R E S E A R C H A R T I C L E

N E U R O S C I E N C E

STIM2 Regulates Capacitive Ca2+ Entry inNeurons and Plays a Key Role in HypoxicNeuronal Cell DeathAlejandro Berna-Erro,1,2* Attila Braun,1,2* Robert Kraft,3 Christoph Kleinschnitz,4

Michael K. Schuhmann,4 David Stegner,1,2 Thomas Wultsch,5 Jens Eilers,3 Sven G. Meuth,4

Guido Stoll,4 Bernhard Nieswandt1,2†

(Published 20 October 2009; Volume 2 Issue 93 ra67)

httD

ownloaded from

Excessive cytosolic calcium ion (Ca2+) accumulation during cerebral ischemia triggers neuronal celldeath, but the underlying mechanisms are poorly understood. Capacitive Ca2+ entry (CCE) is a pro-cess whereby depletion of intracellular Ca2+ stores causes the activation of plasma membrane Ca2+

channels. In nonexcitable cells, CCE is controlled by the endoplasmic reticulum (ER)–resident Ca2+

sensor STIM1, whereas the closely related protein STIM2 has been proposed to regulate basal cyto-solic and ER Ca2+ concentrations and make only a minor contribution to CCE. Here, we show thatSTIM2, but not STIM1, is essential for CCE and ischemia-induced cytosolic Ca2+ accumulation in neu-rons. Neurons from Stim2−/− mice showed significantly increased survival under hypoxic conditionscompared to neurons from wild-type controls both in culture and in acute hippocampal slice prepara-tions. In vivo, Stim2−/− mice were markedly protected from neurological damage in a model of focalcerebral ischemia. These results implicate CCE in ischemic neuronal cell death and establish STIM2as a critical mediator of this process.

p://st

on June 19, 2020

ke.sciencemag.org/

INTRODUCTION

The intracellular Ca2+ concentration [Ca2+]i is a major determinant of thephysiological state of all eukaryotic cells (1). In neurons, Ca2+ signals derivedfrom intracellular stores or from the extracellular space are essential for var-ious functions, including synaptic transmission and plasticity, but underpathological conditions, such as cerebral ischemia, a “calcium overload” caninduce neuronal cell death (2–6). Two principal types of Ca2+ channels medi-ate Ca2+ entry into neurons: Voltage-gated Ca2+ channels and some ionotropicneurotransmitter receptors, includingN-methyl-D-aspartate (NMDA) receptors(NMDARs) and some a-amino-3-hydroxy-5-methyl-4-isoxazolepropionicacid receptors (AMPARs). Both of the latter are activated by the excitatoryneurotransmitter glutamate, and glutamate excitotoxicity contributes to neuro-degeneration in ischemia (4, 7, 8). Less is known about the presence andfunctional importance in neurons of store-operated Ca2+ (SOC) channels,which are activated in response to Ca2+ store depletion to allow capacitiveCa2+ entry [CCE, also called store-operated Ca2+ entry (SOCE)] and store re-plenishment (9, 10). STIM proteins are endoplasmic-sarcoplasmic reticulum(ER-SR)–resident Ca2+-sensing molecules that regulate CCE (11). STIM1is an essential component of CCE in different cell types, including lympho-cytes (12–14), platelets (15), and (excitable) skeletal muscle cells (16),

1Rudolf Virchow Center, DFG Research Center for Experimental Biomedi-cine, University of Würzburg, Josef-Schneider-Straße 2, D15 97080, Würzburg,Germany. 2Vascular Medicine, University of Würzburg, Josef-Schneider-Straße2, D15 97080, Würzburg, Germany. 3Carl-Ludwig-Institute for Physiology, Uni-versity of Leipzig, Liebigstr. 27, 04103, Leipzig, Germany. 4Department of Neu-rology, University Clinic Würzburg, Josef-Schneider-Str. 11, 97080, Würzburg,Germany. 5Molecular andClinical Psychobiology,Department of Psychiatry andPsychotherapy, University of Würzburg, Fuechsleinstr. 15, 97080, Würzburg,Germany.*These authors contributed equally to this work.†To whom correspondence should be addressed. E-mail: bernhard.nieswandt@virchow.uni-wuerzburg.de

ww

where it activates the SOC channel Orai1 (17) [also termed CRACM1(18)] and possibly other SOC channels, whereas STIM2 has been proposedto regulate basal cytosol and store Ca2+ concentrations (19, 20), making aminor contribution to CCE in some cell types (14). No information, how-ever, is available on the function of STIM proteins in neurons.

