ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/calvert.pdf ·...
TRANSCRIPT
![Page 1: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/1.jpg)
Ownership, sharing and community-building in synthetic biology
Jane [email protected]
Intellectual Property and the BiosciencesWhite Rose IPBio Symposium and Summer SchoolUniversity of Leeds, 7-8 July 2010
![Page 2: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/2.jpg)
Boundaries
www.genomicsnetwork.ac.uk
• The importance of social norms, values and organisational arrangements in intellectual property: – Extends the bounds of what is normally included in
technical discussions of this topic
• Synthetic biology can change the nature of biological entities: – Pushes at the boundaries of the patent system
![Page 3: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/3.jpg)
Aims
www.genomicsnetwork.ac.uk
• To throw light on the interconnections between intellectual property norms, open source aspirations, and the dream of engineering biology
• To show how this is linked to a normative and community-building agenda in synthetic biology
![Page 4: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/4.jpg)
What is synthetic biology?
www.genomicsnetwork.ac.uk
![Page 5: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/5.jpg)
James Brown, University of Cambridge iGEM brochure 2005
“The design and construction of new biological parts, devices, and systems and the re-design of existing, natural biological systems for useful purposes” (www.syntheticbiology.org)
![Page 6: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/6.jpg)
Different schools of synthetic biology
www.genomicsnetwork.ac.uk
• BioBricks approaches
• Genome-level work
• Protocell creation
O’Malley et al. (2008)
![Page 7: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/7.jpg)
![Page 8: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/8.jpg)
Making biology into an engineering discipline
www.genomicsnetwork.ac.uk
![Page 9: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/9.jpg)
Engineering principles
www.genomicsnetwork.ac.uk
![Page 10: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/10.jpg)
Modularity in synthetic biology
www.genomicsnetwork.ac.uk
![Page 11: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/11.jpg)
![Page 12: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/12.jpg)
Modularity in synthetic biology
www.genomicsnetwork.ac.uk
• Are biological systems actually made of functional modules?
• Or are they are simply best understood as such by the engineering approaches that are adopted in synthetic biology?
• “a human invention designed to assist people in engineering very complex systems by ignoring unnecessary details” (www.openwetware.org)?
• No consensus on this issue
![Page 13: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/13.jpg)
Modularity in synthetic biology
www.genomicsnetwork.ac.uk
• But even if natural systems aren’t modular, can they be made to be so?
![Page 14: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/14.jpg)
Modularity and intellectual property
www.genomicsnetwork.ac.uk
• Modular systems are not only easier to engineer, they are also well suited to intellectual property regimes
• In applying engineering principles to biology, synthetic biology is making biology better fit IP
• Modularity also “opens novel ways of imagining the organization of collaborative production” (Pottage 2009)
• Commons-based production and private appropriation rely on the very same ontological characteristics
![Page 15: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/15.jpg)
Synthetic genomics
www.genomicsnetwork.ac.uk
(Gibson et al. 2010)
![Page 16: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/16.jpg)
• JCVI’s 2010 paper ‘Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome’ heralded as a landmark achievement
• Longer-term aim to develop a ‘chassis’ around which new life forms could be built
• Venter is notorious for vigorously pursuing IP • He has ‘watermarked’ his name into the code of his
synthetic bacteria
CRAIGVENTER TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
Synthetic genomics
www.genomicsnetwork.ac.uk
![Page 17: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/17.jpg)
Synthetic genomics
www.genomicsnetwork.ac.uk
Illustration: Andrew Rae in Wired 15/09
![Page 18: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/18.jpg)
