pten 2 , a golgi-associated testis-specific …3 the production of 3-phosphorylated...

1

PTEN 2 , a golgi-associated testis-specific homologue of the PTEN tumor

suppressor lipid phosphatase

By

Yan Wu*, Donald Dowbenko*, Mayte Pisabarro+, Lisa Dillard-Telm#,

Hartmut Koeppen# and Laurence A. Lasky*%

Depts of Molecular Oncology* Protein Engineering+ and Pathology#Genentech, Inc.

460 Pt. San Bruno Blvd.SSF, CA 94080

% address correspondence to L.Lasky: 1-650-225-1123 (phone), 1-650-225-6127(FAX), [email protected] (email)

Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on March 2, 2001 as Manuscript M101480200 by guest on January 20, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

2

The tumor suppressor PTEN is a phospatidylinositol phospholipid

phosphatase which indirectly downregulates the activity of the AKT/PKB

survival kinases. Examination of sequence databases revealed the

existence of a highly conserved homologue of PTEN. This homologue,

termed PTEN 2, contained an extended amino terminal domain having 4

potential transmembrane motifs, a lipid phosphatase domain and a

potential lipid-binding C2 domain. Transcript analysis demonstrated

that PTEN 2 is expressed only in testis and specifically in secondary

spermatocytes. In contrast to PTEN, PTEN 2 was localized to the golgi

apparatus via the amino terminal membrane spanning regions. Molecular

modeling suggested that PTEN 2 is a phospholipid phosphatase with

potential specificity for the phosphate at the 3 position of inositol

phosphates. Enzymatic analysis of PTEN 2 revealed substrate specificity

that is similar to PTEN, with a preference for the dephosphorylation of

the phosphatidyl inositol 3,5 phosphate phospholipid, a known mediator

of vesicular trafficking. Together, these data suggest that PTEN 2 is a

golgi-localized, testis-specific phospholipid phosphatase, which may

contribute to the terminal stages of spermatocyte differentiation.

by guest on January 20, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

3

The production of 3-phosphorylated phosphatidylinositol lipid products by the

PI3 kinase pathway is an important control point for the regulation of cell proliferation,

growth, survival and vesicular trafficking [1]. The activation of this pathway by

various growth factors, extracellular matrices or oncogenic events results in a

diversity of signals including the upregulation of the catalytic activity of the AKT/PKB

kinases [2]. These kinases enhance cell survival by phosphorylation of a number of

substrates including a subfamily of forkhead transcription factors [3]. A novel

mechanism for the control of the AKT/PKB pathway was identified when genetic evidence

pointed to a tumor suppressor locus on chromosome 10 at q23-25. Analysis of a

candidate tumor suppressor gene from this region demonstrated that the locus encoded a

phosphatase, which was termed PTEN (also called MMAC and TEP 1) [4] [5] [6].

Further studies demonstrated that PTEN was mutated in a large percentage of brain,

endometrial and prostate tumors as well as a smaller percentage of other tumors [7] [8]

[9]. In addition, Cowden disease and Bannayan-Zonana Syndrome, which are both

characterized by increased susceptibility to breast and thyroid tumors, showed a range

of germline PTEN mutations, which were similar to those observed in tumors [10].

Enzymatic studies demonstrated that PTEN is a lipid phosphatase which downregulates

the PI3 kinase pathway by removing the 3-phosphate from the phosphatidylinositol-3,

4 and -3,4,5 phosphate phospholipids (PIP 3,4 and PIP 3,4,5) [11]. Importantly,

many of the tumor-derived missense mutations observed in PTEN resulted in a complete

loss of phospholipid phosphatase catalytic activity [12]. The loss of the PTEN lipid

phosphates activity due to mutation was expected to result in increased levels of PIP 3,4

and PIP 3,4,5 and the upregulation of the AKT/PKB cell proliferation/survival

pathway, an event which might induce tumor resistance to chemotherapy and radiation

[13] [14] [15]. Data supporting this conjecture demonstrated that glioblastoma cell


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

4

lines mutated for the endogenous PTEN locus suffered deleterious effects on cell cycle

progression (G1 arrest), proliferative capacity and survival when transfected with a

wild type, but not a catalytically-inactive, form of the phosphatase, suggesting that the

enzymatic activity of the enzyme was involved with the regulation of this phospholipid

signaling [6] [16] [17]. These studies suggested that the loss of this phosphatase in

tumors induced the upregulation of the AKT/PKB signaling pathway, which resulted in

cell cycle progression and inhibition of apoptosis.

A number of animal model studies supported an important role for PTEN in the

control of proliferation, survival and cell size. Importantly, mice with homozygous null

mutations in the PTEN locus showed early embryonic lethality due to an apparent

hyperproliferative effect, while heterozygous animals developed tumors postnatally

with apparent loss of heterozygosity at the PTEN locus [18] [19]. This latter result

suggested that the loss of PTEN expression was an advantageous event, which allowed

tumors to grow in a more unregulated manner after the accumulation of other oncogenic

mutations. Cell lines derived from PTEN null embryonic mice demonstrated higher

levels of PIP 3 phospholipids and enhanced activation of the AKT/PKB kinase [19]. These

cells also showed significant resistance to a diversity of apoptotic stimuli, further

endorsing a role for this phosphatase in the regulation of cell survival through the PI3

kinase pathway. Additional evidence in both C. elegans and Drosophila supported a role

for the PTEN phosphatase in the regulation of cell growth and survival. C. elegans

contains an insulin-like pathway , including an insulin –like receptor tyrosine kinase,

a PI 3 kinase, PDK and AKT/PKB kinases and a forkhead-like transcription factor,

which is involved with dauer formation, a developmental stage where worms undergo a

quiescent state. Genetic analysis of this pathway demonstrated that a worm homologue of

PTEN, termed DAF 18, could suppress upstream mutations in either the insulin-like


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

5

receptor or PI 3 kinase, completely consistent with results found in the mammalian PI

3 kinase pathway [20]. The involvement of this pathway in the regulation cell size was

further suggested by studies in Drosophila. These data demonstrated that the fly

homologue of PTEN was involved with the determination of cell size, consistent with

other studies, which established the importance of several components of the PI 3-

kinase pathway, such as AKT/PKB [21] [22]. Together, these three separate animal

models provided strong proof for the relevance of the PTEN lipid phosphatase in the

regulation of various aspects of the PI 3 kinase pathway.

