ppt - welcome to our family homepage
TRANSCRIPT
![Page 1: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/1.jpg)
Evolution by Genome Duplication
http
://n
ews.
bbc.
co.u
k/1/
hi/s
ci/t
ech/
2225
91.s
tm
Itai YanaiDepartment of Biology
Technion – Israel Institute of Technology
![Page 2: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/2.jpg)
Susumu Ohno and evolution by gene duplicationThe Drosophila genome
Homeotic mutationsHox genesWhat is an animal?
Genome Duplication during chordate evolutionGenome duplications happen(ed)The 2R hypothesisMethods of molecular archeology
Map-based (spatial) – S. cerevisiae and Arabidopsis examples
Tree-based (temporal)Recent progress suggests one genome duplication in vertebrate evolution.
Evolution by Genome Duplication
![Page 3: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/3.jpg)
Mutations
DNA sequence
SELECTION)purifying or positive(
DRIFT
DNA sequence (Altered)
The engine :
The steering wheel :
The standard model of genome evolution
![Page 4: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/4.jpg)
~800-1000 Mya
Metazoan phylogeny
Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
![Page 5: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/5.jpg)
What is the birth of creativity, novelty, diversity?
Or, how do you acquire new function while maintaining the old?Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
![Page 6: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/6.jpg)
GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGGTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGGTGCAATGGGAAGCTCTTCTGGAGAGTGAGAGAAGCTTCCAGTTAAGGTGACATTGAAGCCAAGTCCTGAAAGATGAGGAAGAGTTGTATGAGAGTGGGGAGGGAAGGGGGAGGTGGAGGGATGGGGAATGGGCCGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTGAACAACGAAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGCTTTGTAGACACAGTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGATTTTTTGATGTCTTCATCCATCACTGTCCTTGTCAAATAGTTTGGAACAGGTATAATGATCACAATAACCCCAAGCATAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGTTATCC
CCATTTTATGAATGGAGTEvolutionbyDuplicationGATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT
![Page 7: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/7.jpg)
Evolution by Gene Duplication Susumu Ohno, 1970
“natural selection merely modified,while redundancy created”
![Page 8: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/8.jpg)
It is said that “necessity is the mother of invention”. To be sure, wheels and pulleys were invented out of necessity by the tenacious minds of upright citizens. Looking at the history of mankind, however, one has to add that “leisure is the mother of cultural improvement”. Man’s creative genius flourished only when his mind, freed, from the worry of daily toils, was permitted to entertain apparently useless thoughts. In the same manner, one might say with regard to evolution that “natural selection merely modified, while redundancy created”. Natural selection has been extremely effective in policing allelic mutations which arise in already existing gene loci. Because of natural selection, organisms have been able to adapt to changing environments, and by adaptive radiation many new species were created from a common ancestral form. Yet, being an effective policeman, natural selection is extremely conservative by nature. Had evolution been entirely dependent upon natural selection, from a bacterium only numerous forms of bacteria would have emerged. The creation of metazoans, vertebrates and finally mammals from unicellular organisms would have been quite impossible, for such big leaps in evolution required the creation of new gene loci with previously nonexistent functions. Only the cistron which became redundant was able to escape from the relentless pressure of natural selection, and by escaping, it accumulated formerly forbidden mutations to emerge as a new gene locus.
- Susumu Ohno, Evolution by Gene Duplication (1970)
![Page 9: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/9.jpg)
A new function is created by duplicatingan old gene and modifying the copy.
