REGULATION OF ALGINATE AND PSL POLYSACCHARIDE EXPRESSOIN IN CLINICAL STRAINS OF PSEUDOMONAS AERUGINOSA

BY

CYNTHIA R. RYDER

A Dissertation Submitted to the Faculty of

WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

In the Department of Microbiology and Immunology

Of Wake Forest University

August 2010

Winston-Salem, North Carolina

Approved By:

Daniel J. Wozniak, Ph.D., Advisor ____________________________

Examining Committee:

Mark Lively, Ph.D., Chairman ____________________________

Rajendar Deora, Ph.D. ____________________________

David Ornelles, Ph.D. ____________________________

William E. Swords, Ph.D. ____________________________

ACKNOWLEDGEMENTS

First and foremost, I would like to thank the best boss anyone has ever had, Dan Wozniak. Your patience and guidance have helped to make these five years a wonderful time. You are always able to calm me down and build me up whenever I needed it. Your door was always open, even for my “real quick” moments. If my future bosses are half as great as you, I will be blessed. Even though you wouldn’t let me change the name of AmrZ.

Next, I express my appreciation to my committee, Dr. Ornelles, Dr. Lively, Dr. Swords, and Dr. Deora. You have been dedicated to this project and to my growth as a scientist. Never, in all of our meetings, did I doubt that you were on my side. Your criticisms were always tempered with praise and genuine excitement for the work I was doing. I am grateful for the wisdom you have imparted to me.

My thanks and gratitude also go to the entire Microbiology and Immunology department at Wake Forest and the Center for Microbial Interface Biology at Ohio State University. Every single person in the department, past and present, has made my time there fruitful and fun. And I know many great things are in the future for you all.

To my classmates: We bonded right from the start, during interview weekend. The five of us have been so close, I can’t imagine grad school without any of you. Eric, the Mayor of Biochem Town and the Queen of manliness, you never let us be too girly and always encouraged us to talk more about food! Mary, the Queen of Random, your kind and caring disposition warmed us all and reminded us to stop and take a breath. Cheraton, Queen of Sketchiness, your humor made the hard times better and the good times hilarious. Book clubs, tv show quotes, “oh by the way” weddings, and a hot trip to AZ, you will always be my twin. Kristen, Queen of Sass, Yarn Guru, and Mom to us all, it’s been a long road. But we have stood by each other, pointy sticks and all. Mama K, we’ve got a long way to go!

To the Woz lab members, from Wake and OSU, what a great ride it’s been! Halloween excitement, The Dan Wozniak Fan Club, moving labs and schools. I wouldn’t have chosen a different group of coworkers and friends, not matter what. Clearly, the boss knew what he was doing will all of you.

To the numerous and blessed members of College Park Baptist Church and Linworth Baptist Church, you walked the whole way with me. Your prayers and encouragement, lunches and cards, got me through every step of these past five years. The choir, the 7th and 8th grade Sunday School kids, the youth group, my little nursery toddlers, the Young Adults class, and everyone else I encountered, thank you. My life is better and fuller because of you.

Cindy, Mary, Melissa, Leigh, Megan, The Boys, Joanna, Jasmine, and Linda, I can’t fit all of my thanks and memories for each of you here, but you have each been a blessing to my life. I never would have made it through without you. Last, and certainly not least, to my family: There are so many of you, and you each supported and loved me through all my years of study. Mom, Dad, Bob, Rhonda, Robin, Katie, and Lance, this is for you.

ii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .ii

TABLE OF CONTENTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iii

LIST OF ILLUSTRATIONS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v

ABREVIATIONS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .vii

ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

CHAPTER1: INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

CHAPTER 2: MATERIALS AND METHODS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

CHAPTER 3: INVERSE REGUALTION OF PSL AND ALGINATE

POLYSACCHARIDES BY AmrZ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .32

Presence of Psl genes in nonmucoid and mucoid strains. . . . . . . . . . . . . . . . . . . .38

Polysaccharide production in nonmucoid and mucoid pairs. . . . . . . . . . . . . . . . .40

Transcriptional repression of psl in mucoid strains. . . . . . . . . . . . . . . . . . . . . . . .44

AmrZ represses psl expression in mucoid strains. . . . . . . . . . . . . . . . . . . . . . . . . 46

AmrZ binds to the psl promoter region. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

CHAPTER 4: ANALYSIS OF PSL PRODUCTION IN CLINICAL STRAINS OF P.

AERUGINOSA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .51

Characterization of strains. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .52

Nonmucoid strains and Psl production. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

Nonmucoid strains and Attachment. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .56

Mucoid strains and Psl production. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .60

Comparison of Psl and alginate levels in clinical mucoid strains. . . . . . . . . . . . . 63

Psl production in parental and revertant strains. . . . . . . . . . . . . . . . . . . . . . . . . . .65

iii

Psl production in mucA complemented strains. . . . . . . . . . . . . . . . . . . . . . . . . . . 67

CHAPTER 5: DISCUSSION. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

REFERENCES. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80

APPENDICIES

A. Raw Data of Representative Experiments of Clinical Strains Used in This

Study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89

B. Complementation and Revertant Data of Mucoid Strains. . . . . . . . . . . . . . . .96

C. mucA Complementation of Mucoid Clinical Strains. . . . . . . . . . . . . . . . . . . .98

SCHOLASTIC VITA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102

iv

LIST OF FIGURES

TABLES

I Strains and Plasmids used in this study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .34

II Oligosaccharides used in this study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

III Alginate and Psl values of two mucoid/nonmucoid strain pairs. . . . . . . . . . . . . . 41

FIGURES

1 Subunit structures of alginate and Psl polysaccharides. . . . . . . . . . . . . . . . . .10

2 Mucoid Conversion Pathways. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .12

3 Typical pathway of alginate regulation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

4 Structure of psl and pel operons. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .16

5 Regulation of psl and pel by GacS/GacA/rsmZ pathway . . . . . . . . . . . . . . . .22

6 Mutation of algU/T in PAO1 results in decreased expression and production

of Psl . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .24

7 psl genes are present and functional in PAO1 and FRD1 backgrounds . . . . .39

8 Psl expression is decreased in mucoid strains. . . . . . . . . . . . . . . . . . . . . . . . . 42

9 Transcription of psl genes is decreased in mucoid strains. . . . . . . . . . . . . . . .45

10 Deletion of algT and amrZ leads to an increase of Psl in FRD1 . . . . . . . . . . 47

11 AmrZ binds to the psl promoter region . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .49

12 Psl values of nonmucoid clinical strains compared to Psl value of PAO1 . . .54

13 Psl and attachment values of nonmucoid clinical strains divided by geography

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58

14 Psl values of clinical mucoid strains compared to Psl value of FRD1 . . . . . .61

v

15 Comparison of Psl levels to alginate levels in clinical mucoid strains . . . . . .64

16 Psl levels of parental mucoid and revertant nonmucoid strains . . . . . . . . . . . 66

17 Complementation of mucoid strains with mucA . . . . . . . . . . . . . . . . . . . . . . .68

18 Model of inverse regulation of Psl and alginate in mucoid strains. . . . . . . . . 73

APPENDICIES

A Raw Data of Clinical Strains Used in This Study . . . . . . . . . . . . . . . . . . . . . . . . .89

B Complementation and Revertant Data of Mucoid Strains. . . . . . . . . . . . . . . . . . .96

C mucA Complementation of Mucoid Clinical Strains. . . . . . . . . . . . . . . . . . . . . . .98

vi

ABREVIATIONS

bp – base pair

c-di-GMP – bis-(3’,5’)-cyclic diguanylic acid

CF – cystic fibrosis

CFTR – cystic fibrosis transmembrane conductance regulator

CLSM – confocal laser scanning microscopy

COPD – chronic obstructive pulmonary disorder

DNA – deoxyribonucleic acid

E. coli – Escherichia coli

eDNA – extracellular DNA ELISA – enzyme-link immunosorbent assay

EMSA – electrophoretic mobility shift assay

IL-1 – Interleukin-1, proinflammatory cytokine

IPTG - isopropyl-β -D-thiogalactoside

LPS – lipopolysaccharide

NPG - p-nitrophenyl-α -D-galactoside

OD – Optical Density

pNPF - p-nitrophenyl α-L-fucose

P. aeruginosa – Pseudomonas aeruginosa

Pel – pellicle polysaccharide

PQS – Pseudomonas quinolone signal

Psl – polysaccharide from polysaccharide synthesis locus

TNF-α – Tumor Necrosis Factor- alpha, proinflammatory cytokine

vii

UTI – urinary tract infection

WT – wild type

viii

ABSTRACT

Pseudomonas aeruginosa is an ubiquitous opportunistic pathogen, which is often the

terminal pathogen for patients suffering from cystic fibrosis (CF), a genetic disorder

affecting the patient’s ability to clear respiratory infections. The P. aeruginosa strains

most often recovered from patients suffering from long-term chronic infections are

mucoid, overexpressing the polysaccharide alginate. Alternatively, most environmental

and acute infection strains are non-mucoid and produce an alternative polysaccharide,

designated Psl. Both alginate and Psl polysaccharides promote biofilm formation and

thus persistence of P. aeruginosa during infections. We hypothesize that mucoid strains

express reduced Psl levels, indicating coordinate regulation between different

polysaccharide genes. To test this, we performed immunoblotting with a Psl-specific

antibody on two sets of mucoid and nonmucoid isogenic isolates. Mucoid P. aeruginosa

strains consistently produce less Psl than their isogenic nonmucoid counterparts. We

subsequently evaluated whether one or more of the alginate regulatory gene products

repress Psl production in mucoid strains of P. aeruginosa. Psl immunoblots and ELISAs

showed that the alginate regulator AmrZ represses Psl production. AmrZ is a DNA

binding protein and is thus a candidate for transcriptional repression of the psl operon.

DNA binding assays show that AmrZ does bind upstream of the first gene in the psl

operon, in a region overlapping with the promoter of this operon. Transcriptional fusions

confirm that AmrZ functions as a repressor of psl transcription as well as an activator of

alginate genes. These findings support the hypothesis that P. aeruginosa infection in the

CF lung involves a progression from nonmucoid strains producing Psl to mucoid strains

producing alginate. An evaluation of clinical nonmucoid and mucoid strains of P.

ix

aeruginosa illustrated that polysaccharide expression in the clinical setting is more

complicated than previously understood, with Psl levels varying in nonmucoid and

mucoid strains. Therefore, Psl expression in mucoid strains does not always follow the

repression described here, but requires further study in cases involving elevated Psl in

mucoid strains. Understanding the genetic and biochemical properties of these isolates

may allow us to develop practical therapies that prevent P. aeruginosa colonization or the

transition to the mucoid phenotype.

x

CHAPTER ONE

INTRODUCTION

Portions of this Chapter were previously published in the following review: Role of polysaccharides in Pseudomonas aeruginosa biofilm development. Cynthia Ryder, Matthew Byrd, and Daniel J Wozniak Current Opinion in Microbiology 2007, 10:644–648

1

The genus Pseudomonas, until fairly recently, included a large range of bacteria,

including strains now assigned to the Burkholderia, Ralstonia, and Stenotrophomonas

genera. Pseudomonas aeruginosa is a gram negative γ-proteobacterium, found

ubiquitously in the soil and water (1). Interest in the denitrification capacity of P.

aeruginosa is being investigated as well as surfactants produced by the bacterium (1, 2).

Both of these abilities have industrial and environmental implications, as non-petroleum

derived chemicals and natural denitrification gain attention (1, 2). The ability of P.

aeruginosa to infect plants, insects, nematodes, and animals offers infection models to

aid pathogenesis studies of this organism (3).

Pseudomonas aeruginosa. Pseudomonas aeruginosa, as an opportunistic pathogen,

typically only infects those who are already immunocompromised (4). Cancer and bone

marrow transplant patients suffer from pneumonia and septicemia caused by P.

aeruginosa (5). P. aeruginosa also causes ventilator-associated pneumonia in intubated

patients, and bacteremia in burn units (5). AIDS patients are also susceptible to

bacteremia by P. aeruginosa (4). Nosocomial and community acquired infections in

hospitalized, nursing home, and COPD patients are caused by this pathogen. While most

P. aeruginosa infections are acute in nature, chronic infections are also seen in cystic

fibrosis, chronic obstructive pulmonary disease (COPD), and urinary tract infections

(UTI) patients (4).

Several virulence factors are important for colonization and infection of the host.

Colonization by P. aeruginosa is usually caused by damage to host tissues, often from

surgical or other medical procedures, such as intubation. Once the tissue is damaged, the

bacteria must attach. Pili and flagella are involved in attachment to host cells, but they

2

also activate inflammation through TLR signaling. Once the bacteria are attached to the

host cells, Type III secretion systems (TTSS) are used to transport toxins into the host.

Exotoxin A is also involved in host-cell damage, but it enters the cell via receptor-

mediated endocytosis (4, 5). Other factors, such as proteases, hemolysins, and

rhamnolipids cause tissue damage in the host. These virulence factors are also important

in host evasion (5). Just as they kill host tissue, they also can kill immune cells that have

trafficked to the infected area. Quorum sensing molecules, while usually associated with

biofilms, can also affect the immune system and increase inflammation at the infection

site (4).

Biofilm formation is presumed to be important for persistence of P. aeruginosa

in the host. During biofilm formation, many of the virulence factors listed above are

downregulated; specifically flagella, among others. The matrix that forms around

bacteria in a biofilm provides protection from continued immune cell attack as well as

antimicrobial treatments and mechanical clearance (usually in the lungs). Biofilm

formation is a key factor in chronic infections, which are usually found in cystic fibrosis

patients (4-7).

Clinical studies of P. aeruginosa infection. Much study and consideration has been

given to infections by P. aeruginosa, both acute and chronic manifestations. Through the

work of many laboratories and clinics, genotypic and phenotypic trends have been

uncovered (8-12). While Wolfgang et al. have shown that most isolates from the

environment and clinic share a core set of genes, including a large cohort of virulence

factors, these strains have varied phenotypes and live in various niches (10). Strains were

obtained from water, soil, blood, UTI, CF, and ocular infections. While there are some

3

genetic differences between infecting strains, it seems that regulation of gene expression

and protein expression lead to much of the diversity of clinical strains of P. aeruginosa.

There are some distinct exceptions, however, where mutations in specific genes cause

important phenotypes. One of the best studied mutations, and one of the most notable

phenotypes, is the mucA22 mutation which leads to overproduction of the

exopolysaccharide alginate, and will be described further below. Strains overproducing

alginate are referred to as mucoid and these strains are exclusively found in chronic

infections, such as those in cystic fibrosis and chronic obstructive pulmonary disease (11,

13).

Mutations in the gene mutS are also important in CF infections. Strains harboring

these mutant genes are typically resistant to a range of antibiotics as well as having many

other phenotypes important for adapting to the CF lung. These strains, called

hypermutable, accumulate more mutations over time, with specific mutations being

common, such as those in mexZ (involved in antibiotic resistance), lasR (involved in

quorum sensing), and fleQ (involved in flagellar production) (14). Many mucoid strains

are also hypermutators, which is not unexpected as both phenotypes are found in chronic

infection strains (15).

Cystic Fibrosis. Cystic Fibrosis is the most common inheritable lethal disease in the

Caucasian population, but is also a problem for other ethnicities (13). The disease is

caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR)

gene, found on the long arm of Chromosome 7. The CFTR is an apical membrane

chloride channel and a defect in this channel causes problems in the pancreas, sweat

ducts, reproductive organs, and lungs (13, 16). There are more than 1,000 mutations

4

currently catalogued that lead to CFTR dysfunction, and the severity of some CF

symptoms can be deduced if the type of mutation is known (16). However, genetic

typing has not been definitive in estimating future lung deterioration or infection (16).

