ORIGINAL ARTICLE

Octamer and heat shock elements regulate transcriptionfrom the AcMNPV polyhedrin gene promoter

M. Senthil Kumar Æ Aruna Ramachandran ÆSeyed E. Hasnain Æ Murali Dharan Bashyam

Received: 5 August 2008 / Accepted: 12 January 2009 / Published online: 17 February 2009

� Springer-Verlag 2009

Abstract The baculovirus expression vector system

exploits the polyhedrin (polh) promoter for high expression

of foreign proteins in insect cells. The mechanism of basal

and hyperactivated transcription from this promoter, how-

ever, remains poorly understood. We have analyzed the

4-kb upstream region of the polh promoter; deletion of two

separate parts of the 4-kb upstream region, harboring the

Oct binding site and the heat shock element, respectively,

resulted in significant reduction of reporter gene expression

regulated by the polh promoter. Insect cell host factors

could bind to these elements in vitro. Moreover, these

elements could activate polh transcription during viral

infection when present upstream of a minimal polh pro-

moter in transient expression reporter assays. Our results

suggest the possible existence of transcription factors

belonging to the POU and heat shock transcription factor

family in Spodoptera frugiperda cells and support the

hypothesis that host proteins may play a major role in

activating transcription from the polh promoter.

Introduction

Baculoviruses [in particular, Autographa californica mul-

tiple nucleopolyhedrovirus virus (AcMNPV)] have been

used extensively for expression of foreign genes in insect

cells [1–3]. In order to improve the efficiency of the

baculovirus expression vector system (BEVS), efforts to

understand the regulation of the polyhedrin gene (polh)

promoter have been the focus of several studies during the

past two decades [4–7]. Transcription of the polh gene is

activated very late in the baculovirus life cycle and is

driven by a virally encoded, a-amanitin- and tagetitoxin-

resistant RNA polymerase [8, 9]. The polh promoter

belongs to the class of initiator promoters and contains a

12-bp initiator (AATAAGTATTTT) that includes the

transcription start site [10, 11]. Mutations within the initi-

ator result in a 2,000-fold reduction in transcription

efficiency [10]. Transcription activation of the polh pro-

moter has been shown to depend on the presence of an

A ? T-rich region present downstream of the transcription

start point, called the ‘‘burst’’ sequence, since it regulates

M. S. Kumar � M. D. Bashyam (&)

Laboratory of Molecular Oncology,

Centre for DNA Fingerprinting and Diagnostics,

Block no. 7, 5-4-399/B, Gruhakalpa complex,

Nampally, Hyderabad 500001, India

e-mail: bashyam@cdfd.org.in

M. S. Kumar � A. Ramachandran � S. E. Hasnain

Laboratory of Molecular and Cellular Biology,

Centre for DNA Fingerprinting and Diagnostics,

Block no. 7, 5-4-399/B, Gruhakalpa complex,

Nampally, Hyderabad 500001, India

S. E. Hasnain

University of Hyderabad, Hyderabad, India

S. E. Hasnain

Jawaharlal Nehru Centre for Advanced Scientific Research,

Bangalore 560064, India

Present Address:M. S. Kumar

Department of Molecular Microbiology and Infectious Diseases,

College of Medicine, Florida International University,

Miami, FL 33199, USA

Present Address:A. Ramachandran

Urology Department, Children’s Hospital Boston,

Boston, MA 02115, USA

123

Arch Virol (2009) 154:445–456

DOI 10.1007/s00705-009-0324-x

the burst of transcription that occurs during the very late

phase of AcMNPV infection in Spodoptera frugiperda

(Sf9) insect cells [10, 12]. The role of several host factors in

polh transcription has also been reported. One of the ear-

liest reports on the role of host proteins in very late gene

expression showed that a host factor from uninfected Sf9

cells could bind to the 96-bp minimal polh promoter [13].

In our previous study, the polyhedrin promoter binding

protein (PPBP), which binds to the initiator sequence of the

polh promoter, was shown to be required for transcription

[5, 14]. In our subsequent studies, PPBP was also shown to

bind to the baculovirus p10 promoter with a similar binding

affinity to that of the polh promoter [15] and was charac-

teristically different from the TATA binding protein (TBP)

present in Sf9 cells [16]. Sp-family like factors were

reported for the first time from insect cells and they were

shown to bind to and activate transcription from the Sp1

binding sites present about 450 bp upstream from the polh

promoter [7]. A host factor from Sf9 cells (hr1-BP) was

shown to bind the hr1 sequence present about 5 kb

upstream from the polh promoter. hr1-BP was also iden-

tified in nuclear extracts of mammalian cells, and it was

shown that hr1 could enhance transcription from heterol-

ogous promoters such as CMV and Drosophila hsp70 [4].

The aim of the current study was to analyze the sequences

upstream of the polh initiator promoter for the presence of

cis-acting elements and to identify and characterize host

factors that may interact with these elements to augment

transcription. Our results indicate that insect cell host

factors, probably belonging to the POU family as well as

the heat shock transcription factor (HSTF) family, may

play a role in transcription activation from the polh

promoter.

Materials and methods

Maintenance of Sf9 insect cells and transient expression

assay

Spodoptera frugiperda (Sf9) cells were grown at 27�C in

Trichoplusia ni Media Formulation Hink (TNMFH) med-

ium containing 10% fetal bovine serum (Invitrogen, USA)

and 1% antibiotic–antimycotic solution (Invitrogen, USA)

as described previously [7]. Cell viability was estimated by

staining with 10% trypan blue and only cultures that

exhibited greater than 95% viability were used for further

experiments.

Lipofectin (Invitrogen, USA)-mediated transfection of

Sf9 cells and luciferase assay were performed as described

earlier [7]. Sf9 cells were infected with the AcMNPV C-6

strain, 6-h post-transfection, at a multiplicity of infec-

tion (MOI) of 10, as per established protocols [7, 17].

Protein estimation of the samples was carried out using a

bicinchoninic acid protein assay (Pierce, USA) to nor-

malize the luciferase assay values [7]. All assays were

carried out in triplicate and repeated three times. Average

values of the three results (±SEM) are shown. All results

had a statistically significant difference of P \ 0.005 by

Welsh two-sample t test.