![Page 10: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/10.jpg)
GenomeChromosomeSegment
Gene cluster
Gene
Domain (exon)
Short indels
Duplications occur at all genomic scales!A
ppar
ent F
requ
enc y
![Page 11: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/11.jpg)
DNA sequence
DNA sequence (Altered)
The steering wheel :
Single nucleotide changes, short insertions or deletions, inversions, recombinations, domain duplication, gene duplication, cluster duplication, segment duplication, chromosome duplication, genome duplication,
A modified model of genome evolution
Mutationsofdifferent
kinds
SELECTION)purifying or positive(
DRIFT
![Page 12: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/12.jpg)
GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGGTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGGTGCAATGGGAAGCTCTTCTGGAGAGTGAGAGAAGCTTCCAGTTAAGGTGACATTGAAGCCAAGTCCTGAAAGATGAGGAAGAGTTGTATGAGAGTGGGGAGGGAAGGGGGAGGTGGAGGGATGGGGAATGGGCCGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTGAACAACGAAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGCTTTGTAGACACAGTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGATTTTTTGATGTCTTCATCCATCACTGTCCTTGTCAAATAGTTTGGAACAGGTATAATGATCACAATAACCCCAAGCATAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGTTATCCCCATTTTATGAATGGAGGATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT
![Page 13: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/13.jpg)
The Drosophila genome
Adams, M.D. et al. Science 2000 287 2185-2195
~120-megabase euchromatic* portion was sequenced
euchromatic= *true chromatin=
non repetitivegenome regions
![Page 14: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/14.jpg)
Misra et al. Genome Biology 2002 3(12):research0083.1-0083.22
Drosophila has >13,000 genes
![Page 15: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/15.jpg)
Homeotic mutants
Normal fly
Extra set of wings!Ubx (Ultrabithorax) gene mutant
Antennae are transformed into legs!Antp (Antennapedia) gene mutant
Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
Drosophila homeobox genes as example of gene duplication
![Page 16: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/16.jpg)
Eight homeobox (Hox) genes regulate the identity of regions within the adult and embryo.
Embryo
Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
Adult
![Page 17: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/17.jpg)
The Hox genes are paralogs with a highly conserved homeobox domain
Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
The Hox genes are transcription regulators and the Homeobox domain is DNA-binding domain.
Multiple alignment of the homeobox domain:
![Page 18: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/18.jpg)
Vertebrates have 4 Hox clusters
Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
Human chromosomes
![Page 19: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/19.jpg)
Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
Evolution of Metazoan Hox genes
![Page 20: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/20.jpg)
What is an animal?
Textbook definition: an organism that feeds, moves and responds to stimuli.
From the book of “Bunny Suicides”
![Page 21: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/21.jpg)
The phylotypic stage
The top row shows an early stage common to all groups, the second row shows a middle stage of development, and the bottom row shows a late stage embryo.
Haeckel's 1874 version of vertebrate embryonic development.
![Page 22: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/22.jpg)
The zootype defines the spatial order of anterior expression limits of the Hox cluster and some other genes.
An animal is an organism that displays a particular spatial pattern of gene expression (zootype)
Slack et al. Nature 361 (1993), 490-492
![Page 23: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/23.jpg)
Slack et al. Nature 361 (1993), 490-492
Origin of the zootype on the evolutionary tree
![Page 24: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/24.jpg)
GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGGTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGGTGCAATGGGAAGCTCTTCTGGAGAGTGAGAGAAGCTTCCAGTTAAGGTGACATTGAAGCCAAGTCCTGAAAGATGAGGAAGAGTTGTATGAGAGTGGGGAGGGAAGGGGGAGGTGGAGGGATGGGGAATGGGCCGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTGAACAACGAAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGCTTTGTAGACACAGTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGATTTTTTGATGTCTTCATCCATCACTGTCCTTGTCAAATAGTTTGGAACAGGTATAATGATCACAATAACCCCAAGCATAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGTTATCC
CCATTTTATGAATGGAGTEvolutionbyGenomeDuplicationGATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT
![Page 25: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/25.jpg)
Susumu Ohno and the 2R hypothesis
“It is our contention that the ancestors of reptiles, birds, and mammals have experienced at least one tetraploid evolution either at the stage of fish or at the stage of amphibians” (1970)
“A mammalian ancestor might have gone through at least one round of tetraploid evolution at the stage of fish” (1973)
![Page 26: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/26.jpg)
Evolution by gene duplication, Ohno (1970)
Distribution of chromosome number in fishes is bi-modal
![Page 27: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/27.jpg)
At least 7 Hox clusters in zebrafish
Amores et al. (1998) Science 282 1711-1714
![Page 28: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/28.jpg)
1. Dosage relationship of functionally related genes2. Each structural gene is accompanied by duplication of its own
regulator
Much more on evolution of gene function in the next lecture...
