Patterns of Single-Gene Patterns of Single-Gene Inheritance Cont.Inheritance Cont.

Genetic Basis of DiseaseGenetic Basis of Disease

Traditional MechanismsTraditional Mechanisms Chromosomal disordersChromosomal disorders Single-gene disordersSingle-gene disorders Polygenic/multifactorial disordersPolygenic/multifactorial disorders

Novel mechanismsNovel mechanisms ImprintingImprinting

• Uniparental disomy (UPD)Uniparental disomy (UPD)

• Parent of origin effectsParent of origin effects MosaicismMosaicism Maternal (Cytoplasmic) inheritanceMaternal (Cytoplasmic) inheritance Unstable DNA (trinucleotide repeat disorders)Unstable DNA (trinucleotide repeat disorders)

Atypical Patterns of InheritanceAtypical Patterns of Inheritance

Exceptions to mendelian inheritance do occur in Exceptions to mendelian inheritance do occur in single-gene disorders and must be considered in single-gene disorders and must be considered in genetic medicinegenetic medicine

On basis of mendelian principles, a mutant allele of On basis of mendelian principles, a mutant allele of an autosomal gene is equally likely to be transmitted an autosomal gene is equally likely to be transmitted from a parent, of either sex, to an offspring of either from a parent, of either sex, to an offspring of either sexsex

Similarly, a female is equally likely to transmit a Similarly, a female is equally likely to transmit a mutated X-linked gene to a child of either sexmutated X-linked gene to a child of either sex

Does the sex of the parent have any effect on the Does the sex of the parent have any effect on the expression of the genes each parent transmit? expression of the genes each parent transmit?

Atypical Patterns of InheritanceAtypical Patterns of Inheritance

In some genetic disorders, the expression of disease In some genetic disorders, the expression of disease phenotype depends on whether the mutant allele has phenotype depends on whether the mutant allele has been inherited from the father or from the motherbeen inherited from the father or from the mother

Differences in gene expression b/w the allele Differences in gene expression b/w the allele inherited from the father and that inherited from the inherited from the father and that inherited from the mother are the result of mother are the result of genomic imprintinggenomic imprinting

Imprinting is an alteration in chromatin that affects Imprinting is an alteration in chromatin that affects gene expression gene expression but notbut not its DNA sequence. Thus, it is its DNA sequence. Thus, it is a reversible form of gene inactivation but is not a a reversible form of gene inactivation but is not a mutationmutation

Genomic ImprintingGenomic Imprinting

Most genes are expressed equally from both paternal and Most genes are expressed equally from both paternal and maternal allelesmaternal alleles

Genomic imprinting is the Genomic imprinting is the epigeneticepigenetic marking of a gene marking of a gene based on its parental origin that results in monoallelic based on its parental origin that results in monoallelic expressionexpression

Genomic imprinting differs from classical genetics in that Genomic imprinting differs from classical genetics in that the maternal and paternal complement of imprinted genes the maternal and paternal complement of imprinted genes are not equivalentare not equivalent

The mechanism of imprinting appears to involve a parental The mechanism of imprinting appears to involve a parental specific methylation of CpG-rich domains, that is reset specific methylation of CpG-rich domains, that is reset during gametogenesis??during gametogenesis??

Imprinted genesImprinted genes

Approx 100-200 thought to existApprox 100-200 thought to exist Involved in many aspects of development Involved in many aspects of development

including including Fetal and placental growthFetal and placental growth Cell proliferationCell proliferation Brain developmentBrain development Adult behaviourAdult behaviour

Genomic imprinting and embryogenesisGenomic imprinting and embryogenesis

Haploid sperm + haploid egg Haploid sperm + haploid egg normal embryo normal embryo Haploid sperm + haploid sperm Haploid sperm + haploid sperm hydatidiform mole hydatidiform mole Haploid egg + haploid egg Haploid egg + haploid egg ovarian dermoid cyst ovarian dermoid cyst

Indicate that normal human development only proceeds when Indicate that normal human development only proceeds when a complement of the paternal and maternal genomes is presenta complement of the paternal and maternal genomes is present