Construction of recombinant viruses

vMAluc carries the intact 4-kb upstream region of the polh

promoter, upstream of the luciferase gene instead of the

polh gene. The construction of vMAluc is described else-

where [7]. The recombinant virus vdSXluc was constructed

using the BacPak baculovirus expression system (Clontech,

USA) using pdSXKNluc as the transfer vector, as per

manufacturer’s instructions. Therefore, vdSXluc is identi-

cal to vMAluc except that the SacII–XhoI region is deleted.

Viral titers were determined using the Fastplax titer kit

(Novagen, USA) as per manufacturer’s instructions.

Molecular cloning

Standard procedures were followed for the manipulation of

plasmid DNA and transformation of Escherichia coli

DH5a cells [18]. Positive clones were identified using

restriction analysis and confirmed by DNA sequencing

(ABI 3100 and ABI Prism 377).

Construction of pKNluc derivatives

pKNluc is derived from the pVL1393 baculovirus transfer

vector [19] and carries the firefly luciferase gene in place of

polh gene. pKNluc was treated with various combinations

of restriction enzymes (shown in Fig. 1a), end-filled with

Klenow fragment of E. coli DNA polymerase I and reli-

gated to generate the deletion constructs (the abbreviated

restriction enzyme sites were used to name the con-

structs and are indicated here underlined): pdMMKNluc

(MluI–MluI deletion), pdXMKNluc (XhoI–MluI deletion),

pdSXKNluc (SacII–XhoI deletion) and pdNSKNluc (NdeI–

SacII deletion). Oligonucleotide pairs harboring the heat

shock elements (HSE) from the SacII–XhoI region (listed

in Table 1) were synthesized with SacII–XhoI overhangs

and cloned into SacII–XhoI-restricted pKNluc to yield

pHSEKNluc.

Construction of pAJpolluc derivatives

pAJpolluc contains the 92-bp EcoRV–BamHI promoter

fragment obtained from the transfer vector pVL1393 [19]

and cloned at the HincII–BamHI site of plasmid pAJluc

(a derivative of pUC18 carrying the 1,892-bp luc gene [19]

446 M. S. Kumar et al.

123

ligated at the BamHI site), placing it upstream from the

luciferase reporter gene [7]. Since pAJpolluc, unlike

pKNluc, does not harbor the 4-kb upstream sequence of the

polh promoter, pAJpolluc was therefore employed to test if

any of the fragments of the 4-kb polh upstream region

could significantly alter the expression of the luciferase

reporter gene when cloned upstream of the polh promoter.

For construction of pSXpolluc, the SacII–XhoI fragment

from pKNluc was amplified by polymerase chain reaction

using specific primer pairs harboring PstI sites (listed in

Table 1) and subsequently cloned in the PstI restriction site

of pAJpolluc. Two smaller fragments from the SacII–XhoI

region were also separately amplified using primer pairs

harboring PstI restriction sites (listed in Table 1) and

cloned in the PstI restriction site of pAJpolluc to generate

pSXApolluc (containing the initial 250 bp of the SacII–

XhoI region) and pSXBpolluc (containing the initial

500 bp of the SacII–XhoI region), respectively (Fig. 2a).

The XhoI–MluI region was divided into three smaller

overlapping subregions, and each subregion was separately

amplified using primer pairs listed in Table 1 and cloned

in the PstI restriction site of pAJpolluc to generate

pXMApolluc (containing bp 1–200 of the XhoI–MluI

region; 1, corresponding to the first base of the XhoI

restriction site), pXMBpolluc (containing bp 170–360 of

the XhoI–MluI region) and pXMCpolluc (containing bp

320–574 of the XhoI–MluI region), respectively (Fig. 2c).

Oligonucleotides containing HSE and the Oct binding site

(OBS) (listed in Table 1) were synthesized with PstI

restriction ends and cloned into PstI-restricted pAJpolluc.

Identification of potential transcription factor binding

sites

For the identification of transcription factor binding sites,

the SacII–XhoI and the XhoI–MluI regions were submitted

separately online to transcription element search system

(TESS) (http://www.cbil.upenn.edu/cgi-bin/tess/tess) [20]

using the default search parameters.

Electrophoretic mobility shift assay

Nuclear extracts from uninfected Sf9 cells were prepared

as described [21]. Electrophoretic mobility shift assay

Fig. 1 a Each derivative was

constructed as described in

‘‘Materials and methods’’. The

numbers below the restriction

map of pKNluc indicate the

position with respect to

transcription start point (TSP) of

the polh gene. Ppolh polyhedrin

promoter, luc luciferase reporter

gene. b Results of transient

expression of pdSXKNluc,

pdXMKNluc, pdMMKNluc,

pdSNpolluc and pKNluc in Sf9cells. c Sf9 cells were infected at

equal MOI (10) with either the

recombinant virus vdSXluc

(carrying the SacII–XhoI region

deletion) or vMAluc (carrying

the intact 4-kb region), and the

luciferase assay was carried out

at 60 hpi. The luciferase values

are expressed as relative

luciferase units (RLU) per mg of

protein

Regulation of AcMNPV polyhedrin promoter transcription 447

123

(EMSA) was carried out essentially as described earlier [7].

HSE and OBS oligonucleotides (listed in Table 1) were

labeled with [c - 32P] ATP (Amersham Biosciences,

USA ([5,000 Ci mmol-1)) using T4 DNA polynucleotide

kinase (New England Biolabs, USA). One nanogram

(&104 cpm) of the labeled oligonucleotide was incubated

with 5–10 lg of nuclear extract in the presence of binding

buffer containing 10 mM Tris–HCl, pH 7.5, 120 mM

NaCl, 1 mM EDTA, pH 8.0, 10 mM PMSF, 5% glycerol

and 1 lg of poly-dI.dC at 25�C for 30 min and was

resolved at 4�C in a 6% polyacrylamide gel (29:1 acryl-

amide-N,N0-methylene bisacrylamide) in 0.59 TGE buffer

(Tris Glycine EDTA). After electrophoresis, the gel was

dried and exposed to either Hyperfilm (Amersham Bio-

sciences, USA) at -70�C or a PhosphorImager screen (Fuji

Film, Tokyo, Japan) at room temperature for 12–18 h.