RESULTS

STIM2 is the predominant STIM isoform in neuronsWe assessed STIM abundance in mouse brain by Western blot analysisand obtained a clear signal for STIM2, whereas STIM1 was only weaklydetectable. We failed to observe a comparable predominance of STIM2abundance in any other organ tested (Fig. 1A). Immunocytochemicalanalysis revealed hardly any signal for STIM1 in cultured hippocampalneurons, whereas strong perinuclear staining was detected with anti-bodies directed against STIM2, consistent with its expected ER localization(Fig. 1B). In contrast, in T cells the ratio of STIM1 to STIM2 abundancewas reversed (Fig. 1B) (14). Reverse transcription–polymerase chain re-action (RT-PCR) analysis of primary hippocampal neurons isolated by lasercapture microscopy confirmed that STIM2 was the predominant member ofthe STIM family present (Fig. 1C), indicating that it might have a role inCa2+ homeostasis in these cells. Similar to Stim1, Orai1 messenger RNA(mRNA) was hardly detectable in neurons, whereas strong and weak expres-sion was seen for the Orai1 homologs and putative STIM2 targets Orai2 andOrai3 (20), respectively (Fig. 1C). Williams and co-workers have previouslyshown that the mRNAs encoding both STIM1 and STIM2 are expressedin human brain samples, indicating that both proteins might be present inneuronal cells (21). We also detected Stim1 message in mouse brain tissuesamples (Fig. 1C), and the protein is detectable in this organ (Fig. 1A).However, on the basis of data obtained with isolated neurons, it appearsthat these signals largely derive from cells other than neurons.

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 1

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

STIM2-deficient mice develop normally but have areduced life expectancyTo assess STIM2 function in vivo, we disrupted the Stim2 gene in mice(Fig. 1, D and E). Mice heterozygous for the STIM2-null mutation wereapparently healthy and had a normal life expectancy. Intercrossing of theseanimals yielded Stim2−/− mice at the expected Mendelian ratio, and theStim2−/− mice developed normally to adulthood and were fertile (fig.S1). Western blot analyses confirmed the absence of STIM2 in the brainand lymph nodes (LNs), whereas STIM1 abundance was unaltered (Fig.1F). Histological examination of major organs from Stim2−/− mice showedno obvious abnormalities. Starting at 8 weeks after birth, however, we ob-served sudden death of Stim2−/− mice, and only ~10% of the animalsreached the age of 30 weeks (fig. S1). Spontaneous death of Stim2−/− micehas been reported by others (14), although in that study it occurred beforeadulthood (4 to 5 weeks after birth), a difference that may arise from dif-ferences in the genetic background of the two Stim2−/− mouse strains.

ww

Stim2−/− mice did not show any apparent neurological deficits, andNissl staining of brain sections revealed no obvious structural abnor-malities (fig. S2). However, a pronounced cognitive defect became appar-ent when the animals were subjected to the Morris Water Maze Task, thestandard test for hippocampus-dependent spatial memory (22). Stim2−/−

mice showed normal swimming ability but took longer to find the hid-den platform, and the total distance moved was increased in acquisitiontrials, but not in reversal trials (Fig. 2A). In contrast, evaluation of anxiety-like behavior by the Elevated Plus Maze Task revealed no differences be-tween Stim2−/− and wild-type littermates (P > 0.05; Fig. 2B). Thus, lack ofSTIM2 leads to a distinct cognitive impairment.

STIM2 regulates CCE and ischemia-induced Ca2+

accumulation in neuronsTo test the effect of STIM2 deficiency on neuronal Ca2+ homeostasisdirectly, we performed Ca2+ imaging experiments in neuronal cultures

Fig. 1. STIM2 is the main STIM isoform in neurons. (A) Western blot analysisof STIM1 and STIM2 abundance in various organs of 2-month-old mice;a-tubulin expression was used as loading control. LN, lymph node; Plt,platelet. (B) Immunofluorescence staining of STIM1 (top) and STIM2 (mid-dle) in cultured hippocampal neurons [major microtubule-associated protein2a/b (MAP2a/b), green] and CD4+ T cells from wild-type mice. Immunoflu-orescence staining of STIM2 in cultured hippocampal neurons (MAP2a/b,green) from Stim2−/− (bottom) mice. Cell nuclei are counterstained with

DAPI (blue). Scale bars, 10 mm. (C) RT-PCR of neuronal and heart com-plementary DNA with Stim and Orai primers. (D) Targeting strategy for thegeneration of Stim2−/− mice (see Materials and Methods for details); Neo-LacZ, neomycin resistance and LacZ cassettes. (E) Southern blot analy-sis of Bam HI–digested genomic DNA of wild-type (+/+), heterozygous(+/−), or Stim2 knockout (−/−) mice labeled with the external probe. (F)Western blot analysis of STIM2 and STIM1 expression in brain and lymphnode (LN) cells of adult wild-type and Stim2−/− mice.

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 2

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

extracted from cortical tissue. To assess CCE, we elicited Ca2+ store re-lease by exposing cells to the sarcoendoplasmic reticulum Ca2+