MTT colorimetric assay in HEK293 cells

transfected with wild-type or Gly269Val TFG constructs. Empty vector-transfected

cells were used as controls. Values are shown as means ± SEM of eight independent

experiments. The expression of Gly269Val TFG did not have any significant effect on

cell viability at 48 or 72 hours after transfection. (B) The activation of UPR was

evaluated by quantitative real-time PCR (qRT-PCR), measuring the XBP-1 mRNA

splicing and the expression levels of BiP mRNA. Cells exposed to DTT or transfected

with plasmid expressing Arg98Cys myelin protein zero (MPZ) represented the

positive controls. All values (mean ± SEM, n = 6) were first normalized to GAPDH

levels. (C) Susceptibility to external ER stress of HEK293 cells transfected with

plasmids expressing wild-type or Gly269Val TFG was evaluated by measuring XBP-1

splicing and the mRNA levels of BiP and CHOP using qRT-PCR at 5 hours after

treating with 1 mM DTT. Values are shown as means ± SEM of three independent

experiments. None of these UPR parameters was significantly up-regulated in cells

expressing the Gly269Val mutation with or without DTT treatment. *p< 0.05, **p<

0.01.

table e-1. Bioinformatic analysis of exome sequencing in the two affected individuals of the pedigree with axonal CMT

III-8 IV-3

Total bases sequenced 30,658,115.6 Kb 30,862,079.4 Kb

Raw heterozygous variants (number) 15,869 15,238

Common heterozygous variants 6,388

Variants not in dbSNP or 1000 genomes database 163

Variants not found in other 24 non-CMT patients’ exome databases 97

Variants resulting in amino acid sequence changes 57

Variants completely segregating with CMT phenotype in the pedigree 1

table e-2. Primer or oligonucleotide sequences used in this study

Primer sequences used for cloning of TFG

TFG-HindIII-F 5’- ACTAAGCTTACCATGAACGGACAGTTGG -3’

TFG-BamHI-R 5’- ACTGGATCCCTATCGATAACCAGGTCC -3’

Primer sequences used for site-directed mutagenesis

TFG-G269V-F 5’- CAGCCTCAACAGTATGTTATTCAGTATTCAGC -3’

TFG-G269V-R 5’- GCTGAATACTGAATAACATACTGTTGAGGCTG -3’

TFG-P285L-F 5’- CTGGACCTCAACAACTTCAGCAGTTCCAGG -3’

TFG-P285L-R 5’- CCTGGAACTGCTGAAGTTGTTGAGGTCCAG-3’

Primer sequences used for TFG mRNA expression by using real-time quantitative PCR

TFG-F 5’- GTTTCAGGGCCACCCAGTGCT -3’

TFG-R 5’ - GCCGGCCTGTTGCTGGTACTG -3’

GAPDH-F 5’ - GCAGCCTCCCGCTTCGCTC -3’

GAPDH-R 5’ - GCGCCCAATACGACCAAATCCGTT -3’

Primers sequences used for analysis of UPR by using real-time quantitative PCR

XBP1-F 5’- GGTCTGCTGAGTCCGCAGCAGG -3’

XBP1-R 5’- GGGCTTGGTATATATGTGG -3’

BiP-F 5’- TGCAGCAGGACATCAAGTTC -3’

BiP-R 5’- GGCTGGTACAGTAACAACTGC -3’

CHOP-F 5’- GCTCAGGAGGAAGAGGAGGA -3’

CHOP-R 5’ – TCCTGCTTGAGCCGTTCATT -3’

GAPDH-F 5’ - GCAGCCTCCCGCTTCGCTC -3’

GAPDH-R 5’ - GCGCCCAATACGACCAAATCCGTT -3’