Determination of DNA major/minor groove interaction

One nanogram of radiolabeled OBS was incubated with

varying concentrations (0.25–2 mM) of either distamycin A

(Sigma, St. Louis, USA) or methyl green (PolySciences Inc,

USA) for 30 min at room temperature. 10 lg of Sf9 nuclear

extract was then added, and the tubes were further incubated

at room temperature for 15 min. The samples were then

resolved in a 5% polyacrylamide gel as described above.

UV crosslinking and Southwestern blotting

of DNA–protein interaction

The EMSA binding reactions were carried out as described

before, transferred to a fresh sheet of Parafilm and exposed

to 1,200 kJ of UV in a UVP CL1000 UV crosslinker

(Stratagene). The binding reactions were then transferred to

fresh tubes, and equal volumes of 29 SDS loading buffer

(0.00625 M Tris–Cl, pH 6.8, 2% SDS, 5% b-mercap-

toethanol, 10% glycerol, 0.025% bromophenol blue) were

added to each tube. The tubes were boiled for 5 min at 100,

and the samples were electrophoresed on a 10% SDS-

polyacrylamide gel (29:1 acrylamide:N,N0 methylenebis-

acrylamide) in Tris–glycine buffer (25 mM Tris, 192 mM

glycine, pH 8.3, 0.1% SDS). After electrophoresis, the gel

was dried and subjected to autoradiography as described

earlier. Southwestern blotting was carried out essentially as

described [15] and involves identifying and characterizing

DNA-binding proteins by their ability to bind to specific

oligonucleotide probes. The proteins are separated by SDS

electrophoresis, transferred to a nitrocellulose membrane

and probed with a radiolabeled oligonucleotide harboring

the binding site of the protein under study.

Results

Deletion analysis of the 4-kb upstream region

of the polh promoter reveals two regions involved

in enhancement of transcription

The plasmid pKNluc contains the complete 4-kb upstream

region of the polyhedrin gene, cloned upstream of a polh-

luciferase reporter cassette [7]. Using convenient restric-

tions sites, four separate parts of the 4-kb upstream region

were deleted from pKNluc, as described in ‘‘Materials and

methods’’ (Fig. 1a). The deletion constructs were evaluated

Table 1 Primers used for

generating derivatives of

pAJpolluc and pKNluc

a Plasmid constructs, which

were generated by direct

cloning of annealed

oligonucleotides, are

underlined. The sequence of

only the top strand of each

oligonucleotide is givenb The DHSE oligonucleotide

pair was used for EMSA as well

as for generation of

pDHSEpollucc The OBS oligonucleotide was

used for cloning in pAJpolluc as

well as for EMSA

Plasmid Primer pairs/oligonucleotides (50–30)

pSXpolluc sx-f:GATATCCTGCAGCCGCGGGGTATTGAACCGCGCGAT

sx-r:GATATCCTGCAGCTCGAGGTGCAGCGAGTCAACGCG

pSXApolluc sx-1-250-f:GATATCCTGCAGGGTATTGAACCGCGCGATCCGACAAATCCA

sx-1-250-r:GATATCCTGCAGGCGCAAAAAACCGAGGAACTTGTTAAAAAA

pSXBpolluc sx-1-250-f (see above)

sx-1-500-r:GATATCCTGCAGCGACCCGCTGTATTTGCAGCCGCATACAGT

pMXApolluc A-f: GATATCCTGCAGCTCGCTGCACCTCGAGCAGTTCGT

A-r: GATATCCTGCAGTATGCGCAAACAACCCAACTGTAT

pMXBpolluc B-f: GATATCCTGCAGAAAATATATACAGTTGGGTTGTTT

B-r: GATATCCTGCAGTTATTCCACACTTTGATCACTTGA

pXMCpolluc C-f: GATATCCTGCAGAATCGATGCAAGTGATCAAAGTGT

C-r: GATATCCTGCAGCAATCAAAGCTCGTGCCGGAACGC

pHSEpolluca AGCTTTTTTCTGCTTTCTTCGCAATCAGCTTAGTCACCCTTCTTCTAC

ATTCTTCTGCA

pHSEKNluc Same oligonucleotide pairs as for pHSEpolluc, but with SacII and XhoI overhangs

DHSEb AGCTTCGAGAAATTTCTCTCTCGTTGGTTCCAGAGACTCGAAT

GTTCGCGACTGCA

OBSc GTGATTTGCATCTGCA

448 M. S. Kumar et al.

123

by transient expression followed by AcMNPV infection in

Sf9 cells unless otherwise stated. AcMNPV infection was

carried out after plasmid transfection in all the transient

expression assays. The construct pdSXKNluc, which con-

tained a deletion of the SacII–XhoI region, exhibited a

significant reduction (threefold) in luciferase reporter

expression as compared to pKNluc when used to trans-

fect Sf9 cells. Reporter gene expression supported by

pdXMKNluc, which carries the XhoI–MluI deletion, was

drastically reduced (by tenfold) compared to pKNluc

(Fig. 1b). The deletion of either the NdeI–SacII region

(pdNSKNluc) or the MluI–MluI region (pdMMKNluc) did

not significantly affect expression from the polh promoter,

suggesting that these two regions may not be important for

polh-promoter-driven transcription (Fig. 1b). In all trans-

fections, equal amounts of plasmid constructs were used,

which was confirmed by dot blot hybridization (data not

shown). A recombinant virus harboring a deletion of the

SacII–XhoI region showed significant reduction in polh-

promoter-driven reporter gene expression, compared to the

control virus vMAluc [7], highlighting the importance of

this region in the viral context as well (Fig. 1c).