X ray crystallographic analysis of PTEN structure revealed that this phosphatase

contains a novel substrate recognition pocket with positively charged residues

potentially involved with the association of the phosphates on the inositol ring substrate

[12]. Positioning of many tumor derived mutations known to disrupt catalytic activity

to the active site in part served to explain the mechanism of action of the phosphatase.

The mechanism by which PTEN appears to be associated with its phospholipid substrates

appears to be quite complex. Structural analysis revealed a functional C2 lipid binding

domain in the carboxy-terminal region of the protein, which was proposed to serve as a

lipid association motif [12]. Many tumor-derived mutations have been mapped to the

carboxy-terminus, and a fraction of these are involved with the formation of an

interface between the phosphatase domain and the C2 domain. These latter results helped

to explain why mutations in the carboxy-terminal region appeared to affect catalytic

activity. Human, mouse and Drosophila PTEN all contain a PDZ binding motif (S/TXV) at

their carboxy termini, and yeast two hybrid analyses established that the PTEN

phosphatase binds to PDZ domains of a family of membrane associated guanylate kinases

(MAGUKs), peripheral membrane associated proteins with multiple protein interaction

domains which function to juxtapose signaling molecules and position them near the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

6

plasma membrane [23]. Interestingly, some tumor derived mutations are found at the

extreme carboxy terminus of PTEN, and these mutations would be expected to disrupt

PDZ domain binding interactions, consistent with an important functional role for PDZ

domain binding in PTEN tumor suppression. Because these MAGUKs are localized

specifically to intercellular tight junction regions, these studies also suggested

mechanisms for the positioning of the PTEN phosphatase to the lipid domains of

subcellular regions such as the epithelial tight junction, a site known to be involved

with the regulation of cell survival [24].

In this paper we describe a novel homologue of PTEN, termed PTEN 2, which has

been identified using database searches. Interestingly, this novel phosphatase is

expressed uniquely in testis, and specifically in the secondary spermatocytes. In

contrast to PTEN, PTEN 2 contains several potential transmembrane domains, which

appear to target the phosphatase to the golgi apparatus. Molecular modeling suggests that

PTEN 2 is a lipid phosphatase with many active site residues conserved with PTEN, and

enzymatic analysis demonstrates that the novel phosphatase actively dephosphorylates

PIP 3,5 and PIP 3,4,5 in vitro. Together, these data suggest that PTEN 2 is a

phospholipid phosphatase which may play a role in the terminal stages of spermatocyte

maturation by regulating intracellular levels of phosphatidylinositol-3-phosphate

phospholipids.

Materials and Methods

PTEN DNA constructs. An human EST related to PTEN was initially identified from

searches of public and private databases. By using various protocols, including

screening a testis cDNA library and PCR methods, we obtained a full-length sequence of

human PTEN 2. A fragment of human PTEN 2 cDNA was used as a probe to isolate a full


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

7

length murine cDNA from a murine testis cDNA library GST-PTEN 2 (amino acids 378-

683 was subcloned into an expression vector containing a CMV promoter. . A

catalytically inactive form of murine GST-PTEN 2 was constructed by changing Cys458 to

Ser. To determine the localization of PTEN 2 in mammalian cells, a myc tag was placed at

the C terminus of the gene. GFP-PTEN 2 was constructed by subcloning either the full

length cDNA or the N- or C-terminus into Clontech’s pEGFPN3 vector. PTEN 2 N-

terminus includes amino acids 1-377, while PTEN 2 C-terminus includes amino acids

378 to 683. FISH mapping of mouse murine PTEN 2 was performed by SeeDNA Biotech

Inc. The probe was an 8kb BamHI genomic DNA containing the first exon of PTEN 2.

Molecular Modeling For the molecular modeling, a sequence alignment was obtained

by using CLUSTAL W and a threading approach. The HOMOLOGY/MODELLER module from

the Insight II package (version 98.0; MSI, San Diego, California) was used for molecular

construction and display. Docking of inositol (1,3,4,5)-tetrakisphosphate in the active

site of PTEN2 was manually performed as previously described for PTEN by Lee and

coworkers [12].

PTEN 2 expression pattern. In addition to Northern analysis, we also determined

the tissue distribution pattern of PTEN 2 using the PCR method. Mouse Multiple Tissue

cDNA panels were purchased from Clontech. After 35 cycles, the mouse PTEN 2 gene was

only detected in testis.

In situ hybridization. PCR primers (upper 5’ GAACTGGAACCATGGTG and lower 5’

TAGGAAGATTCGGAGAGAG) were designed to amplify a 423 bp fragment of pTEN2.

Primers included extensions encoding T7 and T3 RNA polymerase initiation sites to allow

in vitro transcription of sense and antisense probes, respectively, from the amplified

products. The hybridization was performed on 5µ paraffin sections of formalin-fixed

tissues. Prior to hybridization the sections were deparaffinized and treated with


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

8

proteinase K for 15 minutes at 370C. 33P-UTP labeled sense and antisense probes were

hybridized to the sections at 550C overnight. Unbound probe was removed by treatment

with RNase A for 30 min at 37oC, followed by a high stringency wash (0.1 X SSC for 2

hours at 550C) and dehydrated in 70%, 95% and 100% ethanol, respectively. The

slides were dipped in NBT2 nuclear track emulsion (Eastman Kodak), exposed for 4

weeks at 40C, developed and counterstained with hematoxylin and eosin.