Genomic imprinting in mammals may have evolved because Genomic imprinting in mammals may have evolved because of a conflict of interest between the maternal and paternal of a conflict of interest between the maternal and paternal genome in regulating fetal growthgenome in regulating fetal growth

Imprinting in Genetic DiseasesImprinting in Genetic Diseases

A number of human diseases are associated with imprinting defectsA number of human diseases are associated with imprinting defects Diseases result from eitherDiseases result from either

Loss of imprinting (resulting in diallelic rather than monoallelic Loss of imprinting (resulting in diallelic rather than monoallelic expression). Control over imprinting appears to be governed by a expression). Control over imprinting appears to be governed by a DNA element called the “DNA element called the “imprinting centerimprinting center”, located within the ”, located within the imprinted region itself.imprinted region itself.

Uniparental disomy (resulting in either x2 or no expression)Uniparental disomy (resulting in either x2 or no expression) Imprinting changes can be eitherImprinting changes can be either

congenital, e.g.congenital, e.g.

• Prader-Willi syndrome, Angelman syndromePrader-Willi syndrome, Angelman syndrome or acquired, e.g.or acquired, e.g.

• Altered expression of growth control genes in human cancerAltered expression of growth control genes in human cancer

IMPRINTEDIMPRINTED

IMPRINTED:  Just after fertilization, a global demethylation event occurs in the zygote, first in the paternal pronucleus, followed by the maternal pronucleus. Imprinting established during gametogenesis must resist this demethylation process. Remethylation of the diploid genome occurs post-implantation and sets secondary imprints that are maintained for the life of the individual.

Prader-Willi syndromePrader-Willi syndrome

PWS is a relatively common dysmorphic syndrome PWS is a relatively common dysmorphic syndrome characterized by obesity, excessive and characterized by obesity, excessive and indiscriminate eating habits, small hands & feet, short indiscriminate eating habits, small hands & feet, short stature, hypogonadism, & mental retardationstature, hypogonadism, & mental retardation

Genomes have genetic info in 15q12 (15q11-q13) Genomes have genetic info in 15q12 (15q11-q13) that derives only from mothers that derives only from mothers

Prader-Willi syndromePrader-Willi syndrome

• 70% have paternally derived deletion of 15q12• 25% have matUPD15• 1-2% imprinting center mutation

Angelman syndromeAngelman syndrome

Characterized by unusual facial appearance, short Characterized by unusual facial appearance, short stature, severe mental retardation, spasticity, and stature, severe mental retardation, spasticity, and seizuresseizures

Have genetic info in 15q12 (12q11-q13) derived only Have genetic info in 15q12 (12q11-q13) derived only from fatherfrom father

Also, E6-AP protein ligase mutationAlso, E6-AP protein ligase mutation E6-AP is located in 15q12 and is normally expressed from E6-AP is located in 15q12 and is normally expressed from

maternal allele in the CNS maternal allele in the CNS

Angelman syndromeAngelman syndrome

• 70% have maternally-derived deletion of 15q12• 2% have patUPD15• 2-4% E6-AP ubiquitin protein ligase mutation• 7-9% imprinting center mutation

m aterna lly inherited

a lle le is no t expressedpaterna lly inherited

a lle le is no t expressed

Im prin ting

Uniparental DisomyUniparental Disomy

Presence of disomic cell line containing Presence of disomic cell line containing two chr’s, or portions thereof, inherited two chr’s, or portions thereof, inherited from only one parentfrom only one parent

Isodisomy: if the identical chr present in Isodisomy: if the identical chr present in duplicateduplicate

Heterodisomy: if both homologs from one Heterodisomy: if both homologs from one parent present parent present

ExamplesExamples

Cases of PWS & ASCases of PWS & AS Two CF patients with short stature, inherited Two CF patients with short stature, inherited

two identical copies of most or all of their two identical copies of most or all of their maternal chr. 7. In both cases, the mother maternal chr. 7. In both cases, the mother happened to be a carrier for CFhappened to be a carrier for CF

Father-to-son transmission of hemophilia, Father-to-son transmission of hemophilia, affected boy inherited both X & Y from affected boy inherited both X & Y from fatherfather

Expression of X-linked in homozygous form Expression of X-linked in homozygous form in a female offspring of a carrier mother and a in a female offspring of a carrier mother and a normal fathernormal father