Problems genome duplication solves:
![Page 29: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/29.jpg)
Science v. 291, pp 1304-1351
Evidence 1: Large segments of conserved synteny are indeed present
Synthenic regions of human chromosome 11 on other human chromsomes
![Page 30: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/30.jpg)
Carroll S.B. et al. From DNA to Diversity (2001) Blackwell Science
Evidence 2: Vertebrates have 4 copies of the Hox cluster
![Page 31: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/31.jpg)
Detected genome duplication events
genomeduplication
Van de Peer et al. Nature Reviews Genetics (2009)
![Page 32: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/32.jpg)
The “one-to-four” rule:
The human genome contains up to four paralogs of many Drosophila genes.
Spring J. FEBS Letters 400 (1997) 2-8
![Page 33: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/33.jpg)
Examples of the ‘one-to-four’ rule
Spring J. Nature Genetics (2002) 31 128-129
![Page 34: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/34.jpg)
How to turn 5 genes into 9 by a 2R model
Wolfe, K.H. Nature Reviews Genetics (2001) 2 333-341
Things Fall Apart, or
![Page 35: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/35.jpg)
Methods for detecting genome duplications
• Spatial – Map-based approachusing knowledge of the order of genes along complete genomes
• Temporal – Tree-based approachusing the molecular clock to estimate the age of the duplication
Ken WolfeGenome Duplication archaeologist par excellence
![Page 36: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/36.jpg)
Map-based approachA systematic search for duplicated regions in S. cerevisiae
3 separate diagonals indicate 3 distinct regional duplications
Interspersed within the clusters are gene that are not duplicated (result of regional duplications)
Wolfe K.H. and Shields D.C. Nature (1997) 387 708-713
![Page 37: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/37.jpg)
55 duplicate regions were identified
Wolfe K.H. and Shields D.C. Nature (1997) 387 708-713
• 376 pairs of homologous genes
• Covering ~50% of the genome
![Page 38: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/38.jpg)
How did these 55 duplicated regions arise?
By successive duplications
Simultaneously by a single duplication of the entire genome (tetraploidy)
-OR-
![Page 39: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/39.jpg)
Triplicated regions are not observed!
If duplications were successive, then about 7 of the 55 duplications would be expected to be in triplicated regions
The duplicates are not duplicated again
Duplication
Duplication of duplicate
![Page 40: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/40.jpg)
Chrom. XVI
Chrom. VII
centromere
centromere
50 of the 55 duplicated regions conserve the orientation with respect to the centromere.
Wolfe K.H. and Shields D.C. Nature (1997) 387 708-713
What does this signify?
![Page 41: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/41.jpg)
mutual exchange of segments between nonhomologous chromosomes
http://www.ucl.ac.uk/~ucbhjow/bmsi/bmsi_7.html
Reciprocal translocation
![Page 42: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/42.jpg)
• ~100 million years ago, two ancestral diploid yeast cells each containing about 5000 genes fused to form a tetraploid.
• The species then became diploid (decay of sequence identity) and most (85%) of the duplicate copies were deleted.
• Current species with a haploid diploid life cycle and 5,800 genes that include many duplicates.
S. cerevisiae is a paleoploid
Wolfe K.H. and Shields D.C. Nature (1997) 387 708-713
![Page 43: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/43.jpg)
K. Waltii illuminates the way
S. cerevisiae and K. waltii diverged roughly 150 million years ago,before the genome duplication event.
Kellis et al. Nature (2004) 428 617-624
![Page 44: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/44.jpg)
Gene and region correspondence with K. waltii reveals genome duplication
Kellis et al. Nature (2004) 428 617-624
• Identified a total of 253 duplicate blocks, containing 75% of K. waltii genes and 81% of S. cerevisiae genes.
• Duplicate blocks tile 85% of each K. waltii chromosome in the pattern expected for WGD.
![Page 45: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/45.jpg)
• Segmentally duplicated regions in the Arabidopsis genome.• Much of the genome is in pairs (not in triplicates, etc.).• There is evidence that most (60–70%) flowering plants have a polyploid ancestry
Arabidopsis Genome Initiative. Nature 408, 796–815 (2000).Masterston, Science 264, 421–423 (1994).
