١۴٣٠/١٢/٠۴

١

Recombinant DNA Technology

(DNA cloning)( N g)

Majid Mojarrad

History of recombinant DNA technology

Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by

i i d d h itwo scientists named Boyer and Cohen in 1973.

Recombinant DNA

Formed when two genes from two different sources -often different species are combined in vitro into the same moleculeThis process is called genetic engineeringp g g gLead to a new field called biotechnology, the manipulation of organisms or their components to make useful products

Fig. Fig. 11..2 2 Many scientific disciplines contribute to molecular Many scientific disciplines contribute to molecular biotechnology, which generates a wide range of commercial biotechnology, which generates a wide range of commercial

productsproducts

DNA cloninggene cloning - prepare multiple identical copies of gene-sized pieces of DNA. Generation of DNA fragment

Joining into a vector or carrier molecule

Introduction into host cell to amplification

Selection of required sequences

١۴٣٠/١٢/٠۴

٢

Genes can be cloned into recombinant DNA vectorsFive steps:

Isolation of vector and geneIsolation of vector and geneInsert gene into vectorTransform bacteria with vectorPlate bacteria under selectionIdentify clones carrying vector

Generation of DNA fragment

Direct chemical synthesis

Restriction enzymatic digestion

Mechanical shearing

Joining into a vector

Homopolymertailing

Sticky end ligation

Blunt end ligation

Introduction into host cell

Transfection with recombinant phage

Transformation with recombinant plasmid

synthesis

PCR

RT-PCR

Use of linker

Ligase independent cloning

Packaging DNA in vitro

Generation of DNA fragment

Enzymatic digestion of purified DNAPCRRT-PCR

Restriction enzymes are used to make recombinant DNA

Cut DNA at specific DNA sequences

symmetrical series of four to eight basesSticky or blunt endsSticky or blunt endsRestriction fragments-specific for each DNA

Origin – bacteriaHow do they protect their own DNA?

Combined by DNA ligase

Methods of Introducing Foreign DNA

TransformationElectroporationConjugation

How can you identify which clones carry the vector?

1) Nucleic acid hybridization2) Isolation of plasmid DNA from individual clones

and restriction mappingPCRPCR

١۴٣٠/١٢/٠۴

٣

PCR: HistoryPCR: History

PCR Invention: PCR Invention: 1987 1987 KaryKary MullisMullis

PCR is essentially DNA replication in a tube.PCR is essentially DNA replication in a tube.

Series of repetitive steps enabling amplificationSeries of repetitive steps enabling amplificationof target DNA from a complex mixture of DNAof target DNA from a complex mixture of DNA

The major advantages of PCRThe major advantages of PCR

Speed and ease of useSpeed and ease of use30 30 cycles each taking cycles each taking 33--5 5 minsmins

SensitivitySensitivityCan amplify from a single cell great care must beCan amplify from a single cell great care must beCan amplify from a single cell, great care must be Can amplify from a single cell, great care must be taken to avoid contaminationtaken to avoid contamination

RobustnessRobustnessWill even work on degraded DNA or fixed DNAWill even work on degraded DNA or fixed DNA

Disadvantages of PCRDisadvantages of PCR

Need for Target DNA sequence informationNeed for Target DNA sequence informationTo construct primers you need to know your targetTo construct primers you need to know your target

Short size limit for productShort size limit for productThere is an upper limit to the size of DNA synthesized by There is an upper limit to the size of DNA synthesized by pp y ypp y yPCRPCR

Infidelity of replicationInfidelity of replicationBecause the PCR polymerases are heat stable they ten not to Because the PCR polymerases are heat stable they ten not to have the have the 33’’-->>55’ exonuclease activity’ exonuclease activity

BasicsBasicsTargetTarget

dNTP’sdNTP’s

BufferBuffer

DenatureDenature-- 929200CC--959500C C ((949400C)C)

AnnealAnneal-- 505000CC--727200CCAim for Aim for 5500C below C below calculated Tmcalculated Tm

PrimersPrimers

DNA DNA TaqTaq polymerasepolymerase

calculated Tmcalculated Tm((525200CC--585800C generally best)C generally best)