Intracellular localization of PTEN 2. The intracellular localization of PTEN 2

gene was done in COS7 cells. 36 hours after transfection, the cells were fixed using

formaldehyde and stained using an anti-myc monoclonal antibody. The YFP-Golgi marker

was purchased from Clontech. Brefeldin was purchased from Sigma and the transfected

cells were treated for 40 minutes before fixation.

Preparation of catalytically active PTEN proteins. Approximately 5 x 108

293 cells are collected and resuspended in 100 ml of 0.5% Triton X-100, 50 mM Tris

pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM DTT, and protease inhibitors ( Roche,

#1836145). After sitting on ice for 15 minutes, the lysates are centrifuged at 10,000

x g and the supernatant is collected. The lysate is applied to a 2 ml GSH-sepharose

column and recirculated several times. The column is washed in 10 column volumes of

0.03% Brij35 , 50 mM Tris pH 7.5, 0.5M NaCl, 10% glycerol, and 2mM DTT. The

GST-fusion protein is eluted with 50 mM Tris pH7.5, 150 mM NaCl, 2 mM DTT, 30%

glycerol, and 10 mM reduced glutathione. The protein is stored in aliquots of 30 ul at

–20oC. Full length human PTEN cDNA was cloned into the baculovirus expression vector,

PH.hif, as a C-terminal HIS-tag fusion. The PCR primers used for this were: 5’-

CATCGCGATCGCATGACAGCCATCATCAAAGAG3 ’and

5’CTACGCGGCCGCTCAGACTTTTGTAATTTGTGTATGC-3’.Insect “Hi-Five” cells (Expression

Systems) at 7.5 x 105 /ml were infected with a multiplicity of 1.0 for 48 hours and


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

9

then harvested. Pelleted cells were resuspended in 100 ml of 50mM Tris pH 7.5,

300mM NaCl, 250mM sucrose, 1mM DTT, and 5 mM Imidazole. The suspension was

sonicated for 1 minute on ice and centrifuged at 10,000 x g for 15 minutes. The

supernatant was collected and recirculated over a 2 ml column of Ni-NTA superflow

(Qiagen #1004493). The column was washed with 10 column volumes of lysis buffer

and eluted with 5 x 1ml steps of 50 mM Tris pH 7.5, 250 mM sucrose, 150 mM NaCl,

2 mM DTT and 250 mM Imidazole. Enzyme was stored at –70oC in 20 ul aliquots.

Phosphoinositide phosphatase assay. The lipid-based phosphatase reactions were

performed essentially as described [25]. The reactions (50 µl) contained 100 mM

Tris(pH8.0),10 mM dithiothreitol, 100 uM phosphatidyl inositol phosphate substrates,

(Echelon), 1.0 mM phosphatidylserine (Avanti, #830052) and 50 ug/ml PTEN2 or 10

ug/ml PTEN. Reactions were run at 37oC for 3 hours and centrifuged at 20,000g for 15

min. The supernatants were treated with malachite green (Biomol Green, # AK-111)

and absorbance was measured at A650.

Results

Sequence characterization of a PTEN homologue. Perusal of human and murine

DNA sequence databases demonstrated a closely related homologue of PTEN in both

species. Cloning of cDNAs encoding both the human and murine forms of the homologue

revealed that, while a diversity of sequences were expressed in the human, a single

species was found in the mouse. While this work was being completed, a human

homologue of the murine sequence was reported, and chromosomal mapping suggested

that there were a number of different PTEN-homologous genes encoded in the human

genome, some of which appeared to be psuedogenes [26]. The sequence of the 664 amino

acid (m.w. 76, 719 daltons) mouse protein is illustrated in figure 1 and compared with


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

10

the reported human PTEN 2 homologue and with PTEN. This figure illustrates that both

the human and murine PTEN homologues are extended at their amino-termini, and

hydropathy analysis (figure 1) reveals that, in contrast to PTEN, the murine and human

homologues appear to contain four high-probability transmembrane domains followed

by the catalytic domain. Interestingly, all four potential transmembrane domains contain

charged residues embedded within the hydrophobic potential membrane-spanning

sequence (figure 1). Using a structural algorithm , which predicts membrane topology

(Dr. Thomas Wu-personnal communication), we find that the murine homologue of PTEN

may have a membrane spanning structure, which is reminiscent of ion channels (figure

1). This sequence analysis suggests that the murine and human PTEN homologues appear

to have extended amino termini, which may be involved with intracellular membrane

association. FISH mapping revealed that the murine homologue mapped to a single locus

on chromosome 8 between A3 and A4 (data not shown).

The murine homologue appears to have a number of residues throughout the

catalytic domain, which are conserved with PTEN (figure 1). Importantly, many of

these residues are likely to be involved with substrate recognition and catalytic activity

(figure 2) [12]. For example, residues D426, H427, C458, K459, G461, R462 and Q510, which

are identical between the two proteins, were all proposed to be involved with substrate

recognition in the structural analysis of PTEN. In addition, figure 2 also illustrates that

the vast majority of the tumor-associated PTEN mutations, many of which are known to

disrupt catalytic activity, occur at residues that are also either identical or conserved

between the PTEN and the PTEN homologue. These comparative data suggest that the

murine and human homologues are likely to have similar substrate specificity as PTEN,

and we have therefore termed the new protein PTEN 2.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