• DNA sequencing “allows storage of the genetic instructions for life as a digital file” (Gibson et al. 2010)
• (Myriad ruling: DNA described as the “physical embodiment of biological information”)
• Explains why genes become the subject of patent applications• But this down-plays the importance of cellular context (Kay
1999, Sarkar 1996, Barnes and Dupré 2008)• The synthetic genome will only thrive if it is implanted into an
existing cell
Computational metaphors
www.genomicsnetwork.ac.uk
![Page 19: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/19.jpg)
Ownership and sharing of BioBricks
www.genomicsnetwork.ac.uk
![Page 20: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/20.jpg)
• “DNA sequencing and synthesis technologies make genetic information and material interconvertible” (BioBrick Public Agreement presentation 2009)
• These technologies allow DNA sequences to be ‘decompiled’and ‘recompiled’
www.innogen.ac.ukwww.genomicsnetwork.ac.uk
Computational metaphors
![Page 21: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/21.jpg)
Computational metaphors
www.genomicsnetwork.ac.uk
“New organisms can be designed by combining short snippets of DNA—so-called standard biological parts—into complex genetic blueprints in the same manner that LINUX modules are now combined to make software” (Maurer 2009, p.806)
![Page 22: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/22.jpg)
• BioBricks Foundation has been set up in an attempt to ensure that the information needed to build BioBricks is freely available in the public domain
• Aims to foster “the open design, construction, distribution, understanding, and use of BioBrick™ compatible parts”(BioBricks Public Agreement 2010)
• Synthetic creations are likely to require many BioBricks: patents could lead to patent thickets or blocking patents
www.innogen.ac.ukwww.genomicsnetwork.ac.uk
The BioBricks Foundation
![Page 23: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/23.jpg)
• Attempt to establish the grounds on which BioBricks can be accessed and shared, currently open for comments
• Sign-up would give access to all BioBricks in the Registry of Standard Biological Parts
• Contributors must promise not to assert any property rights theymay hold on BioBricks
• Not ‘viral’, no share-alike clause• Parts can be patented if they are in a mixed system, novel
combination, or are inventive • The aim is to enable a “rich, fully diverse ecology of commercial
and public benefit “(BioBrick Public Agreement presentation 2009)
www.genomicsnetwork.ac.uk
BioBrick Public Agreement
![Page 24: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/24.jpg)
• Inspired by the rich ecosystem of software innovation • Peer production of BioBricks is entirely compatible with more
proprietary strategies (Pottage 2009) • Alternative models, such as Henkel and Maurer’s (2009) ‘embedded
Lunix’ have been proposed• What are the norms, values and organisational structures that we
see being co-constructed with the ownership and sharing regimes being developed in synthetic biology?
• These factors broaden the conversation into a wide range of topics beyond the bounds of patent law
• Two community-building efforts
www.genomicsnetwork.ac.uk
Diverse ecology
![Page 25: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/25.jpg)
![Page 26: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/26.jpg)
iGEM
www.genomicsnetwork.ac.uk
• Aim is to build a community which shares certain values about safety, security and open access
• Wants to shape “the ideology, values and culture of the synthetic biology community” (Smolke 2009)
• Teams are rewarded for contributing parts to the Registry, and ‘debugging’ existing parts
• “engineering is not just a technical activity – it simultaneously builds norms and practices of collaboration into standardized parts” (Pottage 2009)
• The technology and its social world are being created simultaneously
![Page 27: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/27.jpg)
IP and iGEM
www.genomicsnetwork.ac.uk
• The competition is very successful, but rests on shaky IP foundations
• Many of the DNA sequences in the Registry are already covered by patent claims (Rai 2009)
• Strong IP on Green Fluorescent Protein• The threat of litigation hovers in the background• iGEM is breaking the existing IP regime: does this
demonstrate that the IP regime is broken?