One proposed mechanism to explain how the loss of proper CFTR function in the lungs

leads to disease is dehydration of the mucus layer and lack of normal mucociliary

clearance of pathogens (13, 16-18). Also, lower oxygen pockets can be found in CF

lungs, promoting growth of bacteria in biofilms that can be sustained in hypoxic or

anaerobic environments; Hassett et al. have shown that P. aeruginosa in specific has this

ability (19). The unique environment of the CF lung seems to promote infection.

Recurring and chronic lung infections are the major cause of morbidity and mortality in

CF patients. Lung infections in CF patients are quite detrimental, causing lessening of

lung function and shortening the lifespan (8, 9). While many organisms, such as

Burkholderia cepacia, Staphylococcus aureus, Haemophilus influenzae, non-tuberculous

mycobacteria, and Aspergillus fumigatus, are known to infect the CF lung, P. aeruginosa

is typically the terminal pathogen (13). Patients with CF are particularly susceptible to

infection by P. aeruginosa and once colonized, carry the bacterium for life (13, 20). We

suspect that the biofilm lifestyle is integral to persistence in the CF lung. In addition to

biofilm formation, overproduction of alginate is a major virulence factor in P. aeruginosa

infections in CF (21). This polysaccharide is typically seen during the chronic phase of

P. aeruginosa infection and aids the bacterium in evading host defenses (22).

Alginate has been shown to have immunomodulatory effects which affect the

pathogenesis of mucoid strains. The mucoid coating itself can inhibit phagocytosis, both

opsonic and nonopsonic (13). If opsonins are present, either on the surface or under the

5

alginate layer, they are not able to appropriately interact with phagocytes. Also, alginate

scavenges reactive oxygen species, which may be important for killing of P. aeruginosa

(13). Alginate may also increase the inflammation and damage seen in the CF lung. This

polysaccharide, along with other antigens, causes stimulation of B-cells which can lead to

hypergammaglobulinemia. This is significant because elevated antibody levels correlate

with worsening disease in CF patients (13). These antibodies are not typically functional

for opsonization and therefore lead to immune-complex mediated inflammation. In

addition, alginate leads to production of IL-1 and TNF-α which are proinflammatory

cytokines (13). This activity of alginate on the immune system of CF patients helps to

explain why mucoid P. aeruginosa is a poor indicator for prognosis.

Chronic Obstructive Pulmonary Disease. While chronic infections of P.aeruginosa

are most often seen in CF, mucoid strains have been documented recently in COPD

patients. Murphy et al. observed that, similar to CF patients, COPD patients experience

persistent carriage of P. aeruginosa (12). The majority of patients sampled showed

infection by P. aeruginosa followed by clearance. Mucoid strains were isolated from

patients with “indeterminate” or persistent carriage. This trend is also seen in CF,

suggesting that treatments used in CF could be translated to treating COPD patients with

P. aeruginosa. However, antibody production against P. aeruginosa does not promote

clearance in COPD or CF (12). Another study in 2008 describes a large number of

mucoid, hypermutable, and small colony variant strains of P. aeruginosa in COPD,

morphotypes also seen in CF chronic infections (11). The chronic strains evaluated in

this study are similar to CF isolates in other ways, as well: decreased motility, decreased

cytotoxicity, increased antibiotic resistance, and increased biofilm capacity. In both

6

studies, patients were found to carry one persistent strain for many months or years,

mirroring observations in CF (11, 12). While the present study does not involve COPD

isolates, the patterns seen with chronic CF strains may be extended to COPD strains

based upon the similarities noted above.

Components of the biofilm matrix. Many factors contribute to the formation and

architecture of biofilms. Extracellular DNA is integral to the structure and integrity of P.

aeruginosa biofilms. A 2002 study by Whitchurch et al. investigated whether

extracellular DNA is required for biofilm formation in P. aeruginosa by treating biofilms

of various ages with DNase I. This study showed that DNA is important for early steps

in biofilm initiation and formation, but that other substances in the matrix may stabilize

the biofilm at later stages (23). Release of extracellular DNA (eDNA) is regulated, at

least in part, by quorum sensing, specifically the pqs quorum sensing system (24, 25).

These studies also illustrate that iron levels affect the amount of extracellular DNA in the

matrix, suggesting another pathway leading to eDNA presence in the biofilm matrix (24,

25).

Another component to consider in biofilm matrix composition is

lipopolysaccharide (LPS). P. aeruginosa has two types of LPS, A-band and B-band, both

of which seem to affect the surface-binding abilities of the cell. Biofilms formed without

B-band LPS were flat and uniform, while those formed with B-band LPS were composed

of microcolonies and clumps of cells (26). The level of oxygen saturation affects the

amount of LPS B-band production, but not that of A-band. More B-band LPS is

produced at higher oxygen saturation. It was suggested by Sabra et al. that B-band LPS

7

may be important in initial attachment of cells to surfaces, but that in the low oxygen

environment of the later biofilm that B-band is downregulated (27).

Membrane vesicles are also an important part of the biofilm matrix. Membrane

vesicles are bilayered spheres composed of outer membrane proteins, LPS, and

phospholipids and enclose periplasmic components, including various virulence factors

(28-30). Membrane vesicles retain much of the surface properties of the parent cell and

can transport virulence factors from a distance to host cells (30). While commonly found

in planktonic culture of gram negative bacteria, Schooling and Beveridge reported that

membrane vesicles were also found in biofilms under many different conditions, leading

them to conclude that membrane vesicles are ubiquitous in the biofilm mode of growth

(28). The authors of this study suggest that membrane vesicles could be a source of LPS,

extracellular DNA, and protective enzymes in the biofilm matrix. Sabra et al. show that

membrane vesicles are more prevalent under conditions of high oxygen saturation,

consistent with planktonic culture studies (27). Schooling and Beveridge explain in their

study that membrane vesicles generated in planktonic culture differ qualitatively and

quantitatively from those found in biofilm cultures, showing multiple roles for these

structures (28).

Two lectins produced by P. aeruginosa, LecA and LecB, are also involved in the

biofilm matrix. Loss of LecA in PAO1 leads to decreased biofilm formation and

overproduction of LecA enhances biofilms (31). The authors also observed that addition

of hydrophobic galactosides, IPTG and NPG in this study, caused dispersal of the

biofilms of the WT parent but not the lecA mutant strain. This suggests a possible

therapeutic use for these compounds against biofilms containing LecA (31). A study by

8

Tielker et al. investigated the role of LecB in biofilm formation. PAO1 deficient in LecB

production showed decreased biofilm formation. LecB binds to L-fucose and treatment

with p-nitrophenyl α-L-fucose (pNPF) releases LecB from the outer membrane where it

is localized (32). In addition to aiding biofilm formation, LecA and LecB are cytotoxic

to host cells both in vitro and in vivo (33). Therefore, the treatments using IPTG, NPG,

and pNPF suggested may help to undermine the P. aeruginosa biofilm as well as lessen

host cell damage (31-33).

Three fimbrial gene clusters named cup (chaperone/usher pathway) play a role in

biofilm formation. Vallet et al. demonstrated in their study of P. aeruginosa strain PAK

that CupA adhesins are involved in biofilm formation through surface adhesion (34).

CupB and CupC are regulated separately from CupA (34). While CupB and CupC

produce distinct adhesins, they are simultaneously regulated and were shown by Ruer et

al. to work synergistically in bacterial clustering and microcolony formation (35). These

two studies suggest that the fimbrial Cup adhesins are needed at different stages of

biofilm formation, with CupA being involved in adhesion and CupB/C involved in

microcolony formation (34, 35).

Alginate. Significant work has been done toward understanding the regulation of the

exopolysaccharide alginate, an important component of mucoid biofilms. Alginate is an

O-acetylated polymer made of β-1,4-linked D-mannuronic and L-guluronic acid (Figure

1).

9

Figure 1

E

Psl pentasaccharide structure

Figure 1. Subunit structures of alginate and Psl polysaccharides.

D -ma nnuronate L-guluronate

O O

OH HOHOOH

COO-

OO

COO-

O

10

Past studies have shown that alginate overproduction, termed mucoidy, is caused by a

mutation in mucA, encoding an anti-sigma factor, in 80% of cases (Figure 2)(36). In the

majority of mucA mutants, a deletion of one G residue in a stretch of 5 Gs at base 440 in

mucA causes a premature stop codon and loss of function of this anti-sigma factor. This

common mutation is termed mucA22. Strings of 4-7 G residues appear to be targeted for

frequent mutation during SOS response by Pol IV (37). Also, mismatch repair deficient

strains of P. aeruginosa have increased incidence of the -1bp mutation at 5-C and 5-G

stretches (38). A truncated MucA allows function of AlgT and overexpression of the

polysaccharide alginate (Figure 3) (13, 39). In nonmucoid strains, MucA sequesters

AlgT, the alternate sigma factor necessary for alginate production. When free from

MucA, AlgT activates other regulators that bind to the alginate operon and lead to

production of the polysaccharide (39). AlgT activates expression of three regulators

required for alginate operon expression: AlgR, AlgB, and AmrZ (40-43). The operon

encodes the genes for biosynthesis of alginate, except for algC which is located

separately, but is regulated by AlgR as well (44). Each of these regulators has a specific

binding site upstream of the alginate operon and loss of any one of the three leads to a

nonmucoid phenotype.

11

Figure 2

Mucoid Conversion Pathways

Figure 2. Mucoid Conversion Pathways. Left. A schematic of mutations in mucA that

lead to mucoidy. Right. Possible mutations and pathways not involving mucA mutation.

ATG TGA TGA

GGGG_

∆G (mucA22)

Var. -1bp, transversions,

ATG TGA

OR

∆mucA 80% Non-mucA20%

mucA

mucA

ATG TGA mucA

Unknown cause

Mutation ?∆kinB ? ~67%

of ∆mucA

MucA degradation

RpoN

alg operon activation

12

Figure 3

Figure 3. Typical pathway of alginate regulation. In a nonmucoid strain, MucA

sequesters AlgT and no alginate is produced. When MucA is mutated, AlgT is free and

activates expression of other alginate regulators AlgB, AmrZ, and AlgR. These three

regulators bind upstream of the alginate biosynthetic operon (algD is the first gene in this

operon), activating expression and, ultimately, overproduction of alginate.

MucA

MucB

AlgT

MucA MucB

∆mucA

AlgT

AlgB AlgR

AmrZ

Alginate operon algD

Alginate production

13

A recently characterized regulator of mucoidy, termed MucR, stimulates alginate

production by generating an intracellular messenger molecule bis-(3’-5’)-cyclic-dimeric-

GMP (c-di-GMP) (45). C-di-GMP binds to the membrane protein Alg44, and this

interaction is required for mucoidy. Alg44 is part of the alginate biosynthesis machinery

anchored to the cell membrane. Data suggests that MucR is located near Alg44 and

generates a local c-di-GMP pool, facilitating overproduction of alginate (45).

The mucA22 mutation is not the only mutation that can lead to mucoidy. The

muc-25 or mucA25 mutation was characterized by Qiu et al. as a ∆T180 mutation in

mucA (46). Mucoidy caused by this allele depends upon activity of ClpX and ClpP,

proteases that degrade the truncated MucA generated by the mutation at base 180.

Degradation of MucA by these proteases frees AlgT, allowing expression of the alginate

operon. Other mutations in mucA have been characterized from clinical strains in several

studies (47-49). The majority of these mutations cause premature stop codons and

potentially truncated MucA. Another protease, AlgW, has been shown to degrade MucA,

again leading to mucoidy. A study by Damron et al. shows that when KinB, a negative

regulator of alginate production, is mutated, AlgW degrades full-length MucA, liberating

AlgT and causing mucoidy (50). This study also showed that AlgB and RpoN are

necessary for the mucoid phenotype in kinB mutants. While no clinical mucoid strains

have been shown to be kinB mutants as of yet, this type of mucoid strain could account

for some of the ~20% of clinical mucoid strains that do not have mutations in mucA. A

2009 study indicated that cell wall stress can activate AlgW to cleave MucA, thus freeing

AlgT and causing mucoidy (51). Another allele that falls into the “non-mucA” category

of mucoid strains is termed muc23. These strains have wild type, functional mucA genes

14

but are stably mucoid (52). Boucher et al. demonstrate that AlgT is not required for

alginate production in these strains, but RpoN is necessary. They postulate that RpoN

and AlgT may vie for the same or overlapping binding sites upstream of algD (52). The

mutation present in muc23 strains has not been elucidated but could be located in a

response regulator that interacts with RpoN or in a locus involving a novel mechanism.

Psl. During the past decade, there has been a renewed interest in using P. aeruginosa as

a model system for biofilm development and pathogenesis. Most of these studies have

been performed with nonmucoid (i.e. mucA+) P. aeruginosa strains such as PAO1 or

PA14, which produce little to no detectable alginate in vitro. Furthermore, when the

alginate genes were disrupted in PAO1 and PA14, these strains were fully capable of

forming biofilms. The biofilm formed by these mutants retained what appeared to be

polysaccharide matrix material (53). This suggested that one or more polysaccharides

independent of alginate might be essential for biofilm development in nonmucoid P.

aeruginosa strains. Several groups initiated studies to identify alternative polysaccharide-

encoding genes, and two loci were discovered. The first, pel (Figure 4), was found to be

involved in pellicle formation in strain PA14 (54). The role of pel in the biofilm matrix

will be discussed below. The second polysaccharide locus designated psl (polysaccharide

synthesis locus, Figure 4) is an operon composed of 15 genes encoding the Psl

biosynthetic machinery.

15

Figure 4

Figure 4. Structure of psl and pel operons. Putative functions and localization of

Psl and Pel enzymes are shown (M: membrane; C: cytoplasm; S:secreted).

16

The psl operon was shown to be essential for biofilm formation in strains PAO1 and

ZK2870 (55-58). In these studies, inactivation of the psl gene cluster led to a significant

defect in cell–surface and cell–cell interactions. Psl is also required for adherence to

mucin-coated surfaces and airway epithelial cells; biotic surfaces that are clearly relevant

to CF (57). A study in 2006 utilizing an inducible psl construct found that in addition to

being required for cell–surface and cell–cell interactions, psl is also needed for

maintenance of the biofilm structure post attachment. This led the authors to conclude

that Psl functions as a scaffold, holding biofilm cells together in the matrix (57).

Carbohydrate and lectin staining analyses indicate that Psl is a mannose-rich and

galactose-rich polysaccharide, and the structure of the Psl subunits has recently been

elucidated (Figure 1)(56, 58-60). Campisano et al. (61) and Overhage et al. (62)

demonstrated that pslA and pslD, which encode a putative UDPglucose lipid carrier and

exporter, respectively, are essential for biofilm formation in strain PAO1. They also

demonstrated that while psl is constitutively expressed in planktonic cells, its expression

is localized at the center of developing biofilm microcolonies (62). This implies that Psl

has a role in biofilm differentiation. Our lectin staining studies show Psl is equally

distributed in undifferentiated, flat multiple-layer biofilms. However, mature

microcolonies reveal peripheral staining of Psl with minimal staining of matrix in the

center of the microcolonies. Instead, this region has numerous motile cells representing a

biofilm at a developmental stage just before dispersion (63).