11

The structure of PTEN has been recently solved by X-ray crystallography at 2.1

angstroms resolution [12]. This analysis revealed a molecule consisting of an N-

terminal phosphatase domain and a C-terminal C2 lipid binding motif which were tightly

packing against each other through a large interface. The phosphatase active site is

similar to that observed in protein tyrosine phosphatases, including the essential

catalytic residues, but is enlarged to allow for the binding of the larger phosphoinositide

substrate. C2 domains have been shown to mediate membrane lipid association. Based on

the 39% sequence identity between PTEN2 and PTEN, a three dimensional model of the

phosphatase and C2 domains of PTEN2 has been built by homology modeling and threading

techniques using the PTEN structure as template (figure 2). The existence of a C2

domain in PTEN2 (PTEN2-C2) was established by using threading analysis and the high

conservation of residues forming the phosphatase domain/C2 interface (figure 2). This

domain presents a 23% sequence identity with the PTEN C2 domain (PTEN-C2). In

PTEN2 there is a five residue insertion in the "T1 loop" that could allow this loop to

establish more extensive contacts with the C2 domain as compared to PTEN (figure

2).The catalytic residues essential for the activity in all protein tyrosine phosphatases

are conserved in PTEN2 (D426, C458 and R464) and occupy the same position in both, PTEN

and PTEN2 (figure 2). The high conservation of residues forming the substrate binding

site in PTEN and PTEN2 has structural implications for substrate-recognition. In

particular, the positively charged residues that have been proposed to interact with the

negatively charged phosphate groups of the phospholipid substrate in PTEN are

conserved in PTEN2 (H427, K459 and K462). Manual docking of inositol (1,3,4,5)-

tetrakisphosphate (Ins(1,3,4,5)P4) in the active site of PTEN2 was performed as

described by Lee and collaborators [12], and indicated that this phospholipid might

bind to PTEN2 in the same binding mode as that proposed for PTEN (figure 3). Like the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

12

PTEN-C2, PTEN2-C2 lacks the residues present in other Ca2+-dependent C2 containing

proteins that coordinate Ca2+ and regulate membrane binding. A patch of five lysines or

"CBR3 loop" has been proposed by Lee and collaborators to mimic the Ca2+ charge in

PTEN . In PTEN2, none of the five lysine residues in the CBR3 loop of PTEN is conserved

(P 607, P610, Y613, D614, and C616). A second "positive patch" in helix c2 (K644, K646, K649)

is conserved in both PTEN and PTEN2. This region is similar to a helix in phosphilipase

A2 that has been shown to contribute to membrane binding. Together, these analyses

suggest that many of the functional characteristics of the PTEN structure are conserved

in PTEN 2.

PTEN 2 is expressed in a specific stage of sperm development. Northern blot

analysis (figure 3) of various murine tissues using a PTEN 2 probe revealed a discrete

~ 2.7 kb transcript which was specifically expressed in testis, in agreement with

results for the human PTEN 2 sequence [26]. The specificity of testis expression is

underlined by the observation that PCR analysis of multiple murine tissues revealed a

signal only in testis RNA, even after a large number of PCR cycles (figure 3). Because

testis contains a diversity of cell types, some of which (spermatocytes) pass through a

number of developmental stages [27], we decided to analyze this tissue using in situ

hybridization. Isotopic in-situ hybridization (ISH) was performed on adult testis, as

well as on testes representing various stages of adolescence. In the adult testis a positive

signal was observed in germ cells within seminiferous tubules, while cells in the

interstitium of the testis were negative. The positive signal within the seminiferous

tubules showed an uneven distribution with some tubules displaying a strong signal,

while others were completely negative (figure 4). A positive ISH signal appeared to

correlate with the presence of a specific cell population. The positively reacting cells


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

13

reside in the adluminal portion of the tubule, are of small to medium size, have a round

nucleus with evenly distributed, finely granular chromatin and a distinct nucleolus.

Based on morphological criteria, these cells are most consistent with secondary

spermatocytes and/or very early spermatids. The abundance of the positive signal,

together with the short half-life of secondary spermatocytes, makes it likely that both

cell types express PTEN 2. Sertoli cells, spermatogonia, primary spermatocytes or

mature spermatids did not express PTEN 2 RNA. Expression in these cell types was

ruled out on the basis of their location within the seminiferous tubules, size and shape

of cell body and nucleus and chromatin pattern. Expression of PTEN 2 during testicular

maturation is not detected until day 19 of postnatal development (figure 4). In a time

course experiment we were unable to demonstrate PTEN 2 RNA in testes removed on days

3, 7, 10 and 16. The expression of PTEN 2 RNA therefore slightly precedes sexual

maturity in the male mouse, consistent with an association of PTEN 2 with late events of

spermatogenesis.

PTEN 2 is associated with the golgi apparatus. Examination of the PTEN 2

sequence suggested that 4 potential transmembrane domains are found in the protein,

consistent with the possibility that PTEN 2 is a membrane associated molecule which

passes through the secretory pathway. In order to examine the subcellular localization of

PTEN 2, a plasmid encoding a form of the protein with a carboxy-terminal MYC epitope

tag was transfected together with a plasmid encoding a yellow fluorescent protein-

trans/medial golgi marker (encoding the first 81 amino acids of ß1,4

galactosyltransferase) into COS cells, and confocal microscopy was performed. Figure

5 shows that examination of permeabilized cells revealed that PTEN 2 clearly

colocalized with the golgi-associated marker in perinuclear, vesicular structures,

consistent with the suggestion that PTEN 2 was found in the secretory pathway of the


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

14

cell. This localization was further emphasized by examining transfected cells treated

with the golgi disrupting agent, brefeldin. The vesicular, perinuclear localization of both

PTEN 2 as well as the YFP golgi marker was disrupted in these cells (figure 5),

consistent with the localization of both of these proteins to the golgi apparatus.

In order to determine if the amino-terminal transmembrane-containing region

was involved with golgi localization, truncated forms of the protein encoding either the

N-terminal transmembrane motifs or the C-terminal phosphatase and C2 domains were

also expressed in COS cells. Figure 5 reveals that the C-terminal fragment of the protein

appeared as a diffusely stained signal throughout the cytoplasm and in the nucleus, while

the amino terminal fragment containing the transmembrane motifs was found to

colocalize with the perinuclear golgi apparatus in a manner that was similar to the full

length protein, consistent with the suggestion that the subcellular localization of the

protein is mediated by these hydrophobic domains. These results suggest that, in

contrast to PTEN which appears to be cytoplasmically localized in transfected cells,

PTEN 2 appears to be localized to the golgi apparatus via an interaction that is likely to

be mediated by one or more of the amino-terminal transmembrane motifs.