MosaicismMosaicism

MosaicismMosaicism is the presence of two or more genetically is the presence of two or more genetically different cell lines in an individual, all derived from a different cell lines in an individual, all derived from a single zygote single zygote

Mosaicism can be for chromosomal or single gene Mosaicism can be for chromosomal or single gene disordersdisorders

Mosaicism may affect either somatic or germline tissuesMosaicism may affect either somatic or germline tissues Somatic MosaicismSomatic Mosaicism can result in a range of abnormality can result in a range of abnormality

depending on the amount and distribution of normal cells depending on the amount and distribution of normal cells (e.g. mosaic Down syndrome, non-inherited cancers)(e.g. mosaic Down syndrome, non-inherited cancers)

Gonadal (germline) mosaicismGonadal (germline) mosaicism affects the germline tissues, affects the germline tissues, explains the increased risk of recurrence in disorders due to explains the increased risk of recurrence in disorders due to new dominant mutationsnew dominant mutations

Somatic MosaicismSomatic Mosaicism

Depending on stage at which mutation occurred and Depending on stage at which mutation occurred and lineage of somatic cell in which it originated lineage of somatic cell in which it originated segmented or patchy manifestationsegmented or patchy manifestation

If before separation of germline from somatic If before separation of germline from somatic mutation present in both and transmitted to offspring mutation present in both and transmitted to offspring in complete form + expressed somatically in mosaic in complete form + expressed somatically in mosaic formform

NF-1 is sometimes segmental, parents of patient are NF-1 is sometimes segmental, parents of patient are normal, but if patient has affected child normal, but if patient has affected child the child’s the child’s phenotype is complete NF-1. Here mutation must phenotype is complete NF-1. Here mutation must have occurred before separation of germline from have occurred before separation of germline from somatic cell line that carries the mutationsomatic cell line that carries the mutation

Mutation

A mutation occurring during cell proliferation, in either somatic or during gametogenesis, leads to a proportion of cells carrying the mutation

Somatic mosaicism documented in many X-Somatic mosaicism documented in many X-linked disorders in both males and females.linked disorders in both males and females. e.g., a case of dysfunction of hepatic urea cycle e.g., a case of dysfunction of hepatic urea cycle

due to deficiency of ornithine transcarbamylase in due to deficiency of ornithine transcarbamylase in a boy with unusually mild form. Molecular a boy with unusually mild form. Molecular analysis analysis the boy had somatic mosaicism for a the boy had somatic mosaicism for a deletion in OTC genedeletion in OTC gene

Somatic mosaicism has been reported for Somatic mosaicism has been reported for hemophilia A & DMD in females who transmitted hemophilia A & DMD in females who transmitted the mutation and therefore must have had germline the mutation and therefore must have had germline as well as somatic mosaicism as well as somatic mosaicism

Germline MosaicismGermline Mosaicism

The chance that a disorder due to a new AD mutation The chance that a disorder due to a new AD mutation could occur more than once in a sibship is very low, could occur more than once in a sibship is very low, and having two occur independently in the same gene and having two occur independently in the same gene in the same family is very unlikelyin the same family is very unlikely

Given that a child has a defect due to a new AD Given that a child has a defect due to a new AD mutation, the risk of having another child with the mutation, the risk of having another child with the same defect is negligible (equivalent to population same defect is negligible (equivalent to population risk)risk)

In rare cases, parents who are phenotypically normal In rare cases, parents who are phenotypically normal may have more than affected child. Assuming correct may have more than affected child. Assuming correct diagnosis (e.g., no reduced penetrance or mild diagnosis (e.g., no reduced penetrance or mild expression in any of the parents), the explanation is expression in any of the parents), the explanation is germline mosaicism germline mosaicism

A somatic mutation occurs in a germline cell A somatic mutation occurs in a germline cell and persists in all clonal descendants of that and persists in all clonal descendants of that cell cell proportion of gametes carries the proportion of gametes carries the mutation.mutation.

Recall that there are ~ 30 mitotic divisions in Recall that there are ~ 30 mitotic divisions in germline cells before meiosis in female & germline cells before meiosis in female & hundreds in male. So there is a chance for hundreds in male. So there is a chance for mutation to occur during mitotic stages. mutation to occur during mitotic stages.