The Map-based approach also suggests a genome duplication in the Arabidopsis genome
![Page 46: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/46.jpg)
Genes duplicated simultaneously should show the same history
Duplication 1
Duplication 2
Wolfe, K.H. Nature Reviews Genetics (2001) 2 333-341
Temporal Tree-based approach
![Page 47: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/47.jpg)
When the human genome was estimated at 80,000 genes the “one-to-four” hypothesis was reasonable but now that the estimate is at 35,000.
The ‘one-to-four’ rule does not hold up
Makalowski W. Genome Research (2001) 667-670
...and in 2009, only 25,000.
![Page 48: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/48.jpg)
Arguments against 2R
1. The “one-to-four” rule has not been upheld by genome sequence data
2. Phylogenetic trees for four-membered human gene families do not show the excess of ((AB),(CD)) topologies expected under a 2R model.
A B C D
![Page 49: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/49.jpg)
GATCTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAGGTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGGTGCAATGGGAAGCTCTTCTGGAGAGTGAGAGAAGCTTCCAGTTAAGGTGACATTGAAGCCAAGTCCTGAAAGATGAGGAAGAGTTGTATGAGAGTGGGGAGGGAAGGGGGAGGTGGAGGGATGGGGAATGGGCCGGGATGGGATAGCGCAAACTGCCCGGGAAGGGAAACCAGCACTGTACAGACCTGAACAACGAAGATGGCATATTTTGTTCAGGGAATGGTGAATTAAGTGTGGCAGGAATGCTTTGTAGACACAGTAATTTGCTTGTATGGAATTTTGCCTGAGAGACCTCATTGCAGTTTCTGATTTTTTGATGTCTTCATCCATCACTGTCCTTGTCAAATAGTTTGGAACAGGTATAATGATCACAATAACCCCAAGCATAATATTTCGTTAATTCTCACAGAATCACATATAGGTGCCACAGTTATCC
CCATTTTATGAATGGAGT2Rornot2R?GATGAAAACCTTAGGAATAATGAATGATTTGCGCAGGCTCACCTGGATATTAAGACTGAGTCAAATGTTGGGTCTGGTCTGACTTTAATGTTTGCTTTGTTCATGAGCACCACATATTGCCTCTCCTATGCAGTTAAGCAGGTAGGTGACAGAAAAGCCCATGTTTGTCTCTACTCACACACTTCCGACTGAATGTATGTATGGAGTTTCTACACCAGATTCTTCAGTGCTCTGGATATTAACTGGGTATCCCATGACTTTATTCTGACACTACCTGGACCTTGTCAAATAGTTTGGACCTTGTCAAATAGTTTGGAGTCCTTGTCAAATAGTTTGGGGTTAGCACAGACCCCACAAGTTAGGGGCTCAGTCCCACGAGGCCATCCTCACTTCAGATGACAATGGCAAGTCCTAAGTTGTCACCATACTTTTGACCAACCTGTTACCAATCGGGGGTTCCCGTAACTGTCTTCTTGGGTTTAATAATTTGCTAGAACAGTTTACGGAACTCAGAAAAACAGTTTATTTTCTTTTTTTCTGAGAGAGAGGGTCTTATTTTGTTGCCCAGGCTGGTGTGCAATGGTGCAGTCATAGCTCATTGCAGCCTTGATTGTCTGGGTTCCAGTGGTTCTCCCACCTCAGCCTCCCTAGTAGCTGAGACTACATGCCTGCACCACCACATCTGGCTAGTTTCTTTTATTTTTTGTATAGATGGGGTCTTGTTGTGTTGGCCAGGCTGGCCACAAATTCCTGGTCTCAAGTGATCCTCCCACCTCAGCCTCTGAAAGTGCTGGGATTACAGATGTGAGCCACCACATCTGGCCAGTTCATTTCCTATTACTGGTTCATTGTGAAGGATACATCTCAGAAACAGTCAATGAAAGAGACGTGCATGCTGGATGCAGTGGCTCATGCCTGTAATCTCAGCACTTTGGGAGGCCAAGGTGGGAGGATCGCTTAAACTCAGGAGTTTGAGACCAGCCTGGGCAACATGGTGAAAACCTGTCTCTATAAAAAATTAAAAAATAATAATAATAACTGGTGTGGTGTTGTGCACCTAGAGTTCCAACTACTAGGGAAGCTGAGATGAGAGGATACCTTGAGCTGGGGACTGGGGAGGCTTAGGTTACAGTAAGCTGAGATTGTGCCACTGCACTCCAGCTTGGACAAAAGAGCCTGATCCTGTCTCAAAAAAAAGAAAGATACCCAGGGTCCACAGGCACAGCTCCATCGTTACAATGGCCTCTTTAGACCCAGCTCCTGCCTCCCAGCCTTCT
![Page 50: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/50.jpg)
4 intervening genes (allow for a maximum of 30)
A paralogon of size 2 (sm = 2)
A paralogon of size 3 (sm = 3)
Paralogons are defined as paralog pairs separated by at most 30 intervening genes
Based upon McLysaght et al. Nature Genetics (2002) 31 200-204
![Page 51: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/51.jpg)
Modified from McLysaght et al. Nature Genetics (2002) 31 200-204
Paralogons on human chromosome 17
![Page 52: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/52.jpg)
McLysaght et al. Nature Genetics (2002) 31 200-204
