overview analyzing sequence data
TRANSCRIPT
![Page 1: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/1.jpg)
Overview Analyzing Sequence Data
Eric L. Stevens, Ph.D.International Policy AnalystInternational Affairs [email protected]
Center for Food Safety and Applied Nutrition
![Page 2: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/2.jpg)
Overview: Genome Assembly
• Understand the process from taking raw sequence reads (either FASTQ or FASTA) and getting a genome assembly (SAM or BAM format)
• Have a conceptual understanding of the difference between alignment and assembly or whatever you hear it described as (i.e. with or without using a reference sequence as a guide)
• Have a conceptual understanding of how reads are aligned/assembled and the pipelines that exist
• Understand how genome sequences are QC’ed and what SAM and BAM format looks like
![Page 3: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/3.jpg)
Overview: Variant Detection
• Understand the process from taking aligned reads (or raw reads) to identifying variants
• Understand the rationale behind the different options (kmer, reference free, reference based).
• Have a conceptual understanding of the major concepts underlying variant identification• IMPORTANT FOR EXPLAINING HOW ROBUST THE DATA AND ANALYSIS
IS!!!!!
• Understand how this genetic variation will set us up for phylogenetic tree construction
![Page 4: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/4.jpg)
4
What Is a Computer?• Computer
– Does computations and carries out logical decisions– Faster than humans
• Computer program– Set of instructions that a computer uses to do something
• Hardware– Physical components of a computer system
• Software– Computer programs that run on a computer
![Page 5: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/5.jpg)
Other Options for Data Analysis
![Page 6: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/6.jpg)
6
FastQ• A more compact format to store sequence and qualities
• Normally on 4 lines:
– “@” followed by the sequence ID
– Sequence
– “+”
– The quality score
• Quality score:– ASCII encoding of phred scores
– Sanger has one scale, Illumina has 3 different (…)
• Can be gzip-ped and used as such by some programs
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
![Page 7: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/7.jpg)
7
@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
EAS139 the unique instrument name
136 the run id
FC706VJ the flowcell id
2 flowcell lane
2104 tile number within the flowcell lane
15343'x'-coordinate of the cluster within the tile
197393'y'-coordinate of the cluster within the tile
1the member of a pair, 1 or 2 (paired-end or mate-pair reads only)
YY if the read fails filter (read is bad), N otherwise
180 when none of the control bits are on, otherwise it is an even number
ATCACG index sequence
![Page 8: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/8.jpg)
8
Phred Score
Phred Quality ScoreProbability of incorrect base call
Base call accuracy
10 1 in 10 90 %
20 1 in 100 99 %
30 1 in 1000 99.9 %
40 1 in 10000 99.99 %
50 1 in 100000 99.999 %
![Page 9: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/9.jpg)
9
Fasta• Most basic file format to represent nucleotide or amino-acid
sequences
• Each sequence is represented by:
– A single description line (shouldn’t exceed 80 characters):
• Starts with “>”
• Followed by the sequence ID, and a space, then
• More information (description)
– The sequence, over one or several lines (the number of characters per line is generally 70 or 80, but it doesnt matter)
![Page 10: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/10.jpg)
Data Preprocessing
• The bases of sequencing reads are not always correct
• Different sequencing platforms have different errors• Therefore, you must know how the sequencing is performed
• There are several common steps– Removing bad sequences that we have low confidence in
– Remove leftover adaptor sequences
– prune the ends of the reads
– k-mer correction …
![Page 11: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/11.jpg)
More could go wrong?
• GC Bias
• Homopolymers
• Low quality bases (especially on the 3’ end)
• Clonal duplicates
• Contamination
• Sequencing artifacts…
![Page 12: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/12.jpg)
![Page 13: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/13.jpg)
![Page 14: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/14.jpg)
14
- Isolate bacterial genome and break it up into many small fragments
- Sequence the fragments using Short or Long-Read Sequencing Technology
- Assemble the thousands to millions of sequenced reads back into the entire genomic sequence of the isolate
- Find genetic differences between isolates (SNPs )
- Use SNPs to create a phylogenetic tree to inform genetic relatedness of foodborne isolates
14
Current WGS Methodology (Simplified)
![Page 15: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/15.jpg)
15
Overview:Current WGS methodology involves growing up the bacterial genome
to be sequenced into a pure culture (one bacterial colony) so that there are many copies of the same bacterial genome. Then the bacterial DNA
is extracted.
Isolate and copy bacterial genome
15
![Page 16: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/16.jpg)
16
Bacterial Genome• 1 circular genome• 3-5 million
nucleotides (AGCTs)
• May have extra DNA (plasmids)
16
Isolate and copy bacterial genome
![Page 17: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/17.jpg)
17
Break up multiple copies of same genome into different pieces
Overview:Current WGS methodology involves cutting multiple copies of the same genome in different positions to generate shorter fragments (of the same length that you can
size select for) that will overlap later on when reassembling the genome (note: this is key to generating a whole-genome sequence)
17
![Page 18: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/18.jpg)
18
Genome copy 1
Genome copy 2
Genome copy 3
• Depending on sequencing
chemistry you will have
thousands to millions of
reads
• Short read = up to ~800bp
(can be millions of reads)
and involves Paired-End
Sequencing
• Long read = up to 40kb in
length (thousands of reads)
and fragmentation is
different
18
![Page 19: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/19.jpg)
19
Break up multiple copies of same genome into different pieces
19
![Page 20: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/20.jpg)
20
Genome Copy
1
1
2
3
1
2
3
1
2
3
1
2
3Genome Copy
2
20
![Page 21: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/21.jpg)
21
How Assembly works: (simplified)Overview: Find overlaps (same string of nucleotides) between reads with different
breakpoints.