Germline MosaicismGermline Mosaicism

Embryo

All or part of a

parent’s germ line is

affected by a

disease mutation,

but the somatic cells

are not

No previous

family history of

this disorder

• Germline mosaicism is well documented in ~ 6% of severe, lethal forms of the AD osteogenesis imperfecta. In which mutations in type I collagen genes lead to abnormal collagen, brittle bones, and frequent fractures

Recurrence of the AD OI. Both affected children have the same point mutation in collagen gene. Their father is unaffected and has no such a mutation in DNA from examined somatic tissues

Germline mosaicism has been reported for Germline mosaicism has been reported for several other disorders, e.g., hemophilia A & B, several other disorders, e.g., hemophilia A & B, & DMD& DMD

The exact recurrence risk is difficult to assess The exact recurrence risk is difficult to assess because it depends on what proportion of because it depends on what proportion of gametes contains the mutationgametes contains the mutation

Apparently non-carrier parents of a child with AD Apparently non-carrier parents of a child with AD or X-linked disorder in which the occurrence of or X-linked disorder in which the occurrence of mosaicism is unknown, may also have some mosaicism is unknown, may also have some recurrence . These couples should be offered recurrence . These couples should be offered whatever prenatal diagnostic tests appropriatewhatever prenatal diagnostic tests appropriate

Germ-line mosaic

Non-mosaic male transmitting an autosomal dominant disease

Male who is a germ-line mosaic

One may misclassify this pedigree as having a recessive disease when in

fact it’s a de novo inherited disease in the affected daughter

Mitochondrial inheritanceMitochondrial inheritance

The Mitochondrial GenomeThe Mitochondrial Genome

The mt genome consists of a circular chr., 16.5 The mt genome consists of a circular chr., 16.5 kb.kb.

Most cells contain at least 1000 mtDNA Most cells contain at least 1000 mtDNA molecules, distributed among hundreds of molecules, distributed among hundreds of individual mt. individual mt.

Mature oocyte has more than 100,000 copies of Mature oocyte has more than 100,000 copies of mtDNA. mtDNA.

Mitochondrial DNA (mtDNA) contains 37 genes Mitochondrial DNA (mtDNA) contains 37 genes (13 encode polypeptides, 2 rRNA, and 22 (13 encode polypeptides, 2 rRNA, and 22 tRNAs).tRNAs).

Different rearrangements and point mutations Different rearrangements and point mutations identified in mtDNA that can cause human identified in mtDNA that can cause human disease, often involving the central nervous disease, often involving the central nervous and musculoskeletal systems (e.g., myoclonic and musculoskeletal systems (e.g., myoclonic epilepsy with ragged-red fibers). epilepsy with ragged-red fibers).

Mitochondrial diseases a distinctive pattern of Mitochondrial diseases a distinctive pattern of inheritance because of three unusual features inheritance because of three unusual features of mitochondria: of mitochondria: replicative segregation, replicative segregation, homoplasmyhomoplasmy and and heteroplasmy,heteroplasmy, and and maternal inheritance.maternal inheritance.

Replicative Segregation Replicative Segregation

Absence of the tightly controlled segregationAbsence of the tightly controlled segregation.. At cell division, the multiple copies of mtDNA At cell division, the multiple copies of mtDNA

in each of the mitochondria in a cell replicate in each of the mitochondria in a cell replicate and sort randomly among newly synthesized and sort randomly among newly synthesized mitochondriamitochondria. .

The mitochondria, in turn, are distributed The mitochondria, in turn, are distributed randomly between the two daughter cellsrandomly between the two daughter cells. . This process is known as This process is known as replicative replicative segregationsegregation. .

When a mutation arises in the mtDNA, it is at When a mutation arises in the mtDNA, it is at first present in only one of the mtDNA first present in only one of the mtDNA molecules in a mitochondrionmolecules in a mitochondrion. .

With replicative segregation, however, a With replicative segregation, however, a mitochondrion containing a mutant mtDNA mitochondrion containing a mutant mtDNA will acquire multiple copies of the mutant will acquire multiple copies of the mutant moleculemolecule. .