![Page 28: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/28.jpg)
www.genomicsnetwork.ac.uk
![Page 29: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/29.jpg)
• In software the distinction between developers and users is not sharp (Von Hippel 2005)
• If biology is becoming more like software, users can become more involved (biohacking)
• DIYBio is enabled by developments which have reduced the cost and increased the ease of access to technologies such as DNA synthesis
• Represents moves towards democratisation synthetic biology and a desire to make biology into a technology that is accessible to all
• Made up of: ‘biocurious’ amateurs (95%), artists, ‘moonlighting’working scientists, bioentrepreneurs and a few “hacker culture uber libertarians” (Cowell 2010)
www.innogen.ac.ukwww.genomicsnetwork.ac.uk
Users and hackers
![Page 30: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/30.jpg)
Motivations for commons-based approaches in synthetic biology
www.genomicsnetwork.ac.uk
• Pragmatic: a commons-based regime can result in more innovation (Rai and Boyle 2007)
• Ideological: openness is adopted because it is considered the best way to “benefit the world” (BioBrick public agreement 2010)
• Strong ideological support for “the cause of radical openness” (Kelty 2005) in the synthetic biology community
• Aspirations that “the hacker culture values like elegant design, creativity and sharing beneficial works of engineering for all, will spread to biology” (Cohn 2005)
![Page 31: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/31.jpg)
Motivations for commons-based approaches in synthetic biology
www.genomicsnetwork.ac.uk
• Can address issues of equity, safety, responsibility and “broader acceptance” of the technology (BioBrick Public Agreement presentation 2009)
• In the future parents will be able to re-programme food, and children will design synthetic pets (Dyson 2007)
![Page 32: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/32.jpg)
• Open science: public domain, outside the IP system• Open source: depends on pre-existing IP rights (e.g.
copyleft)• Open innovation: major global change in business models
(Johnson 2009)
Broader social movements
www.genomicsnetwork.ac.uk
![Page 33: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/33.jpg)
• Shift from the industrial economy to the knowledge economy
• Move away from centralised innovation • More user-centred, aims to redistribute agency, knowledge
and power• We also see distributed user-centred innovation in areas
like mountain biking and snowboarding (Von Hippel 2005)
Open/distributed innovation
www.genomicsnetwork.ac.uk
![Page 34: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/34.jpg)
![Page 35: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/35.jpg)
• Open Science Summit aims for “a rapid, radical reboot of the global innovation system for a truly free and open 21st century knowledge economy”
• Moves towards openness are likely to have a disruptive affect on current business models
• Small companies could undermine existing platforms, displacing incumbent multinationals
• Where there is distributed innovation “there is a normative model of society being performed as well”(Rip et al. 2009)
Open/distributed innovation
www.genomicsnetwork.ac.uk
![Page 36: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/36.jpg)
Summary
www.genomicsnetwork.ac.uk
• It is not feasible or helpful to try to separate out the legal, technical, social and political aspects of synthetic biology
• Proponents of BioBricks admit that the engineering approach is a value system: some people reject it out of hand technically, others morally (Endy 2009)
• Can’t just study novel IP regimes in this field; we also have to be aware of the new social arrangements that are simultaneously being brought into being
![Page 37: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/37.jpg)
Summary
www.genomicsnetwork.ac.uk
• The social and normative innovations being developed around BioBricks approaches rely on the ability to make biological entities into standardized modular parts
• But what if this technical aspiration is not successful?
![Page 38: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/38.jpg)
The recalcitrance of biology
www.genomicsnetwork.ac.uk
![Page 39: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/39.jpg)
![Page 40: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/40.jpg)
Scepticism about engineering biology
www.genomicsnetwork.ac.uk
• Synthetic biologists pursuing BioBricks approaches are keenly aware of the difficulties
• They know that they are dealing with entities that reproduce and evolve
• It may be that modularity will not be successfully applied to biological entities
• If the engineering approach to biological systems is not successful, will the parallel with open source also fail?
• A large array of different players in the synthetic biology field, not all of whom embrace the open biology agenda
![Page 41: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/41.jpg)
Diverse ecology or tipping point?
www.genomicsnetwork.ac.uk
• Some synthetic biologists think we are moving towards a tipping point, where the field will either remain open, or the IP will be locked up
• Powerful multinationals dominate the biotechnology field• Small synthetic biology companies require venture capital,
and need to file patents to justify investment
![Page 42: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/42.jpg)
Pushing the boundaries of the biological
www.genomicsnetwork.ac.uk
• Current biotech patenting regimes rest on certain ideas about the nature of biological entities
• Synthetic biology, if successful, could radically challenge these assumptions, because it has the ability to change biological entities
• The informational and software metaphors that are so widely drawn upon in the field could become actualised
• These metaphors are already changing what people believe should be patentable
• Biology is becoming more like software because we are making it more like software
• If synthetic biology succeeds will we have to rethink intellectual property protection in biotechnology?