Pel. P. aeruginosa is able to form biofilms not only on mucosal and other solid surfaces

but also at the air–liquid interface of standing cultures. The genetic basis for these

structures, known as pellicles, was elucidated by screening a PA14 transposon library for

17

pellicle-deficient mutants. This revealed a seven-gene operon, named pel (Figure 4),

which is necessary for maintenance of biofilm structure in strain PA14 (54). The authors

hypothesized that pel is involved in the production of an extracellular matrix material. To

determine the nature of this pel-associated matrix material, mutants lacking one or more

pel genes were evaluated for biofilm initiation, colony morphology, and mature biofilm

integrity. Although biofilm initiation per se was not significantly affected in PA14 pel

mutants, the colony morphology was affected as well as the ability of these cells to bind

Congo red (54). Carbohydrate and linkage analyses provide evidence that pel encodes a

glucose-rich matrix polysaccharide polymer, which does not appear to be cellulose (54,

56). At this time, the Pel structure is unknown and further biochemical analyses of Pel

polysaccharide are necessary.

In a similar study using a nonpiliated PAK strain, a transposon screen for

nonadherent mutants generated several mutations that mapped to the pel locus (64). The

authors suggested that any role for pel in attachment might not be observed because type

IV pili may compensate for a lack of pel during attachment (64). As predicted, biofilm

initiation was significantly reduced in nonpiliated PAK pel mutants. Clearly the roles of

pel and type IV pili in the initial attachment process need to be delineated.

Genes pelA–G (Figure 4) are highly conserved in other P. aeruginosa strains,

including the common laboratory strain PAO1 (54). The Gram-negative plant pathogen

Ralstonia solanacearum contains a homologous gene cluster that, when mutated, resulted

in a biofilm-defective phenotype similar to that observed in P. aeruginosa pel mutants

(64). Putative functions in polysaccharide processing have been assigned to most of the

pel genes (Figure 1 and (54, 56, 64, 65)).

18

Thus, the pel locus produces a glucose-rich matrix polysaccharide that is essential

for pellicle formation and biofilm structure in P. aeruginosa strains PA14 and PAK. The

pel-encoded polysaccharide is biochemically and genetically distinct from Psl. Currently,

immunological reagents are being generated to probe Pel expression or localization in

developing P. aeruginosa biofilms.

Regulation of Psl and Pel Polysaccharides. Currently, little is known regarding the

regulation of Psl and Pel but several seemingly disparate findings have begun to shed

some light on this issue. D’Argenio et al. performed transposon mutagenesis of strain

PAO1 and isolated a number of colonies that exhibited a ‘wrinkly’ colony phenotype

(66). Genetic analysis of these mutants revealed that mutations in the wspF gene lead to

the hyperaggregative phenotype. The wsp locus was first described in P. fluorescens and

appears to encode a chemosensory system involved in the wrinkly spreader phenotype

(67). Here, WspF controls the methylation state of WspA, which subsequently controls

the activation of the response regulator WspR. If wspF is inactivated, WspA is

hypermethylated and WspR is constitutively active.

In a later study, Kirisits et al. reported similar hyperaggregative and

hyperadherent PAO1-derived colony variants isolated from biofilm reactors (68).

Transcriptional profiling of these variants showed increased psl and pel expression, when

compared with the parental PAO1 strain. Disruption of the psl operon in the variant

reversed the hyperaggregative and hyperadherent phenotype but colonies still retained a

wrinkled phenotype, presumably because of Pel overexpression. Therefore, the authors

conclude that psl, in addition to pel and perhaps other components are expressed at a

higher level and are responsible for the hyperaggregative and hyperadherent variant

19

phenotype (68). Similar conclusions were drawn by Friedman and Kolter while analyzing

the autoaggregative P. aeruginosa variant ZK2870 (56). In support of this,

overexpression of Psl via a pBAD-derived promoter system is sufficient to convert P.

aeruginosa to a phenotype that resembles the above-mentioned autoaggregative variants

(57).

It is reasonable to assume that the wrinkled colonies in the aforementioned

D’Argenio study (66) also overexpress psl and pel and that this overexpression is caused

by activation of WspR. In fact, a later study by Hickman et al. showed an increase in psl

and pel expression in a wspF mutant (69). This study further evaluated the effect of the

Wsp system by investigating the role of WspR as a diguanylate cyclase. Proteins with

this activity generate cyclic di-GMP, which is involved in many cellular processes (70).

The levels of cellular cyclic di-GMP appear to correlate with the biofilm forming ability

of P. aeruginosa. When WspR was constitutively activated, as seen in a wspF mutant,

cyclic di-GMP levels were high and biofilm formation was greater than that in the wild-

type strain. As seen in the above-mentioned autoaggregative variants, a transcriptional

profile of wspF mutant bacteria revealed elevated levels of psl and pel transcription,

when compared with the parental strain. This study also elegantly illustrated that when

cyclic di-GMP was degraded, biofilm formation decreased substantially. This strengthens

the relationship between psl and pel expression, the Wsp chemosensory system, and

cellular levels of cyclic di-GMP.

Another regulatory system controlling psl and pel expression is the

GacS/GacA/rsmZ system. In a study of two-component systems in strain PAK, a

mutation in retS, encoding a hybrid sensor kinase/response regulator, elevated psl and pel

20

expression resulting in enhanced biofilm formation (71). A second round of transposon

mutagenesis in the retS strain revealed that mutations in the GacS/ GacA/rsmZ regulatory

pathway reversed the retS phenotype. GacS and GacA are a sensor-regulator two-

component pair and rsmZ is a small regulatory RNA that represses the activity of the

post-transcriptional RNA-binding protein RsmA. The model explaining how this system

functions is as follows (72): signals that activate RetS repress expression of rsmZ

whereas signals that activate GacS induce rsmZ expression. When rsmZ levels are high,

RsmA is inactive and this results in increased psl and pel expression. The opposite is true:

low levels of rsmZ favor repression of psl and pel (Figure 5). More recent work identified

LadS, encoding a hybrid sensor kinase, which also modulates rsmZ levels (73) and

therefore indirectly affects psl and pel expression.

21

Figure 5

Figure 5. Regulation of psl and pel by GacS/GacA/rsmZ pathway. Reproduced from

Goodman et. al (reference 71). During acute infection, RetS inhibits the GacS/A

pathway and biofilm factors such at psl and pel are downregulated, while secretion

systems and type IV pili are increased. During chronic infection, the GacS/GacA

pathway is activated, sequestering RsmA (a repressor of Psl) and activating psl and pel

expression.

22

Several recent studies have shed more light on psl regulation. Irie et al.

demonstrated that RsmA, which is under the regulation of the GacS/GacA/RetS pathway,

acts as a post-transcriptional repressor of Psl (74). This article also showed that psl

expression is activated by the stationary phase sigma factor RpoS. A study by Borlee et

al. discovered a c-di-GMP regulated adhesin (CdrA) that is important for biofilm

formation in PAO1 (75). Further study showed that CdrA acts as a surface anchor for

Psl; a cdrA mutant had decreased biofilm capacity and less Psl present on the surface.

Also, Psl interactions with CdrA could be out-competed with addition of mannose, a

component of the Psl subunit (75). This work is the first to show how Psl is attached to

the cell surface in biofilm cells. A 2008 study by Attila et al. discovered that a putative

membrane sensor PpyR causes increased psl expression as well as increases in other

biofilm-associated genes (76). Also, AlgT (also called AlgU) was shown to affect Psl

levels in PAO1. When AlgT was mutated in this strain, biofilm capacity decreased, in

correlation with decreased expression of psl, lecA, and lecB (77). These results are

consistent with work mentioned above. However, this study, of which this author is a

contributor (Figure 6), did not show direct interaction between AlgT and the psl promoter

region. PpyR was also shown to be decreased in the AlgT mutant, leading the authors to

predict that AlgT activates PpyR, which in turn activates psl expression leading to

biofilm formation (77). The details of this system require further study, but a broader

picture of psl regulation is beginning to emerge. While the regulation of psl and pel

seems linked, and pel expression is important, the current study is restricted to regulation

of psl and alginate.

23

Figure 6

Figure 6. Mutation of algU/T in PAO1 results in decreased expression and

production of Psl. Figure reproduced from Bazire et. al (reference 77, Figure 3 in

original text). A. Transcriptional levels of pslA and pslB are decreased in the PAO1

algU mutant compared to the PAO1 wild type. B and C. Psl production is decreased in

the PAO1 algU mutant PAOU and production can be restored by induction of the psl

promoter, as shown by ELISA (B.) and Psl immunoblot (C.).

24

Focus of Study. Since colonizing strains of Pseudomonas aeruginosa in CF are

nonmucoid, and Psl is required for binding to biotic surfaces in these strains, it is can be

assumed that Psl also plays a role in CF infections. The function, if any, of Psl in

modulating the host immune response to P. aeruginosa infection is unknown at this time.

However, further study of Psl is needed to determine its effects in CF and other

infections. Also, very little attention has been given to expression and regulation of Psl

in mucoid strains of P. aeruginosa, which are of particular importance in chronic

infections. Therefore, the following study endeavors to investigate the presence of Psl in

mucoid strains and the regulation of these two polysaccharides in mucoid isolates.

25

CHAPTER TWO

MATERIALS AND METHODS

26

Growth Conditions. Strains were grown at 37°C on LANS or PIA agar plates to

determine mucoidy. Strains were inoculated in LBNS at 37°C for overnight cultures

under shaking conditions unless otherwise noted.

Immunoblots and ELISAs. 5 OD600 of overnight culture were spun down and boiled in

0.5M EDTA. Proteinase K was added to the supernatant to a concentration of 0.5µg/ml,

then heated to 60°C for 1 hour and 80°C for 30 minutes to inactivate. These samples

were diluted 1:10 and spotted onto nitrocellulose for immunoblotting or diluted 1:100 and

allowed to attach to a 96-well ELISA plate. Immunoblots were allowed to dry and were

then blocked in 10% skim milk for 1 hour with shaking. The blot was then washed three

times for 5 minutes with shaking in TBS plus 0.05% Tween 20. Primary Psl-specific

rabbit antibody was added at 1:25,000 dilution for 1 hour with shaking. The blot was

again washed three times. The secondary antibody (donkey anti-rabbit) was added at a

1:10,000 dilution for 1 hour with shaking. After a last wash, the blot was treated

according to manufacturer’s instructions with SuperSignal West Dura Extended Duration

Substrate per manufacturer’s instructions (Pierce). Blots were then viewed using either

the Kodak Image Station 2000RT System and analyzed with Kodak Molecular Imaging

Software or the BioRad Chemidoc system.

ELISA plates were coated in triplicate with the 1:100 dilution of sample and a

standard curve from 50-0.05µg/ml of purified Psl overnight at 4°C. The plates were

blocked with PBS plus 10% NCS for one hour at room temperature. The plates were

washed 3-5 times with 200µl PBS plus 0.05% Tween 20 per well. Then the plates were

incubated at RT with Psl-specific rabbit antibody at 1:25,000 dilution for 1 hour. After

another 3-5 washes, the secondary antibody mentioned above was added at 1:10,000

27

concentration and allowed to incubate at RT for 1 hour. The plates were washed again

and 100µl of 3,3',5,5'-Tetramethylbenzidine, or TMB, were added to each well at RT for

30 minutes. Then 50µl of stop solution (2N H2SO4) was added to each well. The plates

were then read at 450nm with a Molecular Devices SpectraMax plate reader.

Construction of Inducible and Reporter Strains. Strains, recipient P. aeruginosa and

donor E. coli, were grown overnight in shaking culture. 10µl of recipient strain were

spotted onto dry LANS plates and allowed to dry. 15µl of SM10 E. coli were spotted on

top of dry recipient spot and allowed to dry. Plates were incubated O/N at 37 or 42°C.

For psl-inducible strains, spots were scraped and streaked for isolation onto LANS –

Gm100 – Irg25, then incubated O/N at 37°C. This step was repeated the next day. The

following day, isolated colonies were chosen and grown in O/N shaking culture. These

cultures were then plated onto LANS – 5% sucrose and incubated at 30°C for 1-2 days.

Isolated colonies were then patched onto LANS or LANS – Gm100 plates and incubated

O/N at 37°C. Gm100 sensitive colonies were plated onto LANS for isolation, grown in

O/N shaking cultures, and finally screened by PCR using specific primers. For mucA-

inducible strains, integration of the plasmid was not needed, therefore, after selection on

Cb300 plates, strains were able to be assayed. pslA-lacZ transcriptional reporter strains

were constructed as published by Irie et al (74).

Carbazole Assay. Alginate extraction adapted from (41, 78). Strains were grown

overnight and 500µl of culture was added to 500µl of 1M NaCl and vortexed well. The

mixture was then spun at maximum speed for 30 minutes to remove any alginate from the

surface of the cells. This supernatant was then treated with 500µl of 2-cetyl pyridinium

chloride and inverted to mix. The tubes were spun at maximum speed for 10 minutes to

28

pellet the alginate. The pellet was resuspended in 500µl cold isopropanol for 10 minutes.

The tubes were spun at maximum speed for 10 minutes and the pelleted alginate was

allowed to resuspend overnight in 500µl of 1M NaCl. This suspension was then used in

the carbazole assay adapted from (79). In short, 50µl of the samples or standard curve of

alginic acid were added in triplicate to a 96-well plate. Then 200µl of H2SO4- Borate

(0.1M H3BO3) solution was added to each well and the plate was incubated in a 100°C

oven for 10 minutes. After cooling, 50µl of 0.1% carbazole was added to each well and

the plate was incubated again in a 100°C oven for 10 minutes. After cooling to RT, the

plate was read at 550nm in a plate reader and compared to the standard curve to

determine the concentration of alginate for each sample.

Confocal Microscopy. Strains were grown to 0.5 OD600 and 500µl was added to a

chamber coverslip for each strain and allowed to attach overnight at 37°C. The next day,

the chambers were washed with 500µl PBS. Then 200µl of HHA-FITC lectin at a

100µg/ml concentration was added to each chamber and allowed to incubate at RT for 2

hours. Then the chambers are washed again and 200µl of 2µg/ml FM4-64 membrane

stain was added for 10 minutes and the excess was washed away. The chambers were

then visualized by CLSM using the FITC-Rhodamine Line Switch setting with LP650 for

Rhodamine.

β-galactosidase assays. Assay adapted from Maloy et al. (80). Strains containing a pslA-

lacZ transcriptional fusion were grown overnight for this assay. The cultures were then

diluted to 0.1-0.4 OD660 and 35µl was added to a microfuge tube in triplicate. Then 10µl

of chloroform and 5µl of 0.1%SDS were added to each tube and vortexed, then allowed

to incubate at RT for 5-10 minutes. Next, 200µl of ONPG was added to each tube,

29

inverted to mix, and allowed to sit at RT until yellow color appeared. 500µl of sodium

carbonate stop solution was added before OD420 exceeded 0.4. The samples were then

plated in triplicate in a 96-well plate and readings for 420nm and 550nm were taken

using a plate reader. These readings, along with the starting OD and time before stopping

the reaction, were used to determine the Miller Units for each sample.

Electrophoretic Mobility Shift Assays. Wild type and R22A binding deficient AmrZ

proteins were isolated as published by Waligora et al. DNA target labeling was

performed by PCR amplification of desired psl or algD promoter region utilizing 6-FAM

labeled forward primers and standard reverse primers, as listed in Table 2. DNA binding

and gel imaging were performed as previously published (81).

Crystal Violet Rapid Attachment Assay. Strains were grown to 0.5-0.7 OD600. 100µl

of each strain was added to a 96-well PVC microtiter plate (BD Falcon) in triplicate. The

bacteria were allowed to attach for 30 minutes at room temperature, then any unattached

bacteria were removed by washing with water. Next, 100µl of 0.1% crystal violet was

added to each well and allowed to incubate for 30 minutes at RT. The plate was washed

again with water, and 200µl of 95% ethanol was added to each well. After 30 minutes at

RT, 100µl were removed and placed into a flat bottom 96-well polystyrene plate. This

plate with solubilized crystal violet was then read in a standard plate reader for OD540.

mucA-inducible Strains. Upon successful uptake of the pHERD-mucA plasmid, strains

were streaked onto PIA or PIA-0.5% arabinose plates. Digital images were taken to

compare each strain with and without induction. Strains could then be scored mucA WT

or mucA mutated.