Enzymatic activity of PTEN 2. Homology modeling (figure 2) strongly suggested

that PTEN 2 might be a lipid phosphatase with specificity for the 3-phosphorylated

phosphatidylinositols that are products of a PI3 kinase reaction. In order to examine the

lipid phosphatase activity of PTEN 2, a truncated form of the protein including the

catalytic region and the potential C2 domain was produced in and isolated from

transfected mammalian cells. As a control, a truncated form of PTEN 2 with a mutation

at the critical active site cysteine (Cys458Ala) was also produced. Full length wild type

PTEN and active site mutated (Cys124Ala) were also produced as positive controls using

the baculovirus system. Each of these isolated proteins was tested for dephosphorylation


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

15

of a variety of phosphatidyl inositol substrates in an in vitro malachite green enzyme

assay. Figure 6 illustrates that the wild type version of PTEN was able to release

phosphate from a diversity of substrates, including those containing phosphate at the 3

position. This activity was completely abolished in the Cys124Ala active site mutant (data

not shown). While this apparent lack of substrate specificity is at odds with the accepted

activity of PTEN towards only the 3 phosphate position, it should be remembered that

this assay is performed under artificial conditions in vitro. Importantly, the activity of

the PTEN 2 phosphatase domain appeared to be directed towards substrates containing

phosphates at both the 3 and 5 positions. Thus, while the enzyme showed strong activity

against PIP 3,5 and PIP 3,4,5 substrates, there was lower activity against PIP 3 and

PIP 3,4. Because molecular modeling predicts that this enzyme is a 3 phosphatase,

together with the complete lack of homology between PTEN 2 and phosphatases with

specificity for the 5 position of phosphatidyl inositols, we propose that PTEN 2 removes

the 3 phosphate from the PIP 3,5 and PIP 3,4,5 substrates. However, further analysis

of the structures of the dephosphorylated substrates will be required to delineate the

exact specificity of this enzyme. In summary, as predicted from molecular modeling,

PTEN 2 appears to be a lipid phosphatase with specificity for a subset of 3-

phosphorylated phosphatidylinositols.

Discussion

The regulation of phosphatidyl inositol levels is a critical component of a

diversity of cellular functions ranging from cell survival to membrane trafficking [1].

The levels of these various phospholipids are determined by a number of factors

including the activities of various lipid kinases and phosphatases. One lipid phosphatase,

termed PTEN, is especially interesting because of its association with a survival


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

16

pathway in cells as well as its apparent tumor suppressor activity . Because PTEN is the

first phosphatase, which appears to dephosphorylate phospholipids at the 3 position, the

identification of other phosphatases with similar activity is of great interest. The data

described here report a novel relative of PTEN, termed PTEN 2, which has many of the

enzymatic characteristics of PTEN, but which shows significant differences with the

original enzyme, including a unique cell-type specificity and an association with the

golgi secretory compartment.

The three-dimensional structure of PTEN provided a number of insights into the

potential mechanisms by which this phosphatases recognizes and dephosphorylates its

3-phosphate-containing phospholipid substrates [12]. Because of the high degree of

sequence homology between PTEN and the novel PTEN 2 described here, we were able to

produce a model for the novel enzyme by homology modeling. This model predicted a

number of interesting aspects about the novel enzyme. First the model suggested that the

novel enzyme should have lipid phosphatase activity specific for the 3 position of the

phospholipid, and this prediction was confirmed in our enzymatic assays. In addition, the

model predicted that the novel phosphatase contains a C-terminal C2 domain which has

the potential for interacting with membrane lipids. Perhaps more interesting is the

conservation in the interface between the phosphatase and C2 domain in both PTEN and

PTEN 2. This conservation suggests that this region may have functional importance, and

analysis of tumor-derived mutations in this region of PTEN suggested that this interface

is important for the maintenance of enzyme activity [12]. Interestingly, enzymatic

analysis suggests that PTEN 2 has a greater degree of specificity for phospholipids

containing phosphate at both the 3 and 5 positions. It will be important to examine the

differences between the PTEN and PTEN 2 phosphatase domains to determine the

mechanism by which this specificity is attained. The current model of PTEN 2, together


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

17

with the crystal structure of PTEN, should prove useful for structural predictions that

can be tested in enzymatic assays.

A major difference between PTEN and PTEN 2 is the extended N-terminus, which

contains 4 potential transmembrane domains. These domains appear to be involved with

the localization of PTEN 2 to the golgi apparatus, as demonstrated by colocalization with

a known golgi marker protein as well as mislocalization of both PTEN 2 and the marker

protein in the presence of the golgi disrupting agent brefeldin. PTEN was previously

suggested to localize to the cell surface restricted phospholipid substrate, and

particularly to the tight junctions of epithelial cells, through a PDZ domain mediated

interaction with a family of tight junction MAGUK proteins termed the MAGIs [23].

PTEN 2 appears to have solved the membrane localization dilemma by incorporating the

hydrophobic N-terminal region. However, this hydrophobic region appears to have more

complex functions than mere localization to the golgi apparatus. For example, the

multiple transmembrane domains in the N terminus of PTEN 2 are reminiscent of ion

channels, and homology analysis of this region of PTEN 2 suggests a distant relationship

with sodium channels (data not shown). The role that PTEN 2 plays in the regulation of

the golgi apparatus remains to be determined. However, a diversity of studies has

suggested that 3 phospholipids are involved with membrane trafficking and,

particularly, with the formation of multivesicular bodies [28] [29] [30] [31] [32]

[33]. For example, yeast mutants in phospholipid kinases, which produce either PIP 3

or PIP 3,5, are found to be defective in the formation of the multivesicular body [30]. It

should be noted that PTEN 2, which has specificity for the PIP 3,5 phospholipid, might

thus be involved with the regulation of this structure in mammalian cells. Further work

will be required to determine the exact role of PTEN 2 in membrane trafficking, but its

localization to the golgi, an important mediator of vesicular trafficking, together with


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

18

its specificity for PIP 3,5, a known mediator of membrane trafficking, jointly suggest

that this enzyme may play a role in regulating some aspect of vesicular localization in

the cell.