![Page 43: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/43.jpg)
References
Andrianantoandro E, Basu S, Karig DK, Weiss R. (2006) ‘Synthetic biology: new engineering rules for an emerging discipline’ Mol Syst Biol
Barnes, SB and Dupré, JA (2008) Genomes and What to Make of Them, University of Chicago Press
BioBrick™ Public Agreement, Draft Version 1, October 2009 http://dspace.mit.edu/bitstream/handle/1721.1/49434/BPA_draft_v1.pdf?sequence=1
Brent, R. (2004). A partnership between biology and engineering. Nature Biotechnology, 22(10), 1211-1214.
Cohn, D (2005) “Open-Source Biology Evolves” in Wired http://www.wired.com/medtech/health/news/2005/01/66289
Cowell, M (2010) 'DIYbio: let's play with biotechnology‘ Talk at the University of Edinburgh, 26th March 2010
Dyson, F (2007) ‘Our Biotech Future’ New York Review of Books, 19 July 2007Endy, D (2009) Talk at the Institute of Systems and Synthetic Biology, Autumn Symposium,
Imperial College, London 11th November 2009Gibson, DG et al. (2010) ‘Creation of a Bacterial Cell Controlled by a Chemically Synthesized
Genome’ Science 329 (5987), 52Henkel J. and Maurer, S.M. (2009) ‘Parts, property and sharing’ Nature Biotechnology, 27,
12, 1095-1098Heinemann M. and Panke, S. (2006). Synthetic biology – putting engineering into biology.
Bioinformatics, 22(22), 2790-2799.Johnson, R (2009) ‘Synthetic Biology: Challenges of Ownership, Access & Rights’ talk at
Opportunities and challenges in the emerging field of synthetic biology Washington, DC July 9th-10th, 2009
![Page 44: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/44.jpg)
References cont.
Kay, L. (1999) In the beginning was the word: the genetic code and the book of life, in: M. Biagioli (Ed.) The Science Studies Reader, pp. 224–233 (New York, London: Routledge).
Kelty, C (2005) ‘Geeks, Social Imaginaries, and Recursive Publics’ Cultural Anthropology, Vol. 20, Issue 2, pp. 185–214
Maurer, SM. (2009) ‘Before it's too late. Why synthetic biologists need an open-parts collaboration--and how to build one’ EMBO Reports Aug 10(8):806-9
O’Malley, M, Powell, A, Davies, J and Calvert, J (2008). Knowledge-making distinctions in synthetic biology. BioEssays, 30(1), 57–65.
Pottage, A (2009) ‘Protocell patents: between modularity and emergence’ in The Ethics of Protocells: moral and social implications of creating life in the laboratory Cambridge, MA: MIT Press
Rai, AK (2009) ‘Synthetic Biology: Innovation and Open Source’ talk at Widrow Wilson Centre meeting on Open Source, Washington DC, June 17, 2009
Rai A, Boyle J. (2007) ‘Synthetic biology: caught between property rights, the public domain, and the commons’ PLoS Biol 5: e58
Rip, A, Joly, P-B, Callon, M (2009) ‘Reinventing Innovation’ in Maarten Arentsen (eds) Governance of Innovation, Edward Elgar
Sarkar, S. (1996) Biological information: a skeptical look at some central dogmas of molecular biology, in: S. Sarkar (Ed.) The Philosophy and History of Molecular Biology: New Perspectives, pp.187–231(Dordrecht: Kluwer).
Smolke, CD (2009) ‘Building outside of the box: iGEM and the BioBricks Foundation’ Nature Biotechnology, 27, 12, 1099-1102
Von Hippel, E (2005) Democratizing Innovation. Cambridge and London: MIT Press.
![Page 45: Ownership, sharing and community-building in synthetic biologyipbio.org/pdfs/Calvert.pdf · intellectual property norms, open source aspirations, and the dream of engineering biology](https://reader034.vdocuments.net/reader034/viewer/2022050112/5f49e9049d173238170d012f/html5/thumbnails/45.jpg)
The support of the Economic and Social Research Council (ESRC) is gratefully acknowledged. The work presented forms part of the programme of the ESRC Genomics Network at Innogen.