Extension Extension -- 686800CC--808000CC((727200C)C)highest efficiency highest efficiency 707000CC--808000CC

TemplateTemplate

PlasmidPlasmidcDNAcDNA (RT(RT--PCR)PCR)Genomic DNAGenomic DNA

Purified (P)Purified (P)Crude Crude LysateLysate (C)(C)

P C P CPlasmid Genomic

40ng 10ng 1ng

١۴٣٠/١٢/٠۴

۴

dNTPsdNTPs

Mixture of Mixture of dATPdATP, , dCTPdCTP, , dGTPdGTP, , dTTPdTTP or or dUTPdUTPPurityPurity-- chemical or enzymatic synthesischemical or enzymatic synthesisStabilityStability-- concentration concentration –– Li or Na salt formLi or Na salt form

BufferBufferAll All 1010x Buffers are not the samex Buffers are not the same

SaltSalt 1010--50 50 mMmM TrisTris pH pH 88..33

MonovalentMonovalent cationcation 100100--150 150 mMmM KClKCl or or NaClNaCl

Divalent Divalent cationcation 11..55uM or > MgCluM or > MgCl22++

MgMg22+, Mn+, Mn22++

Additives Additives Detergent, Glycerol, GelatinDetergent, Glycerol, Gelatin

Buffer SystemsBuffer SystemsModifications:MgpHIonic strength AdditivesAdditives

Ionic strength

Mg2+

Buffer AdditivesBuffer Additives

QQ--solutionsolution--BetaineBetaineDMSODMSOBSA BSA GlycerolGlycerolGlycerolGlycerolGelatinGelatinPEG PEG GCGC--meltmeltFormamideFormamideDetergents Detergents Q D B G P Q/D F D

PrimersPrimers

Pair complementary to opposite strandsPair complementary to opposite strands55’’ 33’ sense primer’ sense primer33’’ 55’ anti’ anti--sense primer sense primer

FeaturesFeatures1818--26 26 nucleotidesnucleotides Equal mix GC to AT basesEqual mix GC to AT bases

Match Tm of primersMatch Tm of primers Tm Tm ooCC= = 22(A/T) + (A/T) + 44(G/C)(G/C)

33’ Stability ’ Stability GG or GC clampsGG or GC clamps

Additional ConsiderationsAdditional Considerations

Secondary structureSecondary structure-- avoid hairpins, selfavoid hairpins, self--dimersdimers, cross, cross--homologyhomology

AvoidAvoid didi--nucleotide repeats that occur consecutivelynucleotide repeats that occur consecutively--Avoid Avoid didi nucleotide repeats that occur consecutivelynucleotide repeats that occur consecutivelyATATATATATATATAT

Avoid long runs of single basesAvoid long runs of single bases-- ACGGGGGGATACGGGGGGAT

Avoid crossAvoid cross--homologyhomology-- BLAST TestBLAST Test

١۴٣٠/١٢/٠۴

۵

Primer Variation ExamplePrimer Variation ExamplePCR 1st Round vary primer pairs Sets A-F

A= Primer 1F Primer 1RB= Primer 2F Primer 1RC= Primer 3F Primer 1RD= Primer 1F Primer 2R

Forward primersPrimer 1: GAGGGCAGATTCGGGAATG Tm=600cPrimer 2: TCGGGAGAGGCCCTTCCC Tm=620cPrimer 3: CAGTTTCCCGGGTTCGGC Tm=600c

Reverse primersPrimer 1: AGCCTAATCAAGTCACTATCAAG Tm=620CPrimer 2: GCAAGTGAGAAAATGGGGAG Tm=600C

D Primer 1F Primer 2RE= Primer 2F Primer 2RF= Primer 3F Primer 2R

DNA Taq PolymerasesDNA Taq PolymerasesConsiderations: Considerations: Aim of experimentAim of experiment