Finally, the highly specific expression of the PTEN 2 phospholipid phosphatase in

a specific subset of developing sperm cells suggests that it might play an important role

in the terminal differentiation of sperm. The cell type which shows predominant

expression of PTEN 2 was the secondary spermatocyte, a stage of spermatogenesis that

occurs just before the large morphological changes which accompany the production of

mature sperm [27]. A potential role for PTEN 2 in terminal sperm differentiation is

also supported by our finding that the transcript for the enzyme appears simultaneously

with the development of mature sperm and sexual maturity (figure 4). Interestingly,

the golgi of the late spermatocyte undergoes a profound morphological change to become

the acrosome of the mature sperm. The possibility that PTEN 2 may be involved with

this morphological change is appealing for a number of reasons. First, of course, is the

temporal expression of the mRNA encoding this phosphatase at a time when this profound

morphological change occurs. Second is the subcellular localization of the phosphatase in

the golgi apparatus of transfected cells. Finally, and perhaps most interestingly, is the

notion that modulation of phospholipid levels in subcellular compartments might be

involved with aspects of vesicular trafficking, as mentioned above. Together, these

results suggest that the specific expression of PTEN 2 in the golgi of secondary

spermatocytes might be required for at least one of the important developmental changes

which sperm progenitors undergo as they differentiate to become mature sperm.

In summary, the results reported here suggest that a closely related homologue of

PTEN, termed PTEN 2, appears to be a golgi-associated lipid phosphatase, which is

expressed, in the terminal stages of sperm development. While the exact function of this


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

19

phosphatase remains to be determined, the data suggest a potential role in membrane

trafficking regulated by the golgi apparatus. It will be of significant interest to produce

mice that are null mutants of this enzyme to determine its role in spermatogenesis, and

we are currently analyzing mice with mutations in this phosphatase. In addition,

further studies into the exact specificity of the phosphatase in vivo, as well as the effects

of the expression of this enzyme on vesicular trafficking, should provide insights into

its function. Finally, the mechanisms by which this phosphatase specifically degrades

3,5-containing phospholipids will require a further understanding of the structure-

function relationships of the catalytic site. Together, these data may highlight a novel

role for this phosphatase in a critical aspect of mammalian reproduction.

References

1. Toker, A. and Cantley, L. Signaling through the lipid products of

phosphoinositide-3-OH kinase. Nature, 1997. 387: p. 673 - 676.

2. Chan, T., Rittenhouse, S., and Tsichlis, P., AKT/PKB and other D3

phosphoinositide-regulated kinases:kinase activation by phosphoinositide-dependent

phosphorylation. Ann. Rev. Biochem., 1999. 68: p. 965-1014.

3. Brunet, A., A. Bonni, M.J. Zigmond, M.Z. Lin, P. Juo, L.S. Hu, M.J. Anderson, K.C.

Arden, J. Blenis, and M.E. Greenberg, Akt promotes cell survival by phosphorylating and

inhibiting a Forkhead transcription factor. Cell, 1999. 96(6): p. 857-68.

4. Li, J., C. Yen, D. Liaw, K. Podsypanina, S. Bose, S.I. Wang, J. Puc, C. Miliaresis,

L. Rodgers, R. McCombie, S.H. Bigner, B.C. Giovanella, M. Ittmann, B. Tycko, H.

Hibshoosh, M.H. Wigler, and R. Parsons, Pten, a Putative Protein Tyrosine Phosphatase

Gene Mutated In Human Brain, Breast, and Prostate Cancer. Science, 1997.

275(5308): p. 1943-1947.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

20

5. Steck, P., Pershouse, MA., Jasser, SA., Yung, WKA. , Lin, H., Ligon, AH.,

Langford, B. LA. , ML., Hattier, T. , Davis, T. , Frye, C. , Hu, R., Swedlund, B. , Teng,,

and S. DHF. and Tavtigian, Identification of a candidate tumor suppressor gene, MMAC1,

at chromosome 10q23 that is mutated in multiple advanced cancers. Nature Genetics,

1997. 15(4): p. 356-362.

6. Li, D.M. and H. Sun, Tep1, Encoded By a Candidate Tumor Suppressor Locus, Is a

Novel Protein Tyrosine Phosphatase Regulated By Transforming Growth Factor Beta.

Cancer Research, 1997. 57(11): p. 2124-2129.

7. Cairns, P., K. Okami, S. Halachmi, N. Halachmi, M. Esteller, J.G. Herman, W.B.

Isaacs, G.S. Bova, and D. Sidransky, Frequent Inactivation Of Pten/Mmac1 In Primary

Prostate Cancer. Cancer Research, 1997. 57(22): p. 4997-5000.

8. Rasheed, B.K.A., T.T. Stenzel, R.E. McLendon, R. Parsons, A.H. Friedman, H.S.

Friedman, D.D. Bigner, and S.H. Bigner. Pten Gene Mutations Are Seen In High-Grade

But Not In Low-Grade Gliomas. Cancer Research, 1997. 57(19): p. 4187-4190.

9. Tashiro, H., M.S. Blazes, R. Wu, K.R. Cho, S. Bose, S.I. Wang, J. Li, R. Parsons,

and L.H. Ellenson, Mutations In Pten Are Frequent In Endometrial Carcinoma But Rare In

Other Common Gynecological Malignancies. Cancer Research, 1997. 57(18): p. 3935-

3940.

10. Eng, C. and M. Peacocke, Pten and Inherited Hamartoma-Cancer Syndromes.

Nature Genetics, 1998. 19(3): p. 223.