With cell division, a cell containing a mixture With cell division, a cell containing a mixture of normal and mutant mtDNAs can distribute of normal and mutant mtDNAs can distribute very different proportions of mutant and wildvery different proportions of mutant and wild--type mitochondrial DNA to its daughter cellstype mitochondrial DNA to its daughter cells. .

Homoplasmy-Heteroplasmy Homoplasmy-Heteroplasmy

One daughter cell may, by chance, receive One daughter cell may, by chance, receive mitochondria that contain only a pure mitochondria that contain only a pure population of normal mtDNA or a pure population of normal mtDNA or a pure population of mutant mtDNA population of mutant mtDNA ((a situation a situation known as known as homoplasmyhomoplasmy). ).

Alternatively, the daughter cell may receive a Alternatively, the daughter cell may receive a mixture of mitochondria, some with and some mixture of mitochondria, some with and some without mutation (without mutation (heteroplasmyheteroplasmy). ).

Because the phenotypic expression of a Because the phenotypic expression of a mutation in mtDNA depends on the relative mutation in mtDNA depends on the relative proportions of normal and mutant mtDNA in proportions of normal and mutant mtDNA in the cells making up different tissues, the cells making up different tissues, reduced reduced penetrance, variable expression, and penetrance, variable expression, and pleiotropypleiotropy are all typical features of are all typical features of mitochondrial disorders. mitochondrial disorders.

Homoplasmy and Heteroplasmy Homoplasmy and Heteroplasmy

Figure 7-33 Replicative segregation of a heteroplasmic mitochondrial mutationFigure 7-33 Replicative segregation of a heteroplasmic mitochondrial mutation. . Random partitioning of mutant and wildRandom partitioning of mutant and wild--type mitochondria through multiple type mitochondria through multiple rounds of mitosis produces a collection of daughter cells with wide variation in rounds of mitosis produces a collection of daughter cells with wide variation in the proportion of mutant and wildthe proportion of mutant and wild--type mitochondria carried by each celltype mitochondria carried by each cell. . Cell Cell and tissue dysfunction results when the fraction of mitochondria that are and tissue dysfunction results when the fraction of mitochondria that are carrying a mutation exceeds a threshold levelcarrying a mutation exceeds a threshold level. . N, nucleusN, nucleus..

Maternal Inheritance of mtDNA Maternal Inheritance of mtDNA

The final mtDNA is its The final mtDNA is its maternal inheritancematernal inheritance. . Sperm mitochondria are generally eliminated from Sperm mitochondria are generally eliminated from the embryo, so that mtDNA is inherited from the the embryo, so that mtDNA is inherited from the mother. mother.

Maternal inheritance in the presence of Maternal inheritance in the presence of heteroplasmy in the mother is associated with heteroplasmy in the mother is associated with additional features of mtDNA genetics that are of additional features of mtDNA genetics that are of medical significance. medical significance. First, the number of mtDNA molecules within First, the number of mtDNA molecules within

developing oocytes is reduced before being developing oocytes is reduced before being subsequently amplified to the huge total seen in mature subsequently amplified to the huge total seen in mature oocytes. This restriction and subsequent amplification oocytes. This restriction and subsequent amplification of mtDNA during oogenesis is termed the of mtDNA during oogenesis is termed the mitochondrial genetic bottleneck.mitochondrial genetic bottleneck.

As might be expected, mothers with a high As might be expected, mothers with a high proportion of mutant mtDNA molecules are proportion of mutant mtDNA molecules are more likely to produce eggs with a higher more likely to produce eggs with a higher proportion of mutant mtDNA and therefore are proportion of mutant mtDNA and therefore are more likely to have clinically affected offspring more likely to have clinically affected offspring than are mothers with a lower proportion. than are mothers with a lower proportion.

One exception to maternal inheritance occurs One exception to maternal inheritance occurs when the mother is heteroplasmic for deletion when the mother is heteroplasmic for deletion mutation in her mtDNA; for unknown reasons, mutation in her mtDNA; for unknown reasons, deleted mtDNA molecules are generally not deleted mtDNA molecules are generally not transmitted from clinically affected mothers to transmitted from clinically affected mothers to their children.their children.