Distribution of sizes of paralogons found in the human genome
![Page 53: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/53.jpg)
Large-scale duplications must be invoked to explain paralogons:Test with a random shuffling model
Any paralogon with sm 6 was very likely to have been formed by a single duplication
McLysaght et al. Nature Genetics (2002) 31 200-204
![Page 54: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/54.jpg)
McLysaght et al. Nature Genetics (2002) 31 200-204
Dating the duplications with respect to divergence from fly
outgroup
![Page 55: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/55.jpg)
McLysaght et al. Nature Genetics (2002) 31 200-204
Excess duplications in the 0.4-0.7 D date range
![Page 56: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/56.jpg)
McLysaght et al. Nature Genetics (2002) 31 200-204
The majority of genes making up paralogons fall in the age class 0.4–0.7 D
![Page 57: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/57.jpg)
1. Human genome contains many more paralogons than expected by chance
2. A burst of gene duplication occurred during early chordate evolution
3. A widespread deletion of genes must have subsequently occurred (as in yeast and arabidopsis)
McLysaght et al. Nature Genetics (2002) 31 200-204
One genome duplication seems to have occurred
![Page 58: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/58.jpg)
Gu X. et al. Nature Genetics (2002) 31 205-209
Another study, based upon 749 gene families ,came to a similar conclusion
The authors emphasized both genome and segmental duplications
![Page 59: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/59.jpg)
Durand D. TIGs (2003) 19 2-5
Evolution of the chordate lineage with fly as an outgroup
Genome duplication estimates
![Page 60: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/60.jpg)
Aury et al. Nature (2006) 444 171-178
In the unicellular eukaryote Paramecium tetraurelia, a ciliate, most of the nearly 40,000 genes arose through at least three successive whole-genome duplications
Representation of the successive duplications of the Paramecium genome. The exterior circle displays all chromosome-sized scaffolds, and the three interior circles show the reconstructed sequences obtained by fusion of the paired sequences from each previous step. Red lines link pairs of genes with a BRH match, and blue lines link pairs of genes with a non-BRH match that were added on the basis of syntenic position. Only the BRHs that link two genes in the same paralogon are represented. The position of an ancestral block is unrelated to the position of its constituents in the previous circle.
![Page 61: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/61.jpg)
Aury et al. Nature (2006) 444 171-178
A model for gradual gene loss after genome duplications deduced from differential retention of genes in Paramecium.
![Page 62: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/62.jpg)
• Paleopolyploidy events therefore seem to be exceedingly rare
• However, polyploidy is extremely common, 2-3% of speciation events.
• This would suggest that, although descendants of WGD events do not survive often, when they do survive their evolutionary lineage can be very successful.
Genome Duplications and Organismal Complexity
Van de Peer et al. Nature Reviews Genetics (2009)
![Page 63: PPT - Welcome to our family homepage](https://reader031.vdocuments.net/reader031/viewer/2022013111/554ea702b4c905fb7c8b4a65/html5/thumbnails/63.jpg)
The End
From the book of Bunny Suicides