11. Maehama, T. and J.E. Dixon, The Tumor Suppressor, Pten/Mmac1,

Dephosphorylates the Lipid Second Messenger, Phosphatidylinositol 3,4,5-

Trisphosphate. Journal of Biological Chemistry, 1998. 273(22): p. 13375-13378.

12. Lee, J., Yang, H., Georgescu, M., Di Cristofano, A., Maehama, T., Shi, Y., Dixon,

J., Pandolfi, P. and Pavletich, N., Crystal structure of the PTEN tumor suppressor:


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

21

implications for its phosphoinositide phosphatase activity and membrane association.

Cell, 1999. 99: p. 323-334.

13. Haas-Kogan, D., N. Shalev, M. Wong, G. Mills, G. Yount, and D. Stokoe, Protein

kinase B (PKB/Akt) activity is elevated in glioblastoma cells due to mutation of the

tumor suppressor PTEN/MMAC. Curr Biol, 1998. 8(21): p. 1195-1198.

14. Whang, Y.E., X. Wu, H. Suzuki, R.E. Reiter, C. Tran, R.L. Vessella, J.W. Said,

W.B. Isaacs, and C.L. Sawyers, Inactivation of the tumor suppressor PTEN/MMAC1 in

advanced human prostate cancer through loss of expression. Proc Natl Acad Sci U S A,

1998. 95(9): p. 5246-50.

15. Wu, X., K. Senechal, M.S. Neshat, Y.E. Whang, and C.L. Sawyers, The

PTEN/MMAC1 tumor suppressor phosphatase functions as a negative regulator of the

phosphoinositide 3-kinase/Akt pathway [In Process Citation]. Proc Natl Acad Sci U S A,

1998. 95(26): p. 15587-91.

16. Furnari, F., Lin, H., Huang, H., and Cavanee, W., Proc. Natl. Acad. Sci. USA,

1997. 94: p. 12479-12484.

17. Cheney, I.W., D.E. Johnson, M.T. Vaillancourt, J. Avanzini, A. Morimoto, G.W.

Demers, K.N. Wills, P.W. Shabram, J.B. Bolen, S.V. Tavtigian, and R. Bookstein,

Suppression Of Tumorigenicity Of Glioblastoma Cells By Adenovirus-Mediated

Mmac1/Pten Gene Transfer. Cancer Research, 1998. 58(11): p. 2331-2334.

18. Dicristofano, A., B. Pesce, C. Cordoncardo, and P.P. Pandolfi, Pten Is Essential

For Embryonic Development and Tumour Suppression. Nature Genetics, 1998. 19(4):

p. 348-355.

19. Stambolic, V., Suzuki, A.Delapompa, J. L.Brothers, G. M.Mirtsos,C.Sasaki,

T.Ruland, J.Penninger, J. M.Siderovski, D. P. and Mak, T. W, Negative Regulation Of

Pkb/Akt-Dependent Cell Survival By the Tumor Suppressor Pten. Cell, 1998. 95 (1):

29-39.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

22

20. Ogg, S.and Ruvkun G., The C. elegans PTEN homolog, DAF-18, acts in the insulin

receptor-like metabolic signaling pathway. Mol. Cell, 1998. 2: p. 887-893.

21. Goberdhan, D., Parico, N., Goodman, E., Mlodzik, M. and Wilson, C., Drosophila

tumor suppressor PTEN controls cell size and number by antagonizing the Chico/PI3

kinase signaling pathway. Genes and Dev., 1999. 13(24): p. 3244-3258.

22. Gao, X., Neufeld, T. and Pan, D., Drosophila PTEN regulates cell growth and

proliferation through PI3K-dependent and independent pathways. Dev. Biol., 2000.

221(2): p. 404-418.

23. Wu, Y., Dowbenko, D., Spencer, S., Laura, R., Lee, J., Gu, Q. and Lasky, L.A.,

Interaction of the tumor suppressor PTEN/MMAC with a PDZ domain of MAGI 3, a novel

membrane associated guanylate kinase. J. Biol. Chem., 2000. 275(28): p. 21477-

21485.

24. Watton, S.and Downward, J.., Akt/PKB localisation and 3 ' phosphoinositide

generation at sites of epithelial cell-matrix and cell-cell interaction. Current Biology,

1999. 9: p. 433-436.

25. Maehama, T., Taylor, G.S., Slama, J.T., and Dixon, J.E., A sensitive Assay for

phosphoinositide phosphatases. Anal. Biochem., 2000. 27: p. 248-250.

26. Chen H., R., C., Morris, M., Scott, H., Gos, A., Bairoch, A. and Antonarakis, S., A

testis-specific gene, TPTE, encodes a putative transmembrane tyrosine phosphatase and

maps to the pericentromeric region of human chromosomes 21 and 13 and to

chromosomes 15, 22 and Y. Hum. Genet., 1999. 105: p. 399-409.

27. Kerr, J., Macro, micro and molecular research on spermatogenesis: the quest to

understand its control. Microscopy Res. and Tech., 1995. 32: p. 364-384.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

23

28. Gaullier, J., Gillooly, D., Simonsen, A., and Stenmark, H., Regulation of endocytic

membrane traffic by phosphatidylinositol 3 phosphate. Biochem. Soc. Trans., 1999.

27(4): p. 666-670.

29. Cooke, F., Dove, S., McEwen, R., Painter, G., Holmes, A., Hall, M., Michell, R.,

and Parker, P., The stress-activated phosphatidylinositol 3-phosphate 5-kinase Fab1p

is essential for vacuole function in S. cerevisiae. Curr. Biol., 1998. 8: p. 1219-1222.

30. Fernandez-Borja, M., Wubbolts, R., Calafet, J., Janssen, H., Dicheva, N.,

Dusseljee, S. and Neefjes, Multivesicular body morphogenesis requires

phosphatidylinositol 3 kinase activity. Curr. Biol., 1999. 9: p. 55-58.