Figure 7-34 Pedigree of Leber hereditary optic neuropathy, a form of Figure 7-34 Pedigree of Leber hereditary optic neuropathy, a form of spontaneous blindness caused by a defect in mitochondrial DNAspontaneous blindness caused by a defect in mitochondrial DNA. . Inheritance is only through the maternal lineage, in agreement with Inheritance is only through the maternal lineage, in agreement with the known maternal inheritance of mitochondrial DNAthe known maternal inheritance of mitochondrial DNA. . No affected No affected male transmits the diseasemale transmits the disease..

Mitochondrial inheritanceMitochondrial inheritance

ComplicationsComplications• Incomplete penetrance• Variable expression

Examples of mitochondrial diseasesExamples of mitochondrial diseases

MELAS (Mitochondrial Encephalomyopathy with Lactic MELAS (Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-like episodesAcidosis and Stroke-like episodes

MERRF (Myoclonic Epilepsy with Ragged Red Fibres)MERRF (Myoclonic Epilepsy with Ragged Red Fibres) Leber Hereditary Optic Neuropathy (LHON)Leber Hereditary Optic Neuropathy (LHON) External OphthalmoplegiaExternal Ophthalmoplegia

• Kearns-Sayre syndromeKearns-Sayre syndrome

• Chronic progressive external ophthalmoplegiaChronic progressive external ophthalmoplegia

NARP (Neurogenic weakness Ataxia with Retinitis NARP (Neurogenic weakness Ataxia with Retinitis Pigmentosa)Pigmentosa)

Unstable DNA Unstable DNA (Trinucleotide repeat disorders)(Trinucleotide repeat disorders)

Dynamic MutationsDynamic Mutations

A Mutation Which Changes Upon TransmissionA Mutation Which Changes Upon Transmission Trinucleotide Repeat Disorders Are the Best ExampleTrinucleotide Repeat Disorders Are the Best Example

Three Nucleotides Which Are Present in Increased NumberThree Nucleotides Which Are Present in Increased Number e.g. CAGCAGCAGCAGCAGCAGCAGCAGCAGe.g. CAGCAGCAGCAGCAGCAGCAGCAGCAG

Trinucleotide RepeatsTrinucleotide Repeats NormalNormal Disease Causing When Expanded Beyond a Certain Disease Causing When Expanded Beyond a Certain

ThresholdThreshold Below That Threshold They Are Stable Both in Mitosis and Below That Threshold They Are Stable Both in Mitosis and

MeiosisMeiosis Beyond a Certain Number the Repeat Can Be Unstable in Beyond a Certain Number the Repeat Can Be Unstable in

Meiosis ± MitosisMeiosis ± Mitosis

Location of trinucleotide expansions in humans

“Repeat disorders” can be classified into two distinct types:The repeats are translated (type I) or not translated (type II)

ATG TAA5’ 3’

CGGCGGCGG GAAGAAGAA CAGCAGCAG CTGCTGCTG

Fragile X syndrome Friedreich Ataxia Huntington diseaseDRPLASBMASCA1SCA2SCA3SCA6SCA7

Myotonic dystrophy

Dynamic MutationsDynamic Mutations

Intergenerational instabilityIntergenerational instability Repeat changes in size from parent to offspringRepeat changes in size from parent to offspring Sex of transmitting parent importantSex of transmitting parent important Some more unstable from father, others from motherSome more unstable from father, others from mother

AnticipationAnticipation More severe phenotype with successive generations/ earlier onset ageMore severe phenotype with successive generations/ earlier onset age Best example is myotonic dystrophyBest example is myotonic dystrophy

PremutationsPremutations Repeat size which is unstable but does not result in A phenotypeRepeat size which is unstable but does not result in A phenotype Best example is fragile X syndromeBest example is fragile X syndrome

Genotype-phenotype correlationGenotype-phenotype correlation For all trinucleotide repeat disorders, the larger the repeat, the earlier the For all trinucleotide repeat disorders, the larger the repeat, the earlier the

onsetonset Cannot use the repeat size to predict phenotype with accuracyCannot use the repeat size to predict phenotype with accuracy