Identification of cis-acting elements in the 4-kb

upstream region of the polyhedrin promoter

If the deleted fragments (SacII–XhoI or XhoI–MluI) har-

bored cis-acting elements required for activation of

transcription from the polh promoter, then the same frag-

ments should result in enhancement of transcription from

the polh initiator promoter. In order to test this hypothesis,

we first divided the SacII–XhoI region into smaller frag-

ments as described in ‘‘Materials and methods’’ (Fig. 2a).

pSXBpolluc, when transiently expressed in Sf9 cells,

exhibited a consistent twofold enhancement in reporter

gene expression when compared to the pAJpolluc control

(Fig. 2b). Luciferase levels supported by pSXpolluc and

pSXApolluc in Sf9 cells were also significantly higher than

that supported by pAJpolluc (Fig. 2b). Similarly, the XhoI–

MluI region (569 bp) was divided into three overlapping

Fig. 2 Schematic

representations of sub-regions

of a the SacII–XhoI region and

c the XhoI–MluI region, which

were cloned separately into

pAJpolluc. b Results of

transient expression of

pAJpolluc derivatives harboring

different sub-regions of c the

SacII-XhoI region and d the

XhoI–MluI region in Sf9 cells

are also shown

Regulation of AcMNPV polyhedrin promoter transcription 449

123

fragments to generate derivatives of pAJpolluc, namely

pXMApolluc, pXMBpolluc and pXMCpolluc, respectively,

as described in ‘‘Materials and methods’’ (Fig. 2c). When

transient expression of these three constructs was carried

out in Sf9 cells, the plasmid pXMBpolluc supported a

consistent twofold enhancement in reporter gene expression

from the polh promoter as compared to pAJpolluc (Fig. 2d).

The plasmid pXMCpolluc showed a drastic reduction

in polyhedrin-promoter-driven luciferase reporter gene

expression. The NdeI–SacII fragment did not result in

enhancement of transcription from the polh promoter (data

not shown), corroborating results obtained from the corre-

sponding pKNluc deletion derivative. In order to identify

transcription factor binding sites in the SacII–XhoI and the

XhoI–MluI regions, computational analysis was carried out

using TESS [20]. In TESS, sequences that show significant

similarity to previously characterized transcription factor

binding sites are given a higher log-likelihood ratio score

(La). Table 2 shows the results obtained for the SacII–XhoI

and the XhoI–MluI regions. Binding sites for Oct tran-

scription factors (Oct-1, Oct-2, Oct-2.1, Oct-2C, etc.) were

identified in both SacII–XhoI and XhoI–MluI regions with a

high log-likelihood score (Table 2). Interestingly, the oct-

amer sequence present in the XhoI–MluI region was also

identified at an identical position with respect to the polh

promoter in related baculovirus, including Plutella xylo-

stella multiple nucleopolyhedrovirus virus, the well-

characterized BmNPV, Rachiplusia ou MNPV, etc. (data

not shown). We therefore decided to further characterize the

putative Oct-like factors from Sf9 cells. In the SacII–XhoI

region, sequences resembling HSEs [22] were identified

using TESS, but with a lower log-likelihood score. We still

Table 2 Transcription factor binding sites present in the SacII–XhoI and XhoI–MluI regions identified using TESS [20]

Transcription factor Positiona Lb Sequence Lac La/L

d Ppve

SacII–XhoI region

Oct-2.1 942 10 TGATTTGCAT 16.09 1.61 4.70E-03

NFIII 944 8 ATTTGCAT 14.52 1.82 2.60E-02

2-Oct 944 8 ATTTGCAT 14.35 1.79 3.40E-04

NFE3A 794 9 TGTGGTAAG 14.26 1.58 1.10E-02

6-Oct 944 8 ATTTGCAT 14.12 1.77 2.60E-02

4-Oct 944 8 ATTTGCAT 13.62 1.7 3.40E-04

SGF-2/3/4 807 8 AATTAAAT 13.07 1.63 6.20E-02

TTF-2 178 9 TCTGCTTGT 12.57 1.4 2.60E-02

1-Oct 944 8 ATTTGCAT 12.54 1.57 7.20E-03

Sn 651 7 ACCTGTT 12.04 1.72 1.20E-01

HSTF 74, 92 5 TTCT 7.82 1.56 ND

XhoI–MluI region

Oct-factorsf 224 13 TTGATTTGCATGC 17.05 1.31 1.30E-02

Oct-2.1 225 10 TGATTTGCAT 16.55 1.66 4.70E-02

6-Oct 227 8 ATTTGCAT 15.79 1.97 6.90E-02

SGF-2/3/4 244 8 AATTAAAT 15.14 1.89 8.00E-03

SGF-2/3/4 531 8 AATTAAAT 15.14 1.89 8.00E-03

Athb-1 245 14 ATTAAATCATTGCG 14.69 1.05 1.60E-02

2-Oct 227 8 ATTTGCAT 14.66 1.83 2.60E-01

NFIII 227 8 ATTTGCAT 14.62 1.83 4.80E-01

1-Oct 227 8 ATTTGCAT 14.56 1.82 1.80E-01

NF-uE1 401 8 GCCATCTT 14.55 1.82 8.80E-01

Only the top ten potential transcription factor binding sites having high log-likelihood score are showna Position indicates the distance in base pairs from the SacII (in the case of SacII–XhoI region) or the XhoI (in the case of XhoI–MluI region)

restriction siteb L length in base pairs of the sequence (query) that matches with the consensus transcription factor binding sitec La log-likelihood score, higher is betterd La/L higher value indicates a better score, maximum is 2.0e Ppv Poisson-model P value, ND not determinedf Oct-factors, Oct-2C, Oct-2B, Oct-B3, Oct-B2, Oct-2.1, Oct-1A, Oct-2, Oct-1, NF-A

450 M. S. Kumar et al.

123

chose to investigate HSEs, since a preliminary search of the

SacII–XhoI region using TFSearch Ver 1.3 (http://molsun1.

cbrc.aist.go.jp/research/db/TFSEARCH.html) had identi-

fied several HSE-like elements (data not shown).