31. Kobayashi, T., Stang, E., Fang, K., Moerloose, P., Parton, R. and Gruenberg, J., A

lipid associated with the antiphospholipid syndrome regulates endosome structure and

function. Nature, 1998. 392: p. 193-197.

32. Reaves, B., Bright, N., Mullock, B., and Luzio, J., The effect of wortmannin on

the location of lysosomal type 1 integral membrane glycoproteins suggest a role for

phosphoinositide 3-kinase activity in regulating membrane traffic late in the endocytic

pathway. J. Cell Science, 1996. 109: p. 749-762.

33. Brown, W., DeWald, D., Emr, S., Plutner, H. and Balch, W., Role for

phosphatidylinositol 3-kinase in the sorting and transport of newly synthesized

lysosomal enzymes in mammalian cells. J. Cell Biol., 1995. 130: p. 781-796.

Figure Legends

Figure 1. Sequence, hydropathy and domain model of PTEN 2. A. The

sequence comparison between murine and human [26] PTEN 2 and human PTEN. The

localization of putative transmembrane domains as predicted by a structural algorithm

(Dr. Thomas Wu-unpublished data) as well as the predicted phosphatase domain are


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

24

overlined. B. Hydropathy analysis of the murine PTEN 2 sequence illustrated in A

reveals the localization of the 4 potential transmembrane domains. The localization of

the phosphatase domain is also illustrated. The human PTEN 2 sequence showed a similar

pattern (data not shown). C. A domain model of PTEN 2 illustrating the membrane

association mediated by the 4 potential N-terminal transmembrane domains and the

phosphatase domain.

Figure 2. Modeling of PTEN 2. A. Sequence alignment of PTEN and PTEN2 used for

the molecular modeling. Hydrophilic and charged residues are displayed in red, and

aromatic/hydrophobic residues are shown in black. The consensus is shown below the

alignment, with conserved hydrophilic/charged and aromatic/hydrophobic mutations

marked as red and black squares, respectively. Residues forming the active site of the

phosphatase and the phosphatase/C2 interface are boxed pink and green, respectively.

Cancer related mutations are highlighted with blue asterisks. Charged residues in the C2

loop involved in contacts with the lipid membrane are marked with red asterisks. B.

Ribbon diagram of the superimposition of the x-ray structure of PTEN (in blue), and

the modeled structure of PTEN 2 (in white). Alpha helices are shown as cylinders, and

beta strands as arrows (r.m.s.d C_ 0.33 Å). a. Zoom in of the active site showing binding

mode of a phosphatidyl inositol 4 phosphate molecule as well as tartrate, a substrate

mimic [12]. Key residues for substrate recognition are shown and labeled in blue for

PTEN and white for PTEN2. b. Zoom in of the PTP/C2 interface highlighting residue

conservation between PTEN and PTEN2.

Figure 3. Transcript distribution of PTEN 2. Northern blot (A) and PCR (B)

analysis of PTEN 2 transcript reveals that the message is only found in testis.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

25

Figure 4. In Situ hybridization analysis of PTEN 2 expression in the

testis. Brightfield (A) and darkfield (B) image (200x magnification) of adult testis

showing expression in three of four testicular tubules. (C) mPTEN 2 RNA expression

in subpopulation of germ cells (arrow; 400x magnification). These cells demonstrate

the morphologic features of secondary spermatocytes and early spermatids (see text).

(D- I ) Dark- and brightfield images of testes at day 10 (D&G), 16 (E&H) and 19

(F&I ) of postnatal life. Day 19, the time when sexual maturity is reached, is the

earliest timepoint with mPTEN 2 expression in testicular germ cells (200x

magnification).

Figure 5. Subcellular localization of PTEN 2. The top panel illustrates confocal

analysis of COS cells transfected with a PTEN 2 construct with a C-terminal myc tag

(red), a marker for the golgi consisting of the first 81 amino acids of ß1,4

galactosyltransferase and the yellow fluorescent protein (green) and the overlapping

image (yellow). Note the perinuclear, vesicular morphology of the costained subcellular

region, which is consistent with the golgi apparatus. The middle panel shows that cells

transfected as in the top panel show delocalization of the two markers when they are

treated with the golgi disrupting agent, brefelfdin. The bottom panels illustrate the

subcellular distribution of various forms of PTEN 2. Note that the full length and N-

terminal, potential transmembrane containing, forms associate with the perinuclear

golgi region, while the C-terminal form shows a diffuse staining over the whole cell,

including the nucleus.

Figure 6. Phospholipid phosphatase activity of PTEN 2. A. The enzymatic

activity of a GST fusion of PTEN 2 produced in mammalian 293 cells and containing the

phosphatase and C2 domains was assayed using the illustrated phospholipids as

substrates. Released phosphate was assayed using the malachite green reagent. B. The


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

26

enzymatic activity of PTEN, including the phosphatase and C2 domains, produced in

baculovirus infected cells was assayed as described in A. In both cases, analysis of

mutants where the active site cysteine was converted to serine showed absolutely no

activity (data not shown).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

0

0.1

0.2

0.3

0.4

0.5PTEN2

PIP1-3P PIP1-4P PIP1-5P PIP2-3,4P PIP2-4,5P PIP2-3,5P PIP3-3,4,5P

0

0.1

0.2

0.3

0.4

0.5

0.6

PTEN

PIP1-3P PIP1-4P PIP1-5P PIP2-3,4P PIP2-4,5P PIP2-3,5P PIP3-3,4,5P


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Laurence A. LaskyYan Wu, Donald Dowbenko, Mayte Pisabarro, Lisa Dillard-Telm, Hartmut Koeppen and

lipid phosphatasePTEN 2 , a golgi-associated testis-specific homologue of the PTEN tumor suppressor

published online March 2, 2001J. Biol. Chem.

10.1074/jbc.M101480200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M101480200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M101480200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2001/03/02/jbc.M101480200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2001/03/02/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2001/03/02/jbc.M101480200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

pten 2 , a golgi-associated testis-specific …3 the production of 3-phosphorylated...

Documents