1
2
3
1
2
3
1
1
2
2
3
3
Bold =
reassembled
genome sequence
21
![Page 22: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/22.jpg)
22
Condensing multiple reads into a draft or complete genome
AGGATTGTTGGCAGGGAATGTTGGCAGT
GAATGTTGGCAGTCAATGTTGGCAGTCG
• 4 sequenced reads that have been aligned together from the SAME isolate
• Red letter indicates possible sequencing error that is resolved by looking at other nucleotides from other reads at that position
AGGAATGTTGGCAGTCG • Genomic sequence of the isolate that takes into account the other sequencing reads
22
![Page 23: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/23.jpg)
Assembly without a Reference
• Requires mate-pair (read-pair) sequence information• Ideally a combination of the two with different insert sizes
• Analysis can be complicated• Assembly, scaffolding, finishing
• could require some manual steps
• Getting easier all the time• increased read length
• better algorithms
• Necessary if you do not want to be biased by a reference genome (will not assemble novel genomic loci)
![Page 24: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/24.jpg)
Assembly with a Reference
• Possess a sequenced genome that is very similar (usually same species or closer)
• Sequencing reads are then aligned to the reference genome
• Can help guide where the reads go• But can also mislead
• Will not align reads that do not match the reference!
• Will miss plasmid, novel genes, amr, etc.
• Can be faster and good for a quick check to make sure you have sequenced what you think you did
![Page 25: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/25.jpg)
![Page 26: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/26.jpg)
26
Sequence Alignment: the beginnings of assembling a genome
• When two sequences are being compared and the similarity is considered statistically significant, it is highly likely that the two sequences are evolutionary related
• Expect differences
– SNPs (e.g. AGTC -> AGTT)
– Insertions or Deletions (indels)
• AGTC
• A_ TC
• AGGTC
• A_ _C
![Page 27: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/27.jpg)
27
High-level overview
Assemblers: ARACHNE, PHRAP, CAP, TIGR, CELERA
Overlap: find potentially overlapping reads
Layout: merge reads into contigs and contigs into supercontigs
Consensus: derive the DNA sequence and correct read errors ..ACGATTACAATAGGTT..
![Page 28: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/28.jpg)
many pieces
to assemble
High coverage:
Low coverage:
A few pieces
to assemble
a few contigs,
a few gaps
many contigs,
many gaps
Input Output
![Page 29: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/29.jpg)
Practical Example
• Isolate Genome = “it was the best of times it was the worst of times it was the age of wisdom it was the age of foolishness”
• Ambiguously placed reads:
• it was the
• times it w
• was the ag
• the age of
• Unambiguously placed reads:
• the best o
• the worst
• age of foo
• f wisdom i
• Reconstructed Genome = “it was the best of times it was the worst of times it was the age of wisdom it was the age of foolishness”
![Page 30: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/30.jpg)
• Isolate Genome = “it was the best of times it was the worst of times it was the age of wisdom it was the age of foolishness”
Practical Example
![Page 31: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/31.jpg)
![Page 32: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/32.jpg)
32
Sequence Alignment Map (SAM)
Standard format for reporting short read alignment data• BAM is compressed version
Header
Alignment info
http://samtools.sourceforge.net/
![Page 33: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/33.jpg)
33
The Data: BAM
![Page 34: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/34.jpg)
Assessing Assembly Quality
![Page 35: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/35.jpg)
![Page 36: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/36.jpg)
Comparing a single isolate’s reads against a reference genome
36
Overview: Identify the genetic differences (called Single Nucleotide Polymorphisms, or SNPs) between genomes
![Page 37: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/37.jpg)
37
Comparing the sequences of different bacterial isolates by their genetic differences
• In this example, the first and the fourth isolates have sequences that are genetically different than the sequences from the second and third isolates which are identical
• Based on this data you could say that isolate 2 and isolate 3 are more closely genetically related because they have all the same nucleotides
TGGAATGTTGGCAGTCGAGGAATGTTGGCAGTCGAGGAATGTTGGCAGTCGAGGAATGTTGGCAGTCC
Isolate 1
Isolate 2
Isolate 3
Isolate 4
37
![Page 38: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/38.jpg)
![Page 39: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/39.jpg)
Reference Genome
• Sequencing reads that reveal a variant (A) when compared to a reference genome
• Note that the reference genome can change and a SNP would not be called if the reference genome chosen had an A instead of a T at this position
39
Reads from a single isolate
![Page 40: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/40.jpg)
![Page 41: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/41.jpg)
![Page 42: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/42.jpg)
42
![Page 43: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/43.jpg)
43
![Page 44: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/44.jpg)
44
![Page 45: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/45.jpg)
45
![Page 46: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/46.jpg)
Note:
• These slides are for teaching purposes only and have
been collected from images that I have made, from the
CDC and FDA, and from around the web.
• The findings and conclusions in this report are those of
the author and do not necessarily represent the official
position of the Food and Drug Administration
![Page 47: Overview Analyzing Sequence Data](https://reader030.vdocuments.net/reader030/viewer/2022040317/6247f060e09e3969f9106976/html5/thumbnails/47.jpg)