TFG siRNA targeting the 3’UTR of TFG

TFG siRNA 5’-ACCAAUUAAUGUAGCUGCUAGCUAU-3’

table e-3. Antibodies used for analysis

Western blotting

Antibody Company and product code Dilution

TFG (rabbit polyclonal) abcam 86606 1:2000

actin (mouse monoclonal) Millipore mab1501 1:5000

Goat polyclonal Secondary Antibody to Rabbit

IgG - H&L (HRP)abcam 6721 1:5000

Rabbit polyclonal Secondary Antibody to Mouse

IgG - H&L (HRP) abcam 6728 1:5000

Immunofluorescence

Antibody Company and product code Dilution

TFG (mouse monoclonal) Novus NBP2-01438 1:200

sec16B (rabbit polyclonal) abcam 106645 1:200

Alexa Flour 488 Goat anti-mouse IgG(H+L) Invitrogen a11001 1:500

Alexa Flour 555 Goat anti-rabbit IgG(H+L) Invitrogen a21428 1:500

e-References

e1. Gunderson KL, Steemers FJ, Lee G, Mendoza LG, Chee MS. A genome-wide

scalable SNP genotyping assay using microarray technology. Nat Genet 2005;37:549-

554.

e2. Steemers FJ, Chang W, Lee G, Barker DL, Shen R, Gunderson KL. Whole-

genome genotyping with the single-base extension assay. Nat Methods 2006;3:31-33.

e3. O'Connell JR, Weeks DE. PedCheck: a program for identification of genotype

incompatibilities in linkage analysis. Am J Hum Genet 1998;63:259-266.

e4. Boyles AL, Scott WK, Martin ER, et al. Linkage disequilibrium inflates type I

error rates in multipoint linkage analysis when parental genotypes are missing. Hum

Hered 2005;59:220-227.

e5. Goode EL, Badzioch MD, Jarvik GP. Bias of allele-sharing linkage statistics in the

presence of intermarker linkage disequilibrium. BMC Genet 2005;6 Suppl 1:S82.

e6. Purcell S, Neale B, Todd-Brown K, et al. PLINK: a tool set for whole-genome

association and population-based linkage analyses. Am J Hum Genet 2007;81:559-

575.

e7. Howrigan DP, Simonson MA, Keller MC. Detecting autozygosity through runs of

homozygosity: a comparison of three autozygosity detection algorithms. BMC

Genomics 2011;12:460.

e8. Abecasis GR, Cherny SS, Cookson WO, Cardon LR. Merlin--rapid analysis of

dense genetic maps using sparse gene flow trees. Nat Genet 2002;30:97-101.

e9. Graham FL, van der Eb AJ. A new technique for the assay of infectivity of human

adenovirus 5 DNA. Virology 1973;52:456-467.

e10. Wigler M, Silverstein S, Lee LS, Pellicer A, Cheng Y, Axel R. Transfer of

purified herpes virus thymidine kinase gene to cultured mouse cells. Cell

1977;11:223-232.

e11. Zhang K, Kaufman RJ. Signaling the unfolded protein response from the

endoplasmic reticulum. J Biol Chem 2004;279:25935-25938.

e12. Li F, Hayashi T, Jin G, et al. The protective effect of dantrolene on ischemic

neuronal cell death is associated with reduced expression of endoplasmic reticulum

stress markers. Brain Res 2005;1048:59-68.

e13. Hirota M, Kitagaki M, Itagaki H, Aiba S. Quantitative measurement of spliced

XBP1 mRNA as an indicator of endoplasmic reticulum stress. J Toxicol Sci

2006;31:149-156.

e14. Badr CE, Hewett JW, Breakefield XO, Tannous BA. A highly sensitive assay for

monitoring the secretory pathway and ER stress. PLoS One 2007;2:e571.

e15. Hewett JW, Tannous B, Niland BP, et al. Mutant torsinA interferes with protein

processing through the secretory pathway in DYT1 dystonia cells. Proc Natl Acad Sci

U S A 2007;104:7271-7276.

e16. Saporta MA, Shy BR, Patzko A, et al. MpzR98C arrests Schwann cell

development in a mouse model of early-onset Charcot-Marie-Tooth disease type 1B.

Brain 2012;135:2032-2047.