Thermal stabilityThermal stabilityProcessivityProcessivityFidelity Fidelity

DNA Taq PolymerasesDNA Taq PolymerasesStandard polymeraseStandard polymerase works for most applicationsworks for most applicationsStandard polymerase with loading dyeStandard polymerase with loading dye aids in higher throughaids in higher through--putputHot Start polymerase Hot Start polymerase inhibits noninhibits non--specific primer specific primer

extensionextensionPolymerase blends or cocktailsPolymerase blends or cocktails combine polymerases for combine polymerases for

fidelity with speedfidelity with speedfidelity with speedfidelity with speed

Taq blend Standard Taq Hot Start Taq

FidelityPCR product sequence

PCR product T/A clonedIndividual isolates sequenced

PCR CyclingPCR Cycling Modified PCR MethodsModified PCR MethodsHot Start PCRHot Start PCRManual Hot StartManual Hot StartPhysical BarrierPhysical BarrierM difi dM difi d TT DNA lDNA lModified Modified TaqTaq DNA polymeraseDNA polymeraseOligoOligo InhibitorsInhibitorsModified Modified dNTP’sdNTP’s

SemiSemi--Nested or Nested PCRNested or Nested PCRTouch down PCRTouch down PCR

١۴٣٠/١٢/٠۴

۶

SemiSemi--Nested or NestedNested or Nested--PCRPCR

Specificity

-------------------------------------------

Sensitivity

Additional PCR MethodsAdditional PCR MethodsAlleleAllele--specific PCRspecific PCRAssembly PCR (PCA)Assembly PCR (PCA)Breakpoint PCRBreakpoint PCRIntersequenceIntersequence--specific PCR (ISSR)specific PCR (ISSR)InverseInverse--PCR (IPCR or REPCR (IPCR or RE--PCR)PCR)Ligation Mediated PCR (LMLigation Mediated PCR (LM--PCR)PCR)Long distance PCRLong distance PCRMultiplexMultiplex--PCRPCRMethylation Specific PCR Methylation Specific PCR MiniMini--primer PCRprimer PCRQuantitative PCR or RealQuantitative PCR or Real--time PCRtime PCRReverse Transcriptase PCR (RTReverse Transcriptase PCR (RT--PCRPCR))

RTRT--PCRPCR

Quality of RNA

Reverse Transcriptase-QColigo dTrandom hexamersgene specific primers

MultiplexMultiplex--PCRPCR

2 3 4 5 6 7 81 9

Increase throughputIncrease data with limited material

Exon 7 and 8Exon 9Exon 3

Exon 5Exon 1Exon 2Exon 6

Exon 4

LongLong--PCRPCRAnalyze large area in single reaction

Tool to analyze inserts and breakpoints

14kb

3kb

1.6kb20kb

BreakpointBreakpoint--PCRPCR

Isolate low frequency event Isolate low frequency event

١۴٣٠/١٢/٠۴

٧

InverseInverse--PCR and REPCR and RE--Inverse PCRInverse PCRIsolate unknown flanking regionIsolate unknown flanking regionDigest with restriction enzymeDigest with restriction enzymeLigate with TLigate with T4 4 DNA ligaseDNA ligase

Restriction fragment length polymorphismRestriction fragment length polymorphism

Allele specificAllele specificPCRPCR

Genomic WalkingGenomic Walking

TaqManTaqMan™ ™ assayassay

Allele specific PCR using the 5’ to 3’ exoactivity and a third primer with a Fluor

d Q hand Quencher.

RealReal--Time PCR or QTime PCR or Q--PCRPCR

Increased SensitivityIncreased SensitivityIncreased SpecificityIncreased SpecificityIncreased ThroughputIncreased Throughput

١۴٣٠/١٢/٠۴

٨

Designing of primers

Identification of restriction map:http://www.firstmarket.com/cutter/cut2.html

Primer Design http://frodo wi mit edu/primer3/http://frodo.wi.mit.edu/primer3/

Evaluation of primers specifityhttp://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome

Introducing of restriction sites

PCR reaction

PCR cycle Cloning of PCR products

Plasmid digestionPCR product digestionMeasurement of molar concentration of DNA

htt // b i th t d /bi t l / lihttp://www.basic.northwestern.edu/biotools/oligocalc.htmlLigationtransformation

transformation

Heat shockelectroporation

١۴٣٠/١٢/٠۴

٩

Preparing mediumAntibiotic selectionLiquid culturePl id t tiPlasmid extractionPlasmid identity confirmationSequencing subcloning

Extraction of plasmid