HSF-like host factors from Sf9 cells activate

transcription from the polh promoter

An EMSA was performed using a labeled oligonucleotide

containing the Drosophila consensus HSE (Table 1) as

described in ‘‘Materials and methods’’. A specific complex

was observed that could be competed out in the presence of

a 100-fold molar excess of unlabeled HSE oligonucleotide,

but not in the presence of excess non-specific DNA

(pUC18) (Fig. 3a). The HSE sequence from the SacII–XhoI

region as well as the Drosophila consensus HSE sequence

supported twofold higher levels of reporter gene expression

compared to polh promoter alone (compare pHSEpolluc

and pDHSEpolluc to pAJpolluc, Fig. 3b), when transiently

expressed in Sf9 cells. Moreover, the luciferase activity

supported by pHSEpolluc and pDHSEpolluc was compa-

rable to that supported by pSXpolluc, indicating that the

HSEs might be the primary cis-activating elements in the

SacII–XhoI region. If HSE is an important transcription-

activating cis-element in the SacII–XhoI region, then it

should increase the reporter gene expression when cloned

in the pKNluc deletion construct pdSXKNluc. The con-

struct pHSEKNluc could indeed support luciferase levels

comparable to that supported by pKNluc (Fig. 3c), once

again indicating that cis-activating HSEs, located in the

SacII–XhoI region, might be important for transcriptional

activation of the polh promoter.

Oct-like factor(s) from Sf9 nuclear extract bind to the

octamer sequences present in the XhoI–MluI and SacII–

XhoI regions and enhance polh gene transcription

In order to determine if Oct-like protein(s) were indeed

present in Sf9 cells, EMSA was carried out with a labeled

OBS oligonucleotide as described in ‘‘Materials and

methods’’. The results suggest that Oct-like proteins from

Sf9 cells could bind with high specificity to the OBS oligo-

nucleotide (Fig. 4a). The OBS-Sf9 N.E. complex could

not be competed out in the presence of a 100-fold molar

excess of a non-specific competitor like pUC18 or a

mutated oligonucleotide (mutOBS), in which two important

bases ‘‘AT’’ in the consensus sequence (TGATTTTGCAT)

had been replaced with ‘‘GC’’. The complex could, how-

ever, be competed out with a 100-fold molar excess of

unlabeled OBS oligonucleotide (Fig. 4a). In addition,

unlabeled bottom strand could compete more effectively

with the double-stranded OBS-Sf9 nuclear extract complex

when compared with unlabeled top strand (data not shown).

No complex was obtained when labeled mutOBS was used

in EMSA reactions (data not shown). In order to determine

whether the Octamer element could activate transcription

from the polh promoter, plasmid reporter constructs har-

boring OBS cloned upstream of the polh promoter were

derived from pAJpolluc as described in ‘‘Materials and

methods’’. Clones corresponding to both the forward and

reverse orientations of OBS were obtained that supported

luciferase levels fourfold higher than that supported

Fig. 3 a Electrophoretic mobility shift assay with Drosophila HSE

oligonucleotide. Five micrograms of Sf9 N.E. was incubated with

radiolabeled DHSE oligonucleotide, either alone or in the presence of

a 100-fold excess of unlabeled DHSE oligonucleotide, or in the

presence of a 100-fold excess of non-specific DNA (pUC18).

A specific HSE-protein complex (indicated by an arrow) can be

clearly seen. The bottom band is non-specific, since it could be

competed out by non-specific DNA. b Results of transient expression

of plasmids carrying either no upstream element (pAJpolluc), HSE

from the polh 4-kb upstream region (pHSEpolluc), or the Drosophilaconsensus HSE (pDHSEpolluc) or the full-length SacII–XhoI region

(pSXpolluc) in Sf9 cells. c A comparison of reporter gene expression

supported by pKNluc, the pKNluc derivative harboring the SacII–

XhoI deletion (pdSXKNluc) and another derivative harboring an HSE

element in lieu of the SacII–XhoI fragment (pHSEKNluc)

Regulation of AcMNPV polyhedrin promoter transcription 451

123

by pAJpolluc in Sf9 cells (Fig. 4b). The reporter gene

expression in either case was, however, less than that sup-

ported by pXMBpolluc (which carries the 170–360 bp

region of the XhoI–MluI region and also harbors the Oct-

amer sequence), indicating that other sequence elements in

this region probably also play a role in activation of tran-

scription from the polh promoter.

Distamycin A can inhibit binding of the Oct-like

protein to the OBS

In order to determine the nature of interaction of the Oct-like

factor with DNA, EMSA reactions were carried out in the

presence of either the major-groove-binding dye methyl

green or the minor-groove-binding drug distamycin A

(Fig. 5a). The binding of Oct-like factor was significantly

inhibited in the presence of 1 and 2 mM distamycin A (lanes

5 and 6), but not in the presence of methyl green (lanes 8–11).

Divalent and monovalent cations inhibit the binding

of the Oct-like protein to the OBS

Many protein–DNA binding reactions require the presence

of mono- or divalent cations. To determine the role of

cations in binding of the Oct-like factors, binding reactions

were carried out in the presence of EDTA, a divalent

chelator, as described in ‘‘Materials and methods’’. The

specific protein–DNA complex was not affected, even in

the presence of 100 mM EDTA (Fig. 5b), indicating per-

haps that the presence of divalent cations was not important

for the binding of Sf9 Oct-like protein(s) to the OBS. To

further support this result, EMSA reactions were carried

out in the presence of increasing concentrations of mono-

and divalent cations. The results revealed that the OBS-Sf9

nuclear extract complex could be inhibited in the presence

of 500 mM NaCl (Fig. 5c). Divalent cations (MgCl2 and

MnCl2) inhibited the binding of Oct-like factor(s) to the

OBS (Fig. 5d, e, respectively), thereby suggesting that both

mono- and divalent cations could inhibit binding of an

Oct-like factor to the OBS.

UV-crosslinking and Southwestern blotting indicate the

size of the octamer-binding protein to be about 66 kDa

In order to determine the size of the protein factor(s)

binding to the OBS, UV-crosslinking and Southwestern

blotting analyses were carried out as described in ‘‘Mate-

rials and methods’’. UV crosslinking revealed three specific

bands, two of which were close to each other and corre-

sponded approximately to about 66 kDa when radiolabeled

OBS was incubated with the nuclear extract (Fig. 6a).

Southwestern blotting, which is a more accurate method to

determine the molecular weight of the protein(s) binding to

a specific DNA element, revealed a specific protein band of

66 kDa when OBS was used as the probe (Fig. 6b).

Interestingly, the non-specific bands of about 36 kDa

obtained b UV crosslinking were also visible in South-

western blotting. No specific complex was obtained when

mutOBS oligonucleotide was used as the probe (Fig. 6b).