30

Generation of nonmucoid revertant strains. Clinical mucoid strains were streaked

from frozen samples onto LANS plates and allowed to grow overnight at 37°C. The

following day, the strain was passed from this plate onto a new LANS plate and

incubated overnight at 37°C. The strains were passed in this manner once a day until the

strain appeared nonmucoid on the plate.

31

CHAPTER THREE

INVERSE REGULATRION OF PSL AND ALGINATE POLYSACCHARIDES BY

AmrZ

32

As mentioned above, it has been shown that, in the case of CF, colonizing strains

of P. aeruginosa are nonmucoid and a majority of chronic strains are mucoid or mucoid

revertants (48). In the colonizing strains, alginate is not expressed and Psl may be the

polysaccharide involved in initial biofilm formation (53, 82). The presence of Psl in the

biofilm from initiation to late stages shows the importance of the polysaccharide to this

mode of growth. To date, however, few if any studies have been performed to determine

the effect of Psl in mucoid biofilms. Several questions arise when nonmucoid and

mucoid P. aeruginosa are considered: Can mucoid strains of P. aeruginosa produce Psl?

If they can, does Psl production persist once mucoid conversion occurs? If alginate

supports the biofilms of mucoid strains, is Psl still needed? To investigate answers to

these questions, this study investigates whether Psl is produced in mucoid strains and

how the expression of psl genes is regulated.

33

Table I

Strains and Plasmids Used in This Study

Strain Characteristics or Sequence Reference or

Source

P. aeruginosa

PAO1 Non-mucoid This laboratory

WFPA800 psl promoter deletion (57)

WFPA801 psl-araC-pBAD promoter replacement (57)

PDO300 mucA22 (83)

FRD1 mucA22 This laboratory

FRD3001

(psl-)

psl promoter deletion This laboratory

FRD3002

(pBAD-psl)

psl-araC-pBAD promoter replacement This laboratory

FRD440 mucA22 algT::Tn501 (84)

FRD810 (40)

FRD840 algB::aacC1 (85)

FRD875 algD::xylE (86)

FRD1200 amrZ::xylE (87)

FRD2239 amrZ R22A (87)

E. coli

34

Strain Characteristics or Sequence Reference or

Source

DH5α F′/endA1 hsdR17(rk

-mk+) glnV44 thi-1 recA1 gyrA (NalR)

relA1∆(lacIZYA-argF)U169

deoR(φ80dlac∆(lacZ)M15)

Gibco/BRL

SM10 Treated to be chemically competent This laboratory

Plasmids

pslA-lacZ transcriptional fusion (74)

pslA-lacZ translational fusion (74)

pHERDmucA Arabinose inducible mucA

35

Table II

Oligosaccharides Used in This Study

Oligos Sequence Reference

FAM pslprom1 AGGCGCATCCTGCCCAGCCA This study

FAM pslprom2 GGCGCCAGAAATACGTCAAT This study

FAM psl309 CCCAGACTACGGATATTTCC This study

psl380 GTGATAGCTGCTTACTTGGA This study

psl452 ACTGCGAAGTGGCGGAACGA This study

FU-902 CAGGAATTCACTACTTCCTCGGTTTCATC This study

R+3 (psl) CATGTTGTTTGCTCTGCCG This study

FAMalgD5 AAGGCGGAAATGCCATCTCC This study

algD7 AGGGAACTTCCGGCCGTTTG This laboratory

pslAF ATGCATTCGAAGTCGGTAGA This study

pslAR TCAGTAGACTTCCTTGGTCA This study

pslCF ATGCGCTGCGCCCTGGTCAT This study

pslCR TCACTTCCAGTAGCCTGGAA This study

pslEF CGCCATGATAGAAATTCGTTCCTT This study

pslER TCAGAACGCGCTCCGGTAGC This study

pslGF ATGGCACGAAGGGACTCTA This study

pslGR TCACTCCCAGACCAGCATCT This study

pslHF ACCCATGCGTATTCTCTGGATCCT This study

pslHR CTATGCGCATGCCGGCGCTC This study

36

Oligos Sequence Reference

mucA 1F GATCTTCCGCGCTCGTGA This study

mucA 1R CCTGAGTGGCGGGAACC This study

pslAR3 CGAGGCCCAGGCGAAGAACA This study

algD19 GCCATACGGCCACCTCATTA This laboratory

algD20 TGAAGTCGGTGGTGCCGACA This laboratory

rpoDF2 AGGCACGCACCATCCGCATC This study

rpoDR3 CTCGCTGGTCGCCATCTCGA This study

37

Presence of Psl genes in nonmucoid and mucoid strains. In order to determine

whether mucoid strains can produce Psl, we tested two parental lineages for the presence

of the psl genes and function of the psl operon. PAO1, a clinical nonmucoid isolate, and

FRD1, a clinical mucoid isolate were the two strains used in this study. Simple PCR

amplification of five of the eleven genes (Fig. 7A) in the psl operon illustrated that each

strain contained the genes within the operon. While not shown here, all eleven genes

were tested and found to be present. Next, we utilized the Psl antibody previously

described by Byrd et al. to perform immunoblots on psl-inducible strains generated in

each parental lineage (Fig. 7B)(60). In short, either the psl promoter was deleted from

the chromosome or an arabinose inducible promoter was substituted. When 2%

arabinose was added to the growth medium, Psl production was observed in both the

PAO1 and FRD1 strains. This shows that both parental strains used in this study are able

to produce Psl.

38

Figure 7

A. PAO1 FRD1

A C G H A C E G H

psl A B C D E F G H I J K L M N O

B. pBAD-psl PAO1 ∆psl

pBAD-psl FRD1 ∆psl

Figure 7. psl genes are present and functional in PAO1 and FRD1 backgrounds. A.

PCR analysis was performed on strains PAO1 and FRD1 using primer pairs pslAF and

pslAR through pslHF and pslHR listed in Table 2. B. psl deletion and inducible strains

were created in the PAO1 and FRD1 backgrounds. Strains were grown in LBNS and 2%

arabinose to induce psl expression. Extracts from the strains were used in Psl-specific

immunoblots.

39

Polysaccharide production in nonmucoid and mucoid pairs. As can also be seen in

Fig. 7, the nonmucoid strain, PAO1, makes more Psl than the mucoid strain, FRD1.

These two strains cannot be compared to each other, however, because they are

genetically different. In order to compare Psl expression between the two phenotypes,

mucoid and nonmucoid isogenic mates, respectively, were generated for these strains

(Table 3). PDO300 is identical to PAO1 except for a mutation in the mucA gene, causing

it to over-produce alginate. FRD440 and FRD1 are isogenic with only a mutation in algT

causing the former to cease producing alginate. By using the carbazole assay to detect

alginate levels, we determined that FRD1 and PDO300 were mucoid at the time of

polysaccharide extraction, (more than 100 µg/ml of alginate representing mucoidy), while

PAO1 and FRD440 were nonmucoid (Table 3). We next performed ELISAs using the

Psl-specific antibody to determine Psl concentration for the four strains and observed that

FRD1 and PDO300 produce approximately 3-fold less Psl than FRD440 and PAO1

(Table 3). These results are confirmed by immunoblotting, as seen in Fig.8A. This

difference can also be observed by lectin staining and CLSM, which utilizes a lectin that

binds to mannose linkages found in Psl (Fig. 8B and C). These data show that, while not

absent, Psl is produced at lower levels in mucoid strains when compared to their isogenic

nonmucoid counterparts, indicating repression of Psl production.

40

Table III

Alginate and Psl values of two mucoid/nonmucoid strain pairs

Strain Alginate (µg/ml) Psl (µg/ml)

PAO1 49 ± 24 46.8 ± 1.4

PDO300 (∆mucA) 107 ± 31 13.9 ± 0.4

FRD1 326 ± 10 19.5 ± 1.1

FRD440 (∆algT) 15 ± 0 71.4 ± 0.4

Table III. Alginate and Psl values of two mucoid/nonmucoid strain pairs.

Polysaccharide extracts were taken from two isogeneic pairs. Alginate extraction and Psl

extraction are described in Chapter 2. Alginate levels were determined by Carbazole

assay and Psl levels were obtained by Psl-specific ELISA. Numbers are averages of at

least three separate experiments.

41

Figure 8

A.

PAO1 PDO300 FRD1 FRD440

B.

PDO300 PAO1 Mucoid Nonmucoid

C.

FRD440 FRD1 Nonmucoid Mucoid

42

Figure 8. Psl expression is decreased in mucoid strains. A. Psl immunoblots of

two nonmucoid/mucoid paired strains. B. and C. Confocal microscopy shows

reduced Psl in mucoid strains. Strains allowed to attach to chamber coverslips were

stained with a Psl-specific lectin to show Psl surface expression. Red: bacterial

membrane, green: Psl, Yellow: overlap of membrane and Psl. B. PAO1 and PDO300,

C. FRD440 and FRD1.

43

Transcriptional repression of psl in mucoid strains. We next investigated at what

point polysaccharide synthesis is being repressed in mucoid strains. Beginning at the

transcriptional level, we employed pslA-lacZ transcriptional fusions first used by Irie et al

(74). In short, a miniCTX construct harboring the fusion was integrated at a neutral site

in the chromosome of each strain in Figure 9. These strains were then tested for β-

galactosidase activity. As shown in Figure 4, transcription was reduced by approximately

2-fold in PDO300 versus PAO1 and 3-fold in FRD1 versus the nonmucoid FRD1

revertant. This confirms previously published data and indicates that the regulation of Psl

in mucoid strains occurs at the transcriptional level (88). These data also imply directed

repression of psl in mucoid strains of P. aeruginosa.

44

Figure 9

0

50

100

150

200

250

300

350

400

PAO1 PDO300 FRD1 FRD1 nonmucoid FRD1 AmrZ R22A

psl p

rom

oter

act

ivity

(Mill

er U

nits

)

Figure 9. Transcription of psl genes is decreased in mucoid strains. Strains

containing pslA-lacZ transcriptional fusions were tested for β-galactosidase activity.

PAO1 and a nonmucoid revertant of FRD1 have higher activity (~2-fold) than

PDO300 and FRD1. A FRD1 strain with R22A substitution in AmrZ also has higher

transcription of pslA than the parental FRD1 strain.

45

AmrZ represses psl expression in mucoid strains. To determine what regulators were

involved in repression of psl, we first considered regulators already present at high levels

in mucoid strains: AlgT, AlgB, AlgR, and AmrZ. We utilized mutants of these regulators

in the FRD1 background to determine if psl expression was altered. Only the algT and

amrZ mutant strains showed an increase in Psl compared to FRD1 by Psl ELISA (Fig.

10). This suggests that AmrZ is the regulator of psl expression, since deletion of AlgT

would also result in loss of AmrZ. Psl production also increased in a strain containing an

R22A substitution in AmrZ (89). The R22 residue is required for DNA binding by

AmrZ, thus the increase in Psl in this mutant strain shows that DNA binding by AmrZ is

needed for repression of psl. Substitution of the R22 residue also caused an increase in

psl transcription, as seen in Fig. 9, supporting the requirement for DNA binding by AmrZ

in reduction of Psl. We also observed that the level of Psl does not increase when algD is

mutated, indicating that the reduction of Psl is not a result of interference of alginate in

the assays. Mutating algD does not affect the regulatory machinery of the cell, but

merely stops the cell from generating GDP-mannuronic acid, the last step in the

polysaccharide pathway toward alginate (39). Thus, alginate regulation is present and

functional in the algD mutant but no alginate is present on the surface of the cell.

Therefore, the decrease of Psl seen in mucoid strains is not caused by the presence of

alginate but is caused by repression of psl transcription.

46

Figure 10

0

10

20

30

40

50

60

70

FRD1 440 840 875 1200 810 FRD1 R22A

Psl c

once

ntra

tion

(ug/

ml)

amrZ R22A

∆algT ∆algB ∆algD ∆amrZ ∆algR FRD1

Figure 10. Deletion of algT and amrZ leads to an increase of Psl in FRD1. Psl

immunoblots and ELISAs were performed for FRD1 and strains with mutations in genes

important for alginate regulation in the FRD1 background. The mutant strains are

nonmucoid because the genes mutated are required for alginate production. The graph

represents µg/ml of Psl. ELISA and immunoblots performed on extracts from the same

day.

47

AmrZ binds to the psl promoter region. Once we had established that AmrZ is the

regulator involved in psl repression, we wanted to determine whether AmrZ acts directly

or indirectly on psl transcription. In order to test this, we employed electrophoretic

mobility shift assays, EMSAs, as shown in Fig. 11. As previously published, we

observed that AmrZ binds specifically to the algD promoter region and that this binding

requires the R22 residue (Fig. 11A) (90). Similarly, AmrZ specifically binds to the psl

promoter region (Fig. 11A). This reveals that AmrZ directly interacts with psl to cause

its repression in mucoid strains.

To further define the binding site of AmrZ at the psl promoter, increasingly

smaller DNA fragments were incubated with AmrZ and DNA-protein interactions were

seen with fragments as small as 110bp (Fig. 11B). Each of these fragments includes the

transcriptional start site previously described by Irie et al (74). However, the 50bp

fragment that did not overlap with the start site showed no binding by AmrZ. This

indicates that the AmrZ binding site is likely overlapping with the transcriptional start

site.

These data show that Psl production in mucoid strains of P. aeruginosa is

repressed at the transcriptional level by AmrZ binding at the psl promoter region.

However, this study only involves two lineages. In Chapter 4, we investigate Psl

production in a number of clinical mucoid strains to determine if mucoid strains at large

also produce decreased levels of Psl.

48

Figure 11

algD

psl

WT AmrZ AmrZ R22A A.

1 2 4 3 6 5 7 8

B.

400bp 200bp

150bp

110bp

1 3 4 6 5 7 8 2

-35 +1 -10

50bp

9 10

pslA

ATG

49

Figure 11. AmrZ binds to the psl promoter region. Increasing amounts of purified

AmrZ and AmrZ R22A were incubated with fluorescently labeled fragments of DNA

overlapping the algD or psl promoter region. A. Top. AmrZ binding to a 400bp fragment

of the algD promoter region. Bottom. AmrZ binding to a 400bp fragment of the psl

promoter region. Lanes: 1. Free DNA, 2. 4.0nM WT AmrZ, 3. 2.8nM WT AmrZ, 4.

1.1nM WT AmrZ, 5. 0.6nM WT AmrZ, 6. 0.3nM WT AmrZ, 7. 4.0nM AmrZ R22A, 8.

0.3nM AmrZ R22A. B. AmrZ binding fragments containing the psl promoter from

400bp to 110bp. Odd numbered lanes contain free DNA of the fragment size noted.

Even numbered lanes contain DNA of the size indicated and 4.0nM of WT AmrZ protein.

50

CHAPTER FOUR

ANALYSIS OF PSL PRODUCTION IN CLINICAL STRAINS OF P. AERUGINOSA

51

Characterization of Strains. In order to investigate the breadth of Psl production in

clinical strains of P. aeruginosa, a cohort of isolates was obtained from various

geographical locations and environments. The strains collected for this study total 143:

22 from Wake Forest University Medical Center (WFU), 43 from the University of

Copenhagen in Denmark (UC Denmark), 20 from the University of North Carolina at

Chapel Hill (UNC) (10), 10 from the University of Washington in Seattle (UW), and 48

from Nationwide Childrens Hospital in Columbus, OH (NCH). As noted in Appendix A,

the strains used here were obtained from diverse environments and infections: water,

plant, blood, wound, cornea, urine, respiratory secretions, and cystic fibrosis lung

infections. Of the 143 strains, 71 were nonmucoid and 72 were mucoid. The details for

each strain, as well as the raw data can be found in the Appendices.