Discussion

The polh gene promoter, used to express foreign genes in

BEVS, is a very late gene promoter that is transcribed by a

virally encoded RNA polymerase [9]. We have shown that

transcription of the polh promoter is regulated by cis-acting

elements located in the 4-kb upstream region and specific

trans-acting factors from the host (insect cell) bind to these

elements. There have been a few attempts earlier to char-

acterize upstream sequence elements in polh promoter. Lo

and colleagues reported an upstream sequence (of the polh

promoter) termed as pu (corresponding to the XhoI–MluI

and MluI–MluI upstream regions of polh promoter) that

could enhance expression from the minimal AcMNPV p35

promoter, a minimal cytomegalovirus (CMV) promoter

and a Drosophila hsp70 promoter [23]. The expression

Fig. 4 a Electrophoretic mobility shift assay with radiolabeled OBS

oligonucleotide (OBS: 50GTG ATT TGC ATC TGC A-30). Radio-

labeled OBS was incubated either alone (lane OBS Free probe) or

with 10 lg of N.E. from Sf9 cells (lane OBS ? Sf9 N.E.). A 100-fold

molar excess of unlabeled OBS oligonucleotide competes for binding

(lane 100X OBS), but the mutOBS oligonucleotide (lane 100XmutOBS) and pUC18 (lane 100X pUC18) could not compete for

binding. Although, two closely migrating bands were obtained, both

appeared to be specific (compare lane 2 with lanes 3 and 4). b Results

of transient expression of plasmids carrying either no upstream

sequence (pAJpolluc) or OBS in forward (pFoctpolluc) or reverse

(pRoctpolluc) orientations. Results for pXMBpolluc (which carries

the 170–360-bp fragment of the MluI–XhoI region and harbors the

octamer sequence) is also shown for comparison

452 M. S. Kumar et al.

123

from these promoters could be further enhanced by hr1

[23]. However, the role of the pu sequence in the context of

the polh promoter in the AcMNPV genome was not

determined.

Several ORFs are located in the 4-kb upstream region of

the polh promoter. The SacII–XhoI region contains most of

ORF984 (233 of the 328 amino acids). The MluI–MluI

region comprises the entire lef-2 ORF as well as partial

sequences of ORF5 and ORF603. Lo and colleagues

observed a reduction in expression from the minimal CMV

promoter when lef-2 was deleted [23]; results presented

here, however, suggest that, at least in the case of the polh

promoter, the deletion of lef-2 does not cause a significant

reduction in reporter gene expression (pdMMKNluc

in Fig. 1b). Similarly, the deletion of the ORF PTP

(ORF984), which comprises a major portion of the NdeI–

SacII region, did not result in a significant reduction in

reporter gene expression (pdNSKNluc in Fig. 1b). The

SacII–XhoI and XhoI–MluI regions did not harbor any

ORFs. It therefore appears that ORFs located within the

4-kb upstream region of the polh promoter may not con-

tribute significantly to enhancement of transcription from

the polh promoter. We observed a significant reduction in

Fig. 6 Determination of molecular weight of Oct-like factor from Sf9cells by a UV-crosslinking and b Southwestern blotting. The arrowsindicate a specific band corresponding to about 66 kDa. The

migratory positions of prestained protein molecular weight markers

are shown

Fig. 5 Biochemical

characterization of binding of

Oct-like factor from Sf9 cells to

the OBS. a Increasing

concentrations of distamycin

A has a negative effect on Sf9Oct-like factor–OBS complex

formation, whereas methyl

green has no effect. Lane 1contains only the Sf9 nuclear

extract incubated with

radiolabeled OBS without any

addition of distamycin A or

methyl green. Lanes 2 and 7 are

controls without Sf9 nuclear

extract to show that the mere

presence of distamycin A or

methyl green does not alter the

mobility of the OBS. b Effect of

EDTA, c NaCl, d MgCl2 and

e MnCl2 on the binding of the

Oct-like factor from Sf9 cells to

the AcMNPV OBS. EMSA was

carried out as described in

‘‘Materials and methods’’

Regulation of AcMNPV polyhedrin promoter transcription 453

123

luciferase reporter assay in the case of vDSXluc when

compared to vMAluc, indicating that the HSE element may

also be important in the viral context.

Heat shock transcription factors are conserved DNA-

binding proteins that bind to HSE upstream of hsp genes

and regulate their expression. Apart from functioning as

transcription factors, they are also involved in embryonic

development in both Drosophila [24] and mice [25].

EMSA with oligonucleotides carrying the HSE sequence

showed specific complexes with Sf9 nuclear extract, pro-

viding evidence that factors resembling HSTF may be

present in the nuclear extracts of Sf9 cells. However, we are

aware that we have not shown conclusive evidence that

heat-shock-factor-like proteins may exist in Sf9 cells. The

top band obtained in the EMSA reactions appears to be the

specific band, since the lower band is competed out by non-

specific DNA (Fig. 3a). The Sf9 hsc70 has been shown

recently to be upregulated during AcMNPV infection [26].

In addition, HSTF is known to activate the transcription of

heat shock protein genes in Drosophila [24], Saccharo-

myces [22] and other organisms. It is therefore possible that

AcMNPV infection in Sf9 cells could result in activation of

HSTF, thus simultaneously driving the expression of host

hsc70 as well as AcMNPV polh, although there is no direct

evidence for this.

The three sub-fragments of the XhoI–MluI region had

varying effects on transcription from the polh promoter.

The drastic reduction in reporter gene expression that was

observed in the case of pXMCpolluc is unclear. Possibly,

cis-acting elements present in this region might suppress

polh transcription. However, the presence of other acti-

vating elements in the entire 4-kb upstream region might

override these inhibitory elements. An interesting possi-

bility is that the inhibitory elements might be responsible

for suppressing transcription from the polh promoter during

early and late phases of infection.

Results from TESS indicated the presence of Oct ele-

ments in the bp 170–360 subregion of the XhoI–MluI

region as well as in the SacII–XhoI region (Table 2).

pAJpolluc derivatives harboring these elements (in either

orientation) supported significantly higher reporter gene

expression than that supported by the basal construct,

pAJpolluc (Fig. 4b). In a previous report, it was shown that

two Oct-1 binding elements could activate p53-indepen-

dent GADD45 gene expression when present in either

orientation [27]. These results, and the fact that specific

factors from Sf9 cells bind to the OBS in the AcMNPV

genome, suggest that Oct-like factors may have a role in

polh transcription, although we have not provided direct

evidence. EMSA results revealed that the binding of host

factor to OBS was strongly inhibited by divalent cations

(Fig. 5d, e as compared to monovalent cations Fig. 5c). In

addition, the binding was not inhibited in the presence of

EDTA (Fig. 5b). Previous studies have shown that the Oct-1

from HeLa cells does not require metal ions for binding to

the Oct-1 sequence [28].

The important role of Oct-1, a protein belonging to the

POU family, in replication of eukaryotic viruses and

transcription of several genes in various species has been

confirmed [29–32]. Also, the important role of octamer

sequence in the regulation of several genes including H2B

[33], SnRNA [29] and the HSV IE enhancer [30] has been

widely reported. Hatfield and Hearing had shown that Oct-

1-binding sites in the adenovirus 103-bp inverted terminal

repeat (ITR) were bound by cellular transcription factor

Oct-1 and stimulated DNA replication in vivo [34]. It was

also shown that the POU domain from different subclasses

of transcription factors could stimulate adenovirus DNA

replication in vitro [35]. These results suggest that Oct-1 or

transcription factors belonging to POU-domain-containing

proteins are essential for adenovirus replication. The

binding of host factor from Sf9 cells to OBS was inhibited

in the presence of the minor-groove DNA-binding antibi-

otic, distamycin A, but not in the presence of the major-

groove-binding dye, methyl green (Fig. 5a). This result is

in agreement with a previous report where distamycin A

was shown to inhibit binding of OTF-1 from the human

ecythroleukemia cell line K562 to its cognate octamer

element [36]. The POU domain is a 150–160-amino-acid

bipartite domain and is comprised of a POU-specific

(POUS) and a POU homeodomain (POUhd) separated by a

variable linker of 15–27 amino acids [37, 38]. Structural

studies carried out with Oct-1 clearly showed that POUS

and POUhd contacted the major groove of the consensus

octamer site on opposite sides of the helix (ATGC and

CAAAT, respectively) [39]. Therefore, the inhibition of

binding of host factor from Sf9 cells to the OBS might be

due to the additional ability of distamycin A to bind to

AT-rich sequences [36].

Despite the widespread use of the polh promoter, we are

only beginning to understand the molecular basis of basal

and hyperactivated transcription from this promoter.

Although the role of several viral genes in transcription

from the polyhedrin gene promoter has been elucidated, the

role of host factors has only recently been shown. The aim

of this study was to analyze the sequences upstream of the

core promoter element for the presence of cis-acting ele-

ments and to identify and characterize host factors that may

interact with these elements to augment transcription from

the polh promoter. An understanding of regulation of polh

expression may potentially lead to the establishment of

a cell-free gene expression system, which would have

several advantages over an in vivo expression system,

including ease of purification of the expressed protein. In

addition, it may provide insights into human-pathogenic

virus interactions. From the present study, it can be

454 M. S. Kumar et al.

123

concluded that AcMNPV is capable of employing insect

cell host factors for driving the expression of its own genes.

It would be interesting to further characterize the bio-

chemical nature of the host factors from Sf9 cells that bind

to heat shock and Octamer elements.

Acknowledgments This work was partly supported by Department

of Science and Technology Grant # HR/OY/GB-16/99 (to MDB) and

by core support from the Department of Biotechnology, Government

of India, to Centre for DNA Fingerprinting and Diagnostics. The

authors wish to thank the National Genomics and Transcriptomics

Facility at CDFD, Hyderabad, India, for DNA sequencing. AR and

SK were recipients of Junior and Senior Research Fellowships from

the Council for Scientific and Industrial Research, Government of

India.

References

1. Roy P (2004) Baculovirus solves a complex problem. Nat

Biotechnol 22:1527–1528

2. Berger I, Fitzgerald DJ, Richmond TJ (2004) Baculovirus

expression system for heterologous multiprotein complexes. Nat

Biotechnol 22:1583–1587

3. Kost TA, Condreay JP, Jarvis DL (2005) Baculovirus as versatile

vectors for protein expression in insect and mammalian cells. Nat

Biotechnol 23:567–575

4. Viswanathan P, Venkaiah B, Kumar MS, Rasheedi S, Vrati S,

Bashyam MD, Hasnain SE (2003) The homologous region

sequence (hr1) of Autographa californica multinucleocapsid

polyhedrosis virus can enhance transcription from non-bacul-

oviral promoters in mammalian cells. J Biol Chem 278:52564–

52571

5. Mukherjee B, Burma S, Hasnain SE (1995) The 30-kDa protein

binding to the ‘‘initiator’’ of the baculovirus polyhedrin promoter

also binds specifically to the coding strand. J Biol Chem 270:

4405–4411

6. Hasnain SE et al (1997) Involvement of host factors in tran-

scription from baculovirus very late promoters—a review. Gene

190:113–118

7. Ramachandran A, Jain A, Arora P, Bashyam MD, Chatterjee U,

Ghosh S, Parnaik VK, Hasnain SE (2001) Novel Sp family-like

transcription factors are present in adult insect cells and are

involved in transcription from the polyhedrin gene initiator pro-

moter. J Biol Chem 276:23440–23449

8. Beniya H, Funk CJ, Rohrmann GF, Weaver RF (1996) Purifica-

tion of a virus-induced RNA polymerase from Autographacalifornica nuclear polyhedrosis virus-infected Spodoptera fru-giperda cells that accurately initiates late and very late

transcription in vitro. Virology 216:12–19

9. Guarino LA, Xu B, Jin J, Dong W (1998) A virus-encoded RNA

polymerase purified from baculovirus-infected cells. J Virol 72:

7985–7991

10. Ooi BG, Rankin C, Miller LK (1989) Downstream sequences

augment transcription from the essential initiation site of a

baculovirus polyhedrin gene. J Mol Biol 210:721–736

11. Glocker B, Hoopes RR Jr, Hodges L, Rohrmann GF (1993) In

vitro transcription from baculovirus late gene promoters: accurate

mRNA initiation by nuclear extracts prepared from infected

Spodoptera frugiperda cells. J Virol 67:3771–3776

12. Weyer U, Possee RD (1989) Analysis of the promoter of the

Autographa californica nuclear polyhedrosis virus p10 gene.

J Gen Virol 70(Pt 1):203–208

13. Etkin E, Carp-Weiss L, Levi BZ (1994) Spodoptera frugiperdaSf-9 cells nuclear factor binds to a specific sequence on the

baculovirus polyhedrin promoter. Virus Res 31:343–356

14. Burma S, Mukherjee B, Jain A, Habib S, Hasnain SE (1994) An

unusual 30-kDa protein binding to the polyhedrin gene promoter

of Autographa californica nuclear polyhedrosis virus. J Biol

Chem 269:2750–2757

15. Jain A, Hasnain SE (1996) A 30-kDa host protein binds to two

very-late baculovirus promoters. Eur J Biochem 239:384–390

16. Ghosh S, Jain A, Mukherjee B, Habib S, Hasnain SE (1998) The

host factor polyhedrin promoter binding protein (PPBP) is

involved in transcription from the baculovirus polyhedrin gene

promoter. J Virol 72:7484–7493

17. O’Reilly DR, Miller LK, Luckow VA (1994) Baculovirus

expression vectors: a laboratory manual. Oxford University Press,

USA

18. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory

manual. Cold Spring Harbor Laboratory Press, New York

19. Hasnain SE, Nakhai B (1990) Expression of the gene encoding

firefly luciferase in insect cells using a baculovirus vector. Gene

91:135–138

20. Schug J (2003) Using TESS to predict transcription factor bind-

ing sites in DNA sequence. In: Baxevanis AD (ed) Current

protocols in bioinformatics. Wiley, New York

21. Hasnain SE, Habib S, Jain A, Burma S, Mukherjee B (1996) Host

factor with single-stranded DNA-binding activity involved in

transcription from baculovirus polyhedrin promoter. Methods

Enzymol 274:20–32

22. Sorger PK (1991) Heat shock factor and the heat shock response.

Cell 65:363–366

23. Lo HR, Chou CC, Wu TY, Yuen JP, Chao YC (2002) Novel

baculovirus DNA elements strongly stimulate activities of

exogenous and endogenous promoters. J Biol Chem 277:5256–

5264

24. Jedlicka P, Mortin MA, Wu C (1997) Multiple functions of

Drosophila heat shock transcription factor in vivo. EMBO J

16:2452–2462

25. Xiao X, Zuo X, Davis AA, McMillan DR, Curry BB, Richardson

JA, Benjamin IJ (1999) HSF1 is required for extra-embryonic

development, postnatal growth and protection during inflamma-

tory responses in mice. EMBO J 18:5943–5952

26. Nobiron I, O’Reilly DR, Olszewski JA (2003) Autographa cali-fornica nucleopolyhedrovirus infection of Spodoptera frugiperdacells: a global analysis of host gene regulation during infection,

using a differential display approach. J Gen Virol 84:3029–3039

27. Jin S et al (2001) Transcription factors Oct-1 and NF-YA regulate

the p53-independent induction of the GADD45 following DNA

damage. Oncogene 20:2683–2690

28. Westin G, Schaffner W (1988) Heavy metal ions in transcription

factors from HeLa cells: Sp1, but not octamer transcription factor

requires zinc for DNA binding and for activator function. Nucleic

Acids Res 16:5771–5781

29. Murphy S, Yoon JB, Gerster T, Roeder RG (1992) Oct-1 and Oct-2

potentiate functional interactions of a transcription factor with the

proximal sequence element of small nuclear RNA genes. Mol

Cell Biol 12:3247–3261

30. Wu TJ, Monokian G, Mark DF, Wobbe CR (1994) Transcrip-

tional activation by herpes simplex virus type 1 VP16 in vitro and

its inhibition by oligopeptides. Mol Cell Biol 14:3484–3493

31. Mittal V, Cleary MA, Herr W, Hernandez N (1996) The Oct-1POU-specific domain can stimulate small nuclear RNA gene

transcription by stabilizing the basal transcription complex

SNAPc. Mol Cell Biol 16:1955–1965

32. Nogueira ML, Wang VE, Tantin D, Sharp PA, Kristie TM (2004)

Herpes simplex virus infections are arrested in Oct-1-deficient

cells. Proc Natl Acad Sci USA 101:1473–1478

Regulation of AcMNPV polyhedrin promoter transcription 455

123

33. Hinkley C, Perry M (1992) Histone H2B gene transcription

during Xenopus early development requires functional coopera-

tion between proteins bound to the CCAAT and octamer motifs.

Mol Cell Biol 12:4400–4411

34. Hatfield L, Hearing P (1993) The NFIII/OCT-1 binding site

stimulates adenovirus DNA replication in vivo and is functionally

redundant with adjacent sequences. J Virol 67:3931–3939

35. Verrijzer CP, van Oosterhout JA, van der Vliet PC (1992) The

Oct-1 POU domain mediates interactions between Oct-1 and

other POU proteins. Mol Cell Biol 12:542–551

36. Broggini M, Ponti M, Ottolenghi S, D’Incalci M, Mongelli N,

Mantovani R (1989) Distamycins inhibit the binding of OTF-1

and NFE-1 transfactors to their conserved DNA elements.

Nucleic Acids Res 17:1051–1059

37. Herr W et al (1988) The POU domain: a large conserved region

in the mammalian pit-1, oct-1, oct-2, and Caenorhabditis elegans

unc-86 gene products. Genes Dev 2:1513–1516

38. Phillips K, Luisi B (2000) The virtuoso of versatility: POU

proteins that flex to fit. J Mol Biol 302:1023–1039

39. Klemm JD, Rould MA, Aurora R, Herr W, Pabo CO (1994)

Crystal structure of the Oct-1 POU domain bound to an octamer

site: DNA recognition with tethered DNA-binding modules. Cell

77:21–32

456 M. S. Kumar et al.

123