Nonmucoid strains and Psl production. Each nonmucoid strain was grown overnight

in liquid culture and surface polysaccharide was extracted. These extracts were then

utilized in Psl-specific ELISAs to determine Psl production. Figure 12 shows the Psl

levels of the nonmucoid clinical and environmental strains tested compared to the Psl

level of PAO1. PAO1 is a well-documented nonmucoid clinical strain that was also used

in Chapter 3. Because little is known about the strains collected for this study, we chose

to compare them to a more extensively studied strain in order to give context to the

results obtained. Comparing nonmucoid strains to PAO1 shows that Psl levels vary

between strains (Fig. 12). We had hypothesized that nonmucoid P. aeruginosa strains

produce high levels of Psl similar to those of PAO1. However, some strains produce

little or no Psl while others produce up to twice as much Psl as PAO1 (Fig. 12).

Interestingly, the majority of the Copenhagen strains produced Psl levels lower than or

52

similar to PAO1, whereas Psl levels in strains from the other geographic regions were

more widespread (Fig 12).

53

Figure 12

54

Figure 12. Psl values of nonmucoid clinical strains compared to Psl value of PAO1.

All clinical nonmucoid strains examined were compared to a well-defined nonmucoid

clinical strain PAO1. An overall level of variability of Psl expression can be observed,

ranging 2-fold more or less than that of PAO1. All raw values can be found in Appendix

A.

55

Nonmucoid strains and Attachment. As mentioned above, Psl has been shown to be

important for attachment to surfaces and for cell-cell interactions, both needed for biofilm

formation, in PAO1 as well as other nonmucoid strains of P. aeruginosa (55-58). Figure

12 shows that not all nonmucoid strains produce high levels of Psl, when compared to Psl

levels produced by PAO1, therefore, we hypothesized that those strains producing little to

no Psl would have lower attachment than those strains producing higher levels of Psl. To

test this hypothesis, the strains listed in Figure 13 were used in the crystal violet rapid

attachment assay described in Chapter 2. PAO1 was included as a reference strain. All

three parts of Figure 13 show that the level of Psl does not always correlate with the level

of attachment, as only the strains from Copenhagen show correlation. However, it should

be noted that the assay performed only measures attachment after 30 minutes of static

incubation. It is possible that longer incubation or another surface material would yield

different results. When the strains were separated by geography, a slight trend could be

seen. The top portion of Figure 13 reveals that strains obtained from WFU were more

variable in their attachment abilities than strains from UNC or Copenhagen. Also, a

percentage of the WFU strains had little to no Psl production (6 of 12), but 4 of the 6 had

mid to high levels of attachment (Fig. 13 Top). This suggests that these strains utilize

other surface components to achieve attachment. The strains from UNC and Copenhagen

all have lower attachment levels than PAO1 (Psl = 5.75 µg/ml, OD540nm = 0.376), even

though some of them have similar or higher levels of Psl (Fig.13 Middle or Bottom).

These data illustrate that Psl levels alone cannot determine attachment capability for a

strain. Again, some other surface component or components, such as Pel polysaccharide,

must influence attachment in nonmucoid clinical and environmental isolates. As

56

mentioned in Chapter 1, Pel is important for cell-cell interactions and pellicle formation

in nonmucoid strains such at PA14, which does not produce Psl. Perhaps Pel is the

polysaccharide that facilitates attachment in nonmucoid clinical strains producing little or

no Psl. Other surface components, such as LecA and LecB, LPS, and Cup fimbriae

should also be investigated in these strains to determine their contribution to the

attachment levels observed.

57

Figure 13

58

Figure 13. Psl and attachment values of nonmucoid clinical strains divided by

geography. Strains were assayed for Psl amounts and rapid attachment ability,

represented by OD540nm. Geographical groups were plotted to determine correlation

between the two variables: Top Winston-Salem (WFU), correlation coefficient = 0.20, p-

value = 0.529; Middle Copenhagen (UC), correlation coefficient = 0.54, p-value =

0.0097; Bottom University of North Carolina Chapel Hill (UNC), correlation coefficient

= 0.01, p-value = 0.975. Each set of strains is compared to PAO1, a well-defined

nonmucoid clinical isolate. Statistics per Pearson’s product-moment correlation.

59

Mucoid strains and Psl production. As with the nonmucoid strains, the 72 mucoid

strains were assessed for Psl production. In addition, all mucoid strains were reported to

be mucoid from the source noted and were confirmed by visualization of growth on agar

plates. Figure 14 shows the Psl values of the mucoid strains when compared to FRD1, a

strain well studied in the field. As mentioned above, little is known about these strains;

therefore, FRD1 was used as a reference. FRD1 is known to produce very little Psl

(Table III, Fig. 8), and we hypothesized that other mucoid strains would produce

similarly low levels. However, Figure 14 shows that much more variation exists

between mucoid strains than anticipated. Several strains had Psl levels above the

threshold of 1 set in Figure 14, while many others did in fact have levels of Psl similar to

FRD1, between 0 and 1 (Fig. 14). Figure 14 also examines Psl levels in mucoid strains

when separated by geography. Each region except Washington and Winston-Salem (UW

and WFU) had strains with Psl levels ≥5 times that of FRD1. However, there were

strains from each geographical location that produced little or no Psl. Again, we see

much diversity in Psl production in strains from the clinical setting. We presume that the

strains with lower Psl production follow the same regulation as that found in FRD1, but

more study is needed to understand the regulation of Psl and alginate in strains where

both are produced.

60

Figure 14

CH

OH I O

W

W-S

DEN

61

Figure 14. Psl values of clinical mucoid strains compared to Psl value of FRD1. All

mucoid strains examined were compared to a well-characterized mucoid strain, FRD1.

The dashed line represents the amount of Psl produced by FRD1 set to 1. A wide range

of Psl expression can be observed in the mucoid strain population, up to ~18-fold higher

than that of FRD1. Strains were separated by geographical location as follows: CH =

UNC Chapel Hill, OHIO = NCH from Nationwide Children’s Hospital, W-S = WFU

from Winston-Salem, NC, and DEN = UC from University of Copenhagen, Denmark.

All raw data can be found in Appendix A.

62

Comparison of Psl and alginate levels in clinical mucoid strains. Some of the mucoid

strains were assessed further for alginate levels by using the carbazole assay explained in

Chapter 2. This assay gives the amount of alginate expressed in µg/ml, as does the Psl

ELISA. We hypothesized that strains producing less alginate would produce more Psl,

which would support an inverse relationship between Psl and alginate and might offer

some insight into the above stated inconsistency. In Figure 15, a general trend toward

decreasing Psl and increasing alginate can be seen, which supports the hypothesis stated

above (Corr. Coef. = -0.37, p-value = 0.24). While a trend toward lower alginate and

higher Psl was observed, variation in Psl amount is still seen in mucoid strains. Also,

strains said to have lower alginate are still considered mucoid, and Psl levels in this group

as well as the nonmucoid group are subjective. There is no standard ranking of Psl levels

in the field; one can only compare strains within groupings and phenotypes.

63

Figure 15

Figure 15. Comparison of Psl levels to alginate levels in clinical mucoid strains. Psl

and alginate levels of mucoid strains were plotted to determine correlation. Based upon

Pearson’s product-moment correlation test, a trend of decreasing Psl levels and increasing

alginate levels can be observed (correlation coefficient = -0.37, p-value = 0.24).

64

Psl production in parental and revertant strains. As detailed in Chapter 1, nonmucoid

strains are considered to be the infecting and colonizing strains for CF lung infections by

P. aeruginosa. After time and selective pressure, some of these strains undergo mucoid

conversion and overproduce alginate (13, 47). We hypothesize that, in general, Psl levels

present in the nonmucoid colonizing strain decrease when mucoid conversion occurs,

similar to that seen when comparing strains PAO1 and PDO300 (Table III and Fig. 8).

However, we do not have the nonmucoid parental strain for any of the mucoid isolates

tested here, including FRD1. When studying FRD1, we utilized an algT mutant which

caused loss of alginate production, yet this strain may be different than the parental strain

for FRD1. In the absence of nonmucoid parental strains, we generated nonmucoid

revertants (as described in Chapter 2) in several of the mucoid strains in order to compare

Psl levels with and without alginate production (Fig. 16). While some strains show

increased Psl upon reversion, more than half have reduced Psl or no increase at all.

While reversion of NCH strains 7, 8, 9, 14, 15, and 17 did not demonstrate a high net

change, the actual Psl levels for parental mucoid and revertant isolates were high. Other

strains, such as WFU20 and UC39 had low levels of Psl for both strains. Even so, a

correlation was observed when the data were plotted on an XY plot (Fig. 16). Psl levels

tend to increase in revertant strains compared to the original level of production in the

parental mucoid strain (Corr. Coef. = 0.70, p-value = 0.002). These results imply that the

mutation which caused loss of mucoidy somewhat affected the regulation of Psl in these

strains.

65

Figure 16

Figure 16. Psl levels of parental mucoid and revertant nonmucoid strains. Sixteen

mucoid strains were allowed to revert to a nonmucoid phenotype and were then assayed

for Psl production alongside their parental mucoid counterparts. FRD1 and FRD440 (a

nonmucoid strain of FRD1) were included for comparison. A correlation was determined

between the original Psl amount of the mucoid strain and the Psl value of the nonmucoid

revertant strain. Correlation coefficient = 0.70, p-value = 0.002, per Pearson’s product-

moment correlation test. Raw data can be found in Appendix B.

66

Psl production in mucA complemented strains. One hypothesis to explain high Psl

levels in some mucoid strains is that different pathways of mucoid conversion lead to

different pathways for Psl regulation. Most clinical mucoid strains of P. aeruginosa have

a mutation in mucA causing overproduction of alginate (36). Yet a percentage of mucoid

strains have no mucA mutation (52). To address this hypothesis, we constructed mucoid

strains containing a plasmid carrying an arabinose-inducible mucA. If a strain had a

mutated mucA, complementing with the mucA from the plasmid would cause the strain to

be nonmucoid. If the strain had a wild type mucA, the complementation would have no

effect on the mucoid status. We grew the strains on agar plates with and without the

presence of 0.5% arabinose and then photographed the plates for analysis; Fig 17A shows

an example of a mucA mutant strain and a mucoid strain with a wild type mucA.

Photographs for all of the complemented strains can be found in Appendix C. We then

extracted surface polysaccharide from both the induced and uninduced strains and

compared the values (Fig. 17B). The results were not consistent with our hypothesis.

The majority (58%) of the mucA mutant strains did show some increase in Psl with

complementation, but not all. Also, 50% of the WTmucA strains showed an increase in

Psl upon complementation for reasons as yet unclear. These data, as well as those above,

illustrate that Psl regulation in mucoid strains is more complicated than predicted by the

results of Chapter 3.

67

Figure 17

A.

UNC18 UC18

- ara +ara - ara + ara

WT mucA ∆mucA B.

0

20

40

60

80

100

UC33 UC18 WFU17 WFU22 WFU20 UNC18 UC39 UC34 UNC16 UW8 UW10 UNC17

Psl (

ug/m

l)

Parental

mucA complementation

mucA status ∆ ∆ ∆ ∆ ∆ WT WT WT ∆ ∆ ∆ WT

68

Figure 17. Complementation of mucoid strains with mucA. A plasmid-borne

inducible mucA was expressed in mucoid strains in order to determine if mutation of

mucA was the cause of mucoidy. A. Examples of ∆mucA and WTmucA results on agar

plates. The complementing mucA allele is induced by addition of 0.5% arabinose to the

growth medium. Strains are then compared with and without induction. A strain that

becomes nonmucoid (matte appearance) upon mucA induction is termed ∆mucA, while a

strain that remains mucoid (viscous appearance) under both conditions is termed

WTmucA. B. Comparison of Psl production in mucoid strains without and with mucA

complementation. Beneath each strain the mucA status, as determined by the

visualization of the plate assay seen in A., is indicated: ∆ = ∆mucA, WT = WTmucA.

The raw data for this figure can be found in Appendix C.

69

CHAPTER FIVE

DISCUSSION

70

Biofilm formation is a critical component of Pseudomonas aeruginosa infections,

and polysaccharides provide much of the attachment and structure for these communities.

In this study, we examined the inverse relationship between alginate and Psl expression

in mucoid strains of P. aeruginosa. The relevance of inverse production could be

explained in several ways. First, the functions of Psl and alginate could be seen as

overlapping. Both form a scaffold for the biofilm and both promote maintenance of P.

aeruginosa biofilms (57, 82, 91). Second, Psl and alginate both contain mannose.

Decreasing the amount of Psl could free up mannose precursors for alginate production.

However, the two polysaccharides do not appear to be interchangeable. Strains

producing Psl are better able to achieve initial attachment, while the ability of alginate to

protect against host defenses is well documented (13). It could be that Psl is needed in

early colonizing stages to allow the bacterium to quickly and efficiently attach to the

mucus layer of the CF lung or other surface and that alginate is needed at later stages in

order to counter and withstand the immune response of the host. The results shown here

could indicate a finely tuned regulatory circuit for biofilm polysaccharides. Psl is

produced at a basal level until mucoid conversion occurs due to a particular stress. The

uniformity of mucoid conversion in chronic infections implies a specific need for alginate

at a given stage in chronic infection. Overproduction of alginate is an energy expensive

process and rather than compete with Psl for precursor, AmrZ represses the expression of

the psl operon at the transcriptional level, thus leaving the majority of the precursor for

alginate production (Figure 18). This scenario efficiently switches the cell from Psl

production to alginate production by using a bi-functional protein to activate one

71

polysaccharide (alginate) while repressing a competing one (Psl). In this way, the

bacterium is able to adjust to the changeable environment of the CF lung and to survive.

72

Figure 18

AlgT

AlgB AlgR

AmrZ

Alginate operon algD Alginate production

Figure 18. Model of inverse regulation of Psl and alginate in mucoid strains. AmrZ

binds upstream of algD and causes activation of alginate (with AlgB and AlgR). AmrZ

also binds upstream of psl causing repression of psl expression.

psl operon Psl production

73

While this explanation is supported by the above data, it does not incorporate

previously published data involving c-di-GMP and polysaccharide expression. C-di-

GMP has been shown to affect levels of both Psl and alginate. In the case of alginate

production, binding of c-di-GMP to Alg44 (important for extrusion of alginate onto the

cell surface) is required for alginate synthesis and the regulator MucR synthesizes c-di-

GMP, creating a pool of c-di-GMP near Alg44 in the membrane (92, 45). Another

regulator that effects psl expression, WspR, generates c-di-GMP and has discrete

localization in the cytoplasm when active, however, it is unknown if WspR directly

interacts with Psl synthetic machinery (93). More research is on-going to determine

where Psl synthesis occurs and in what ways c-di-GMP directly affects Psl production. It

is possible that c-di-GMP is shared by the Psl and alginate and that sharing of this

molecule might lead to the need for the transcriptional regulation described here.

However, given the above research in the field, this seems less likely, as MucR provides

c-di-GMP at the site of alginate synthesis and therefore another enzyme possibly does the

same for the Psl biosynthetic machinery. Yet the locations of alginate and Psl on the cell

surface have not been shown to be separate at this time, and the biosynthetic machinery

of these polysaccharides could be similarly located. Work by Ma et al. shows that Psl

can be found in helical patterns on the surface of P. aeruginosa, but the placement of

alginate has not been seen as clearly (91). With the current knowledge, the reason for the

above described regulation can only be supposed.

As described in Chapter 1, a recent study by Bazire et. al, to which this author is a

contributor, reports a relationship between the alginate regulator AlgT (AlgU) and Psl

that is separate from that described here (77). While the data from these two studies are

74

not contradictory, it is not yet clear how or why AlgT positively affects an activator of

Psl in nonmucoid strains (PpyR) and activates a negative regulator of Psl in mucoid

strains (AmrZ). This paper serves as yet another example of the complexity of

polysaccharide regulation in nonmucoid and mucoid P. aeruginosa.

Other bacterial systems also employ inverse and/or coordinate regulation of

virulence factors. Type 1 fimbriae and P fimbriae are inversely regulated in E. coli strain

CFT073 (94). Only one fimbrial type is typically expressed at one time in E. coli and the

type 1 fimbriae are usually produced in strain CFT073. In a locked-on mutant, as well as

the WT, P fimbriae are repressed. However, in a locked-off mutant, P fimbriae are

expressed (94). This scenario could be compared to the mucoid phenotype of FRD1

where alginate is constitutively expressed and Psl is downregulated. In the case of the

anaerobic oral bacterium Porphyromonas gingivalis, the transcription factor OxyR

directly interacts with the promoter regions of sod (superoxide dismutase) and fimA, a

fimbrial subunit gene. OxyR is a redox-sensing transcription factor and it activates sod

and represses fimA under oxidative stress conditions (95). FimA is a subunit of major

fimbriae, important for initial attachment to surfaces, and SOD is involved degradation of

superoxide when P. gingivalis encounters oxygen stress. Presumably, the energy used to

express FimA is needed to produce SOD under oxidative stress, similar to our hypothesis

that repression of Psl in mucoid strains could involve energy conservation (95).

Based upon the inverse expression data obtained from PAO1, PDO300, FRD1

and FRD440, we hypothesized that examination of clinical nonmucoid and mucoid

strains of P. aeruginosa would demonstrate higher Psl in nonmucoid strains and lower

Psl in mucoid strains. However, this was not the case. As other studies of clinical

75

isolates have shown, much diversity can be seen between bacteria of the same species in

the same disease (8, 9, 14). While the clinical data presented in Chapter 4 do not

disprove repression of Psl in some mucoid strains of P. aeruginosa, they do illustrate the

complexity of polysaccharide regulation.

We concluded that AmrZ represses psl expression in strain FRD1, a mucA22

mutant. With this in mind, we amended the previous hypothesis to say that mucA mutant

mucoid strains would produce levels similar to that of FRD1. Several of the strains

determined to be mucA mutants by complementation did indeed have lower Psl levels,

but not all followed this hypothesis. Conversely, not all mucoid strains containing WT

mucA had high levels of Psl. What is unclear and unknown at this time is what the AmrZ

levels are for these clinical strains. Overexpression of the alginate regulatory and

biosynthesis genes are needed for mucoidy, but the term “overexpression” is not

quantitative. Perhaps a certain level of AmrZ is necessary to both activate the alginate

operon and to repress the psl operon. Alternatively, another level of regulation involving

AmrZ activity at psl might be required for the inverse expression of psl and alginate. It

should also be considered that most chronic infection isolates have many mutations, not

merely those that lead to mucoidy. AmrZ alone has activity in several pathways needed

for both acute and chronic growth and mutations affecting any of these pathways might

influence AmrZ (43, 89, 90). Therefore, experiments investigating the amount of AmrZ

in clinical mucoid strains may help to clarify the data presented here.

We also observed some trends in Psl expression based upon geography.

Variation was still observed within a geographical group, with strains from Copenhagen

being the only set with a correlation between Psl production and attachment. Without the

76

entire set of information about the patients infected by these strains, we can only infer

some reasons for the geographical differences seen. First, environmental strains of P.

aeruginosa, which are the parental strains for the clinical isolates, from each region may

have differing Psl levels and attachment abilities. Few, if any, studies have been done to

compare environmental isolates from a given region to isolates from infections. Studies

of this sort could offer information about initial Psl expression and later changes in

production once infection has occurred that could be important for treatment of P.

aeruginosa infections. Second, treatment regimens for patients in different facilities may

induce or decrease these factors. Some clinics and hospitals treat with antibiotics

consistently after initial lung infection while others only use antibiotics at the occurrence

of an exacerbation (96). The selective pressure of exposure to these chemicals may affect

the expression of factors important to biofilm production. Third, it may be necessary to

consider each patient as a separate environment. Each patient becomes infected under

different circumstances and, as seen in the CF lung, multiple species of bacteria are found

in the same area. Even multiple strains of P. aeruginosa can be isolated from a single CF

patient (18). The unique environment of each patient could lead to differential expression

of Psl or other factors that mediate attachment.

A study of capsule polysaccharides of bovine isolates of Staphylococcus aureus

by Tollersrud et al. also shows variation in clinical sample phenotypes (97). Bovine

mastitis isolates from Iceland, Ireland, Sweden, Finland, Denmark, and the United States

were tested for antibody binding to two capsular polysaccharides, type 5 and type 8. This

analysis revealed that capsules 5 and 8 are present in different percentages in each

geographical region. In addition to the two well-studied capsule types, a percentage of

77

strains from each region had nontypeable capsules. When strains from the US were

evaluated by state, differences in percentage of capsule production (type 5, type 8, and

nontypeable) was observed (97). These results are similar in nature to the production of

Psl and alginate seen in clinical samples of P. aeruginosa in the current study; we

observed variation in polysaccharide expression from region to region as well.

It should also be considered that PAO1 and FRD1, while originally obtained from

the clinical setting, have been passed many times. A convincing article by Fux et al.

illustrates that laboratory strains of bacteria do not represent the species as a whole. They

show that genetic divergence, particularly in virulence factors, can occur after a strain is

grown in idealized laboratory conditions. This is true for E. coli strain K12, P.

aeruginosa, and Staphylococcus aureus strain COL. Biofilm formation in specific

decreases in many laboratory reference strains when compared to clinical isolates. The

selective pressures of the clinical environment are typically lacking in in vitro studies,

leading to downregulation or complete loss of factors necessary for growth in the host

(98). The authors also emphasize that no one clinical isolate can be accurately used to

represent the entire species and that a supragenome of several isolates would be the best

representation of a species. When considered in light of this article, the variability of our

data is not surprising. While not condemning the study of laboratory strains, Fux et al.

encourage the study of clinical isolates to aid in a “world view” of a given species (98).

Our study achieves this, in a way, by applying results from reference strains to a larger

sampling of clinical and environmental isolates. This approach provides data that support

the previous result as well as paving the way for investigation of different pathways.

78

In conclusion, P. aeruginosa infection in the CF lung is a complex scenario.

Many factors affect the progression of disease and thus potentially affect the regulation of

virulence factors and the lifestyle of the organism. Here we have shown that

polysaccharide expression in P. aeruginosa is carefully and complexly regulated. While

Psl and alginate have some similar functions, they are expressed under differing

conditions, implying that each offers a specific advantage. More study is required to

completely understand the conditions and advantages necessary to lead to expression of

one polysaccharide over the other. Our work also illustrates the need for more

investigation into this regulation and the diversity of biofilm factors in general. This

further study will yield important information for treating P. aeruginosa biofilm

infections at large and Cystic Fibrosis infections in general.

79

REFERENCES

1. Nakazawa, T., Furukawa, K., Haas, D., and Silver, S., eds. 1996. Molecular

Biology of Pseudomonads. ASM Press, Washington, D.C.

2. Desai, J. D. and I. M. Banat. 1997. Microbial production of surfactants and their commercial potential. Microbiol.Rev. 61:47-64.

3. Mahajan-Miklos, S., L. Rahme, and F. Ausubel. 2000. Elucidating the molecular mechanisms of bacterial virulence using non-mammalian hosts. Mol Microbiol. 37:981-988.

4. Sadikot, R. T., T. S. Blackwell, J. W. Christman, and A. S. Prince. 2005. Pathogen-Host Interactions in Pseudomonas aeruginosa Pneumonia. Am. J. Respir. Crit. Care Med. 171:1209-1223.

5. Van Delden, C. and B. H. Iglewski. 1998. Cell-to-Cell Signaling and Pseudomonas aeruginosa Infections. Emerg Infect Dis. 4:551-560.

6. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial Biofilms: A Common Cause of Persistent Infections. Science 284:1318-1322.

7. Abdi-Ali, A., Mohammadi-Mehr, M., and Alaei, Y. Agha. Bactericidal activity of various antibiotics against biofilm-producing Pseudomonas aeruginosa. Int J Antimicrob Agents. 27[3], 196-200. 3-1-2006.

8. Burns, J. L., R. L. Gibson, S. McNamara, D. Yim, J. Emerson, M. Rosenfeld,

P. Hiatt, K. McCoy, R. Castile, A. L. Smith, and B. W. Ramsey. 2001. Longitudinal Assessment of Pseudomonas aeruginosa in Young Children with Cystic Fibrosis. J Infect Dis. 183:444-452.

9. Smith, E. E., D. G. Buckley, Z. Wu, C. Saenphimmachak, L. R. Hoffman, D. A. D'Argenio, S. I. Miller, B. W. Ramsey, D. P. Speert, S. M. Moskowitz, J. L. Burns, R. Kaul, and M. V. Olson. 2006. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc Natl Acad Sci U S A. 103:8487-8492.

10. Wolfgang, M. C., B. R. Kulasekara, X. Liang, D. Boyd, K. Wu, Q. Yang, C. G. Miyada, and S. Lory. 2003. Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A. 100:8484-8489.

11. Martinez-Solano, L., M. D. Macia, A. Fajardo, A. Oliver, and J. L. Martinez. 2008. Chronic Pseudomonas aeruginosa Infection in Chronic Obstructive Pulmonary Disease. Clin Infect Dis. 47:1526-1533.

80

12. Murphy, T. F., A. L. Brauer, K. Eschberger, P. Lobbins, L. Grove, X. Cai, and S. Sethi. 2008. Pseudomonas aeruginosa in Chronic Obstructive Pulmonary Disease. Am.J.Respir.Crit.Care Med. 177:853-860.

13. Deretic, V., M. J. Schurr, and H. Yu. 1995. Pseudomonas aeruginosa, mucoidy and the chronic infection phenotype in cystic fibrosis. Trends Microbiol. 3:351-356.

14. Mena, A., E. E. Smith, J. L. Burns, D. P. Speert, S. M. Moskowitz, J. L. Perez, and A. Oliver. 2008. Genetic Adaptation of Pseudomonas aeruginosa to the Airways of Cystic Fibrosis Patients Is Catalyzed by Hypermutation. J.Bacteriol. 190:7910-7917.

15. Waine, D. J., D. Honeybourne, E. G. Smith, J. L. Whitehouse, and C. G. Dowson. 2008. Association between Hypermutator Phenotype, Clinical Variables, Mucoid Phenotype, and Antimicrobial Resistance in Pseudomonas aeruginosa. J.Clin.Microbiol. 46:3491-3493.

16. Boucher, R. C. 2004. New concepts of the pathogenesis of cystic fibrosis lung disease. Eur Respir J 23:146-158.

17. Geller, D. and B. Rubin. 2009. Respiratory care and cystic fibrosis. Respir Care. 54:796-800.

18. Goss, C. H. and J. L. Burns. 2007. Exacerbations in cystic fibrosis -+ 1: Epidemiology and pathogenesis. Thorax 62:360-367.

19. Hassett, D. J., M. D. Sutton, M. J. Schurr, A. B. Herr, C. C. Caldwell, and J. O. Matu. 2009. Pseudomonas aeruginosa hypoxic or anaerobic biofilm infections within cystic fibrosis airways. Trends Microbiol. 17:130-138.

20. Lyczak, J. B., C. L. Cannon, and G. B. Pier. 2002. Lung Infections Associated with Cystic Fibrosis. Clin. Microbiol. Rev. 15:194-222.

21. Hentzer, M., G. M. Teitzel, G. J. Balzer, A. Heydorn, S. Molin, M. Givskov, and M. R. Parsek. 2001. Alginate Overproduction Affects Pseudomonas aeruginosa Biofilm Structure and Function. J.Bacteriol. 183:5395-5401.

22. Govan, J. R. and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol.Rev. 60:539-574.

23. Whitchurch, C. B., T. Tolker-Nielsen, P. C. Ragas, and J. S. Mattick. 2002. Extracellular DNA Required for Bacterial Biofilm Formation. Science 295:1487.

24. Allesen-Holm, M., K. B. Barken, L. Yang, M. Klausen, J. Webb, S. Kjelleberg, S. Molin, M. Givskov, and T. Tolker-Nielsen. 2006. A

81

characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms. Mol Microbiol. 59:1114-1128.

25. Yang, L., K. B. Barken, M. E. Skindersoe, A. B. Christensen, M. Givskov, and T. Tolker-Nielsen. 2007. Effects of iron on DNA release and biofilm development by Pseudomonas aeruginosa. Microbiology. 153:1318-1328.

26. Rocchetta, H. L., L. L. Burrows, and J. S. Lam. 1999. Genetics of O-Antigen Biosynthesis in Pseudomonas aeruginosa. Microbiol.Rev. 63:523-553.

27. Sabra, W., H. Lunsdorf, and A. P. Zeng. 2003. Alterations in the formation of lipopolysaccharide and membrane vesicles on the surface of Pseudomonas aeruginosa PAO1 under oxygen stress conditions. Microbiology. 149:2789-2795.

28. Schooling, S. R. and T. J. Beveridge. 2006. Membrane Vesicles: an Overlooked Component of the Matrices of Biofilms. J.Bacteriol. 188:5945-5957.

29. Tashiro, Y., R. Sakai, M. Toyofuku, I. Sawada, T. Nakajima-Kambe, H. Uchiyama, and N. Nomura. 2009. Outer Membrane Machinery and Alginate Synthesis Regulators Control Membrane Vesicle Production in Pseudomonas aeruginosa. J.Bacteriol. 191:7509-7519.

30. Bomberger, J. M., D. P. MacEachran, B. A. Coutermarsh, S. Ye, G. A. O'Toole, and B. A. Stanton. 2009. Long-Distance Delivery of Bacterial Virulence Factors by Pseudomonas aeruginosa Outer Membrane Vesicles. PLoS Pathog 5:e1000382.

31. Diggle, S., R. Stacey, C. Dodd, M. Camara, P. Williams, and K. Winzer. 2006. The galactophilic lectin, LecA, contributes to biofilm development in Pseudomonas aeruginosa. Environ Microbiol. 8:1095-1104.

32. Tielker, D., S. Hacker, R. Loris, M. Strathmann, J. Wingender, S. Wilhelm, F. Rosenau, and K. E. Jaeger. 2005. Pseudomonas aeruginosa lectin LecB is located in the outer membrane and is involved in biofilm formation. Microbiology. 151:1313-1323.

33. Chemani, C., A. Imberty, S. de Bentzmann, M. Pierre, M. Wimmerova, B. P. Guery, and K. Faure. 2009. Role of LecA and LecB Lectins in Pseudomonas aeruginosa-Induced Lung Injury and Effect of Carbohydrate Ligands. Infect. Immun. 77:2065-2075.

34. Vallet, I., J. W. Olson, S. Lory, A. e. Lazdunski, and A. Filloux. 2001. The chaperone/usher pathways of Pseudomonas aeruginosa: Identification of fimbrial gene clusters (cup) and their involvement in biofilm formation. Proc Natl Acad Sci U S A. 98:6911-6916.

82

35. Ruer, S., S. Stender, A. Filloux, and S. de Bentzmann. 2007. Assembly of Fimbrial Structures in Pseudomonas aeruginosa: Functionality and Specificity of Chaperone-Usher Machineries. J.Bacteriol. 189:3547-3555.

36. Schurr, M. J., H. Yu, J. M. Martinez-Salazar, J. C. Boucher, and V. Deretic. 1996. Control of AlgU, a member of the sigma E-like family of stress sigma factors, by the negative regulators MucA and MucB and Pseudomonas aeruginosa conversion to mucoidy in cystic fibrosis. J.Bacteriol. 178:4997-5004.

37. Sanders, L. H., A. Rockel, H. Lu, D. J. Wozniak, and M. D. Sutton. 2006. Role of Pseudomonas aeruginosa dinB-Encoded DNA Polymerase IV in Mutagenesis. J.Bacteriol. 188:8573-8585.

38. Moyano, A. J. and A. M. Smania. 2009. Simple Sequence Repeats and Mucoid Conversion: Biased mucA Mutagenesis in Mismatch Repair-Deficient Pseudomonas aeruginosa. PLoS ONE 4:e8203.

39. Ramsey, D. M. and D. J. Wozniak. 2005. Understanding the control of Pseudomonas aeruginosa alginate synthesis and the prospects for management of chronic infections in cystic fibrosis. Mol Microbiol. 56:309-322.

40. Wozniak, D. J. and D. E. Ohman. 1994. Transcriptional analysis of the Pseudomonas aeruginosa genes algR, algB, and algD reveals a hierarchy of alginate gene expression which is modulated by algT. J.Bacteriol. 176:6007-6014.

41. Ma, S., U. Selvaraj, D. E. Ohman, R. Quarless, D. J. Hassett, and D. J. Wozniak. 1998. Phosphorylation-Independent Activity of the Response Regulators AlgB and AlgR in Promoting Alginate Biosynthesis in Mucoid Pseudomonas aeruginosa. J.Bacteriol. 180:956-968.

42. Leech, A. J., A. Sprinkle, L. Wood, D. J. Wozniak, and D. E. Ohman. 2008. The NtrC Family Regulator AlgB, Which Controls Alginate Biosynthesis in Mucoid Pseudomonas aeruginosa, Binds Directly to the algD Promoter. J.Bacteriol. 190:581-589.

43. Baynham, P. J., D. M. Ramsey, B. V. Gvozdyev, E. M. Cordonnier, and D. J. Wozniak. 2006. The Pseudomonas aeruginosa Ribbon-Helix-Helix DNA-Binding Protein AlgZ (AmrZ) Controls Twitching Motility and Biogenesis of Type IV Pili. J.Bacteriol. 188:132-140.

44. Lizewski, S. E., D. S. Lundberg, and M. J. Schurr. 2002. The Transcriptional Regulator AlgR Is Essential for Pseudomonas aeruginosa Pathogenesis. Infect.Immun. 70:6083-6093.

45. Hay, I. D., U. Remminghorst, and B. H. A. Rehm. 2009. MucR, a Novel Membrane-Associated Regulator of Alginate Biosynthesis in Pseudomonas aeruginosa. Appl. Environ. Microbiol. 75:1110-1120.

83

46. Qiu, D., V. M. Eisinger, N. E. Head, G. B. Pier, and H. D. Yu. 2008. ClpXP proteases positively regulate alginate overexpression and mucoid conversion in Pseudomonas aeruginosa. Microbiology. 154:2119-2130.

47. Boucher, J. C., H. Yu, M. H. Mudd, and V. Deretic. 1997. Mucoid Pseudomonas aeruginosa in cystic fibrosis: characterization of muc mutations in clinical isolates and analysis of clearance in a mouse model of respiratory infection. Infect.Immun. 65:3838-3846.

48. Jelsbak, L., H. K. Johansen, A. L. Frost, R. Thogersen, L. E. Thomsen, O. Ciofu, L. Yang, J. A. J. Haagensen, N. Hoiby, and S. Molin. 2007. Molecular Epidemiology and Dynamics of Pseudomonas aeruginosa Populations in Lungs of Cystic Fibrosis Patients. Infect.Immun. 75:2214-2224.

49. Ciofu, O., B. Lee, M. Johannesson, N. O. Hermansen, P. Meyer, N. Hoiby, and the Scandinavian Cystic Fibrosis Study Consortium. 2008. Investigation of the algT operon sequence in mucoid and non-mucoid Pseudomonas aeruginosa isolates from 115 Scandinavian patients with cystic fibrosis and in 88 in vitro non-mucoid revertants. Microbiology. 154:103-113.

50. Damron, F. H., D. Qiu, and H. D. Yu. 2009. The Pseudomonas aeruginosa Sensor Kinase KinB Negatively Controls Alginate Production through AlgW-Dependent MucA Proteolysis. J.Bacteriol. 191:2285-2295.

51. Wood, L. and D. E. Ohman. 2009. Use of cell wall stress to characterize sigma 22 (AlgT/U) activation by regulated proteolysis and its regulon in Pseudomonas aeruginosa. Mol Microbiol. 72:183-201.

52. Boucher, J. C., M. J. Schurr, and V. Deretic. 2000. Dual regulation of mucoidy in Pseudomonas aeruginosa and sigma factor antagonism. Molecular Microbiology. 36:341-351.

53. Wozniak, D. J., T. J. O. Wyckoff, M. Starkey, R. Keyser, P. Azadi, G. A. O'Toole, and M. R. Parsek. 2003. Alginate is not a significant component of the extracellular polysaccharide matrix of PA14 and PAO1 Pseudomonas aeruginosa biofilms. Proc Natl Acad Sci U S A. 100:7907-7912.

54. Friedman, L. and R. Kolter. 2004. Genes involved in matrix formation in Pseudomonas aeruginosa PA14 biofilms. Mol Microbiol. 51:675-690.

55. Jackson, K. D., M. Starkey, S. Kremer, M. R. Parsek, and D. J. Wozniak. 2004. Identification of psl, a Locus Encoding a Potential Exopolysaccharide That Is Essential for Pseudomonas aeruginosa PAO1 Biofilm Formation. J.Bacteriol. 186:4466-4475.

56. Friedman, L. and R. Kolter. 2004. Two Genetic Loci Produce Distinct Carbohydrate-Rich Structural Components of the Pseudomonas aeruginosa Biofilm Matrix. J.Bacteriol. 186:4457-4465.

84

57. Ma, L., K. D. Jackson, R. M. Landry, M. R. Parsek, and D. J. Wozniak. 2006. Analysis of Pseudomonas aeruginosa Conditional Psl Variants Reveals Roles for the Psl Polysaccharide in Adhesion and Maintaining Biofilm Structure Postattachment. J.Bacteriol. 188:8213-8221.

58. Matsukawa, M. and E. P. Greenberg. 2004. Putative Exopolysaccharide Synthesis Genes Influence Pseudomonas aeruginosa Biofilm Development. J.Bacteriol. 186:4449-4456.

59. Ma, L., H. Lu, A. Sprinkle, M. R. Parsek, and D. J. Wozniak. 2007. Pseudomonas aeruginosa Psl Is a Galactose- and Mannose-Rich Exopolysaccharide. J.Bacteriol. 189:8353-8356.

60. Byrd, M., I. Sadovskaya, E. Vinogradov, H. Lu, A. Sprinkle, S. Richardson, L. Ma, B. Ralston, M. R. Parsek, E. M. Anderson, J. S. Lam, and D. J. Wozniak. 2009. Genetic and biochemical analyses of the Pseudomonas aeruginosa Psl exopolysaccharide reveal overlapping roles for polysaccharide synthesis enzymes in Psl and LPS productionmmi_6795 622. Mol Microbiol. 73:622-638.

61. Campisano, A., C. Schroeder, M. Schemionek, J. Overhage, and B. H. A. Rehm. 2006. PslD Is a Secreted Protein Required for Biofilm Formation by Pseudomonas aeruginosa. Appl. Environ. Microbiol. 72:3066-3068.

62. Overhage, J., M. Schemionek, J. S. Webb, and B. H. A. Rehm. 2005. Expression of the psl Operon in Pseudomonas aeruginosa PAO1 Biofilms: PslA Performs an Essential Function in Biofilm Formation. Appl. Environ. Microbiol. 71:4407-4413.

63. Ma, L., M. Conover, H. Lu, M. R. Parsek, K. Bayles, and D. J. Wozniak. 2009. Assembly and Development of the Pseudomonas aeruginosa Biofilm Matrix. PLoS Pathog 5:e1000354.

64. Vasseur, P., I. Vallet-Gely, C. Soscia, S. Genin, and A. Filloux. 2005. The pel genes of the Pseudomonas aeruginosa PAK strain are involved at early and late stages of biofilm formation. Microbiology. 151:985-997.

65. Vasseur, P., C. Soscia, R. Voulhoux, and A. Filloux. 2007. PelC is a Pseudomonas aeruginosa outer membrane lipoprotein of the OMA family of proteins involved in exopolysaccharide transport. Biochimie 89:903-915.

66. D'Argenio, D. A., M. W. Calfee, P. B. Rainey, and E. C. Pesci. 2002. Autolysis and Autoaggregation in Pseudomonas aeruginosa Colony Morphology Mutants. J.Bacteriol. 184:6481-6489.

67. Spiers, A., S. Kahn, J. Bohannon, M. Travisano, and P. Rainey. 2002. Adaptive divergence in experimental populations of Pseudomonas fluorescens. I. Genetic and phenotypic bases of wrinkly spreader fitness. Genetics. 161:33-46.

85

68. Kirisits, M. J., L. Prost, M. Starkey, and M. R. Parsek. 2005. Characterization of Colony Morphology Variants Isolated from Pseudomonas aeruginosa Biofilms. Appl. Environ. Microbiol. 71:4809-4821.

69. Hickman, J. W., D. F. Tifrea, and C. S. Harwood. 2005. A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc Natl Acad Sci U S A. 102:14422-14427.

70. Jenal, U. and J. Malone. 2006. Mechanisms of Cyclic-di-GMP Signaling in Bacteria. Annu Rev Genet. 40:385-407.

71. Goodman, A. L., B. Kulasekara, A. Rietsch, D. Boyd, R. S. Smith, and S. Lory. 2004. A Signaling Network Reciprocally Regulates Genes Associated with Acute Infection and Chronic Persistence in Pseudomonas aeruginosa. Dev Cell. 7:745-754.

72. Yahr, T. and E. P. Greenberg. 2004. The genetic basis for the commitment to chronic versus acute infection in Pseudomonas aeruginosa. Mol Cell. 16:497-498.

73. Ventre, I., A. L. Goodman, I. Vallet-Gely, P. Vasseur, C. Soscia, S. +. Molin, S. Bleves, A. e. Lazdunski, S. Lory, and A. Filloux. 2006. Multiple sensors control reciprocal expression of Pseudomonas aeruginosa regulatory RNA and virulence genes. Proc Natl Acad Sci U S A. 103:171-176.

74. Irie, Y., M. Starkey, A. Edwards, D. J. Wozniak, T. Romeo, and M. R. Parsek. 2010. The key Pseudomonas aeruginosa biofilm matrix polysaccharide, Psl, is regulated at multiple levels by RpoS and RsmA. Mol Microbiol. Forthcoming publication.

75. Borlee, B., A. Goldman, K. Murakami, R. Samudrala, D. J. Wozniak, and M. R. Parsek. 2010. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. Mol Microbiol. 75:827-842.

76. Attila, C., A. Ueda, and T. Wood. 2008. PA2663 (PpyR) increases biofilm formation in Pseudomonas aeruginosa PAO1 through the psl operon and stimulates virulence and quorum-sensing phenotypes. Appl Microbiol Biotechnol. 78:293-307.

77. Bazire, A., K. Shioya, E. Soum-Soutera, E. Bouffartigues, C. Ryder, L. Guentas-Dombrowsky, G. Hemery, I. Linossier, S. Chevalier, D. J. Wozniak, O. Lesouhaitier, and A. Dufour. 2010. The Sigma Factor AlgU Plays a Key Role in Formation of Robust Biofilms by Nonmucoid Pseudomonas aeruginosa. J.Bacteriol. 192:3001-3010.

78. Knutson, C. A. and A. Jeanes. 1968. A new modification of the carbazole analysis: Application to heteropolysaccharides. Anal Biochem. 24:470-481.

86

79. Marina C., Luppi E., Maccari F., and Volpi N. 2003. A 96-well assay for uronic acid carbazole assay. Carbohydr Polym. 54:59-61.

80. Maloy, S., V. J. Stewart, and R. K. Taylor. 1996. Appendix E: Enzyme Assays, p. 493-495. In Genetic Analysis of Pathogenic Bacteria. Cold Spring Harbor Laboratory Press, Plainview, NY.

81. Waligora, E., D. M. Ramsey, E. Pryor, H. Lu, G. Sloan, T. Hollis, R. Deora, and D. J. Wozniak. 2010. AmrZ Beta-Sheet Residues Are Essential For DNA-Binding And Transcriptional Control Of Pseudomonas aeruginosa Virulence Genes. Mol Microbiol. Forthcoming publication.

82. Stapper, A. P., G. Narasimhan, D. E. Ohman, J. Barakat, M. Hentzer, S. Molin, A. Kharazmi, N. Hoiby, and K. Mathee. 2004. Alginate production affects Pseudomonas aeruginosa biofilm development and architecture, but is not essential for biofilm formation. J Med Microbiol 53:679-690.

83. Mathee, K., O. Ciofu, C. Sternberg, P. W. Lindum, J. I. A. Campbell, P. Jensen, A. H. Johnsen, M. Givskov, D. E. Ohman, M. Soren, N. Hoiby, and A. Kharazmi. 1999. Mucoid conversion of Pseudomonas aeruginosa by hydrogen peroxide: a mechanism for virulence activation in the cystic fibrosis lung. Microbiology. 145:1349-1357.

84. Flynn, J. L. and D. E. Ohman. 1988. Cloning of genes from mucoid Pseudomonas aeruginosa which control spontaneous conversion to the alginate production phenotype. J.Bacteriol. 170:1452-1460.

85. Ma, S., U. Selvaraj, D. E. Ohman, R. Quarless, D. J. Hassett, and D. J. Wozniak. 1998. Phosphorylation-Independent Activity of the Response Regulators AlgB and AlgR in Promoting Alginate Biosynthesis in Mucoid Pseudomonas aeruginosa. J.Bacteriol. 180:956-968.

86. Woolwine, S. C. and D. J. Wozniak. 1999. Identification of an Escherichia coli pepA Homolog and Its Involvement in Suppression of the algB Phenotype in Mucoid Pseudomonas aeruginosa. J.Bacteriol. 181:107-116.

87. Ramsey, D. M., P. J. Baynham, and D. J. Wozniak. 2005. Binding of Pseudomonas aeruginosa AlgZ to Sites Upstream of the algZ Promoter Leads to Repression of Transcription. J.Bacteriol. 187:4430-4443.

88. Tart, A. H., M. C. Wolfgang, and D. J. Wozniak. 2005. The Alternative Sigma Factor AlgT Represses Pseudomonas aeruginosa Flagellum Biosynthesis by Inhibiting Expression of fleQ. J.Bacteriol. 187:7955-7962.

89. Tart, A. H., M. J. Blanks, and D. J. Wozniak. 2006. The AlgT-Dependent Transcriptional Regulator AmrZ (AlgZ) Inhibits Flagellum Biosynthesis in Mucoid, Nonmotile Pseudomonas aeruginosa Cystic Fibrosis Isolates. J.Bacteriol. 188:6483-6489.

87

90. Patricia J.Baynham, A. L. B. L. L. H. a. J. W. 1999. Pseudomonas aeruginosa AlgZ, a ribbon-helix-helix DNA-binding protein, is essential for alginate synthesis and algD transcriptional activation. Mol Microbiol. 33:1069-1080.

91. Ma, L., M. Conover, H. Lu, M. R. Parsek, K. Bayles, and D. J. Wozniak. 2009. Assembly and Development of the Pseudomonas aeruginosa Biofilm Matrix. PLoS Pathog 5:e1000354.

92. Massimo Merighi, V. T. L. M. H. Y. H. a. S. L. 2007. The second messenger bis-(3-5)-cyclic-GMP and its PilZ domain-containing receptor Alg44 are required for alginate biosynthesis in Pseudomonas aeruginosa. Mol Microbiol. 65:876-895.

93. Guvener, Z. and C. S. Harwood. 2007. Subcellular location characteristics of the Pseudomonas aeruginosa GGDEF protein, WspR, indicate that it produces cyclic-di-GMP in response to growth on surfaces. Mol Microbiol. 66:1459-1473.

94. Snyder, J. A., B. J. Haugen, C. V. Lockatell, N. Maroncle, E. C. Hagan, D. E. Johnson, R. A. Welch, and H. L. T. Mobley. 2005. Coordinate Expression of Fimbriae in Uropathogenic Escherichia coli. Infect. Immun. 73:7588-7596.

95. Wu, J., X. Lin, and H. Xie. 2008. OxyR is involved in coordinate regulation of expression of fimA and sod genes in Porphyromonas gingivalis. FEMS Microbiol Lett. 282:188-195.

96. Gibson, R. L., J. L. Burns, and B. W. Ramsey. 2003. Pathophysiology and Management of Pulmonary Infections in Cystic Fibrosis. Am. J. Respir. Crit. Care Med. 168:918-951.

97. Tollersrud, T., K. Kenny, A. J. Reitz, Jr., and J. C. Lee. 2000. Genetic and Serologic Evaluation of Capsule Production by Bovine Mammary Isolates of Staphylococcus aureus and Other Staphylococcus spp. from Europe and the United States. J. Clin. Micro. 38:2998-3003.

98. Fux, C. A., M. Shirtliff, P. Stoodley, and J. W. Costerton. 2005. Can laboratory reference strains mirror ‘real-world’ pathogenesis? Trends Microbiol. 13:58-63.

88

APPENDIX A

Raw Data of Representative Experiments of Clinical Strains Used in This Study

Strain

Name

Mucoid

Phenotype

Psl

(µg/ml)

Attachment

(OD540 nm)

Source of Isolation

WFU1 N 1.63 0.27 UTI

WFU2 N 9.01 0.38 UTI

WFU3 N 7.57 0.27 Foot Wound

WFU4 N 0.30 0.32 Ear

WFU5 N 2.18 0.41 Bronchial

WFU6 N 0.82 0.07 Sputum

WFU7 N 0.68 0.20 Trach. Asp.

WFU8 N 11.0 0.07 Trach. Asp.

WFU9 N 8.64 0.15 Trach. Asp.

WFU10 N 10.2 0.29 Trach. Asp.

WFU11 N 11.0 ND Trach. Asp.

WFU12 N 0.00 0.00 Sputum

WFU13 M 3.09 0.25 CF Sputum

WFU14 M 1.39 0.03 CF Sputum

WFU15 M 0.60 0.01 CF Sputum

WFU16 N 11.0 0.37 Trach. Asp.

WFU17 M 15.1 ND CF

WFU18 N 0.01 ND CF

89

Strain

Name

Mucoid

Phenotype

Psl

(µg/ml)

Attachment

(OD540 nm)

Source of Isolation

WFU19 N 7.34 ND CF

WFU20 M 8.40 ND CF

WFU21 N 0.99 ND CF

WFU22 M 2.25 ND CF

UC1 N 5.11 0.12 Wound

UC2 N 0.85 0.11 Wound

UC3 N 4.48 0.02 Wound

UC4 N 4.60 0.13 Wound

UC5 N 3.72 0.04 Wound

UC6 N 7.57 0.06 Wound

UC7 N 5.48 0.05 Wound

UC8 N 3.04 0.01 Wound

UC9 N 4.64 0.12 Wound

UC10 N 4.28 0.13 Wound

UC11 N 6.28 0.20 Wound

UC12 N 11.7 0.21 Wound

UC13 N ND 0.10 Wound

UC14 M ND 0.08 Wound

UC15 N 2.46 0.07 CF

UC16 N 2.88 0.11 CF

UC17 N 4.68 0.06 CF

90

Strain

Name

Mucoid

Phenotype

Psl

(µg/ml)

Attachment

(OD540 nm)

Source of Isolation

UC18 M 0.51 0.07 CF

UC19 M 4.67 0.10 CF

UC20 N 3.69 0.09 CF

UC21 N 3.46 0.05 CF

UC22 M 0.82 0.88 CF

UC23 M 1.30 0.05 CF

UC24 M 1.21 0.02 CF

UC25 N 1.44 0.03 CF

UC26 N 4.63 0.02 CF

UC27 N 4.18 0.05 CF

UC28 N 3.57 0.05 CF

UC29 M 2.23 0.05 CF

UC30 N 1.89 0.03 CF

UC31 N 1.39 ND CF

UC32 N 0.00 ND CF

UC33 M 39.3 ND CF

UC34 M 1.60 ND CF

UC35 N 0.37 ND CF

UC36 N 1.48 ND CF

UC37 N 0.71 ND CF

UC38 N 2.30 ND CF

91

Strain

Name

Mucoid

Phenotype

Psl

(µg/ml)

Attachment

(OD540 nm)

Source of Isolation

UC39 M 4.02 ND CF

UC40 N 3.31 ND CF

UC41 N 3.45 ND CF

UC42 M 2.08 ND CF

UC43 N 2.63 ND CF

UNC1 N 2.98 0.16 Tomato plant

UNC2 N 1.37 0.05 Water

UNC3 N 0.62 0.03 Water

UNC4 N 16.8 0.05 CF

UNC5 N 4.43 0.03 CF

UNC6 N 1.76 0.05 CF

UNC7 N 2.93 0.03 UTI

UNC8 N 2.53 0.05 UTI

UNC9 N 6.35 0.12 UTI

UNC10 N 3.19 0.02 UTI

UNC11 N 7.86 0.08 UTI

UNC12 N 3.68 0.08 Cornea

UNC13 N 3.35 0.15 Cornea

UNC14 N 9.90 0.05 Blood

UNC15 N 7.24 0.12 Blood

UNC16 M 1.31 ND Lung pus: CF

92

Strain

Name

Mucoid

Phenotype

Psl

(µg/ml)

Attachment

(OD540 nm)

Source of Isolation

UNC17 M 6.38 ND Lung pus: CF

UNC18 M 27.5 ND Lung pus: CF

UNC19 M 26.4 ND Lung pus: CF

UNC20 M 10.3 ND Lung pus: CF

UW1 N 11.1 ND CF

UW2 N 8.44 ND CF

UW3 N 2.59 ND CF

UW4 N 3.85 ND CF

UW5 N 1.43 ND CF

UW6 N 0.70 ND CF

UW7 N 1.83 ND CF

UW8 M 8.38 ND CF

UW9 N 4.86 ND CF

UW10 M 4.42 ND CF

NCH2 M 3.63 ND CF

NCH3 M 32.4 ND CF

NCH4 M 4.88 ND CF

NCH5 M 18.0 ND CF

NCH7 M 31.4 ND CF

NCH8 M 33.0 ND CF

NCH9 M 39.9 ND CF

93

Strain

Name

Mucoid

Phenotype

Psl

(µg/ml)

Attachment

(OD540 nm)

Source of Isolation

NCH10 M 28.5 ND CF

NCH11 M 15.4 ND CF

NCH14 M 41.6 ND CF

NCH15 M 25.7 ND CF

NCH17 M 40.0 ND CF

NCH19 M 1.81 ND CF

NCH20 M 0.70 ND CF

NCH22 M 2.52 ND CF

NCH35 M 5.24 ND CF

NCH36 M 19.2 ND CF

NCH46 M 14.0 ND CF

NCH50 M 62.3 ND CF

NCH51 M 1.37 ND CF

NCH57 M 8.70 ND CF

NCH59 M 1.50 ND CF

NCH62 M 2.80 ND CF

NCH63 M 1.28 ND CF

NCH64 M 1.43 ND CF

NCH65 M 14.1 ND CF

NCH66 M 0.90 ND CF

NCH86 M 4.36 ND CF

94

Strain

Name

Mucoid

Phenotype

Psl

(µg/ml)

Attachment

(OD540 nm)

Source of Isolation

NCH88 M 9.40 ND CF

NCH91 M 8.20 ND CF

NCH96 M 1.18 ND CF

NCH99 M 9.00 ND CF

NCH101 M 3.30 ND CF

NCH102 M 19.1 ND CF

NCH103 M 9.64 ND CF

NCH105 M 8.10 ND CF

NCH106 M 0.91 ND CF

NCH107 M 1.88 ND CF

NCH108 M 0.49 ND CF

NCH109 M 1.15 ND CF

NCH111 M 1.55 ND CF

NCH114 M 5.86 ND CF

NCH116 M 32.9 ND CF

NCH117 M 30.3 ND CF

NCH118 M 2.03 ND CF

NCH119 M 3.55 ND CF

NCH120 M 0.78 ND CF

NCH128 M 9.00 ND CF

95

APPENDIX B

Complementation and Revertant Data of Mucoid Strains

mucA Complementation Strain Name

Psl (µg/ml) Psl

without Psl

with Alginate without

Alginate with

Revertant Psl (µg/ml)

mucA status

WFU15 0.6 ±0.78 3.07, 3.26 ND ND ND WTmucA

WFU17 15.1 ±11.4 15.3

±4.2,

10.4 ±4.6 165

±50.9,

-20 ±7 ND ∆mucA

WFU20 8.4 ±3.6 8.11

±4.5,

24.1 ±10 156

±56.7,

89.5

±101

8 ±6 ∆mucA

WFU22 2.25 ±2.24 5.4 ±1.5, 4.7 ±1.3 262.3

±58.8,

81.5

±48.3

19.2 ±16.7 ∆mucA

UC18 0.51 ±0.62 9.03

±1.02,

11.9 ±6.4 ND ND ND ∆mucA

UC34 1.6 ±0.99 3.45

±2.4,

22 ±7 344

±42.7,

117

±93.3

5.34 ±0.88 WTmucA

UC39 4.02 ±2.23 2.45

±2.59,

29.1

±17.7

218±31.

9,

203

±64.5

4.2 ±1.7 WTmucA

UNC16 1.31 ±0.13 1.97

±1.73,

12.4 ±9 330

±0.14,

133

±49.8

6.14 ±6.12 ∆mucA

UNC17 6.38

±1.67,

7.29

±2.35

355

±108.6,

139

±53.2

22.8 ±20.2 WTmucA

UNC18 27.5 ±18.2 29.7

±5.3,

37.5

±10.2

ND ND ND WTmucA

UW8 8.38 ±1.75 5.46 21.9 287 110 ND ∆mucA

96

mucA Complementation Strain Name

Psl (µg/ml) Psl

without Psl

with Alginate without

Alginate with

Revertant Psl (µg/ml)

mucA status

±1.68, ±13.1 ±70.4, ±79.1

UW10 4.42 ±1.95 2.5 ±0.9, 22 ±11.3 ND ND 10.7 ±6.48 ∆mucA

NCH3 32.4 ±18.5 ND ND ND ND 8.73 ±2.7 ND

NCH7 31.4 ±15.8 ND ND ND ND 44.1 ±27.6 ND

NCH8 33 ±5.3 ND ND ND ND 32.5 ±17.6 ND

NCH9 39.9 ±10.1 ND ND ND ND 23 ±22.5 ND

NCH14 41.6 ±4.4 ND ND ND ND 31.8 ±2.2 ND

NCH15 25.7 ±3.87 ND ND ND ND 27.6 ±1.85 ND

NCH17 40 ±4.5 ND ND ND ND 48 ±20.3 ND

NCH35 5.24 ±5.5 ND ND ND ND 12 ±5.1 ND

NCH36 19.2 ±7 ND ND ND ND 33.8 ±15.8 ND

NCH46 14 ±9.25 ND ND ND ND 31.7 ±21.1 ND

97

APPENDIX C

mucA Complementation of Mucoid Clinical Strains Shown in Figure 16

Legend: Viscous appearance = mucoid, -ara = no arabinose, +ara = 0.5% arabinose, ∆mucA = mutation in mucA, WTmucA = no mutation in mucA

UNC16 UNC17

- ara +ara - ara +ara ∆mucA WTmucA

NCH19 NCH102

- ara +ara - ara +ara ∆mucA WTmucA

98

UC33 NCH103

- ara +ara

WTmucA - ara

∆mucA

+ara

UC34 UC39

- ara +ara - ara +ara

WTmucA WTmucA

99

UW8 UW10

- ara +ara ∆mucA

- ara +ara ∆mucA

WFU14 WFU13

- ara +ara WTmucA

- ara +ara WTmucA

100

WFU17 WFU15

W- ara - ara +ara +ara

TmucA ∆mucA

WFU20 WFU22

- ara +ara ∆mucA

- ara +ara

∆mucA

101

SCHOLASTIC VITA

CYNTHIA RACHEL RYDER

BORN:

UNDE

Summ , Centers for Disease Control, Atlanta, Georgia, su 004

Student Sponsored Speaker Series, Wake Forest University, Chairperson, 2008

ONORS AND AWARDS:

tudent Travel Award, Mid Atlantic Microbial Pathogenesis Meeting, 2009

Trainee Travel Award, 5th ASM Meeting on Biofilms, 2009

ROFESSIONAL SOCIETIES:

Beta Beta Beta Biological Honor Society, 2005

Am

PUBLIC

a

February 17, 1983, Knoxville, Tennessee

RGRADUATE

STUDY: Furman University

Greenville, South Carolina

B.S. Biology

GRADUATE STUDY: Wake Forest University

Winston-Salem, North Carolina

Ph.D. 2010

SCHOLASTIC AND PROFESSIONAL EXPERIENCE:

Undergraduate Teaching Assistant, Furman University, 2002-2005

er Research Program mmer 2

H

S

P

erican Society of Microbiology, 2009

ATIONS:

Cynthia Ryder, Matthew Byrd, and Daniel J Wozniak. Role of polysaccharides in Pseudomonas aeruginosa biofilm development. Current Opinion in Microbiology 2007, 10:644–648.

Bazire, Alexis; Shioya, Kouki; Soum-Soutera, Emmanuelle; Bouffartigues, Emeline; Ryder, Cynthia; Guentas-Dombrowsky, Linda; Hemery, Gaelle; Linossier, Isabelle; Chevalier, Sylvie; Wozniak, Daniel J.; Lesouhaitier, Olivier; Dufour, Alain. The SigmFactor AlgU Plays a Key Role in Formation of Robust Biofilms by Nonmucoid Pseudomonas aeruginosa. Journal of Bacteriology 2010, Jun;192(12):3001-10.

102

Cynthia Ryder, Elizabeth Waligora, Yasuhiko Irie, Matthew Parsek, and Daniel J. Wozniak. AmrZ regulates inverse expression of the Pseudomonas aeruginosa biofilm matrix polysaccharides alginate and Psl. Manuscript in preparation. Luyan Ma, Cynthia Ryder, Erin Anderson, Joseph Lam, Daniel J. Wozniak Pseudomonas aeruginosa controls its periphery exoploysaccharides by check point enzyme, AlgC. In preparati Cynthia Ryder, Kelly Colvin, Molly Bain, Matthew Parsek, Daniel J.Wozniak.

n of polysaccharide l isolates of a. In preparation.

on.

Evaluatio expression and biofilm formation in clinicaPseudomonas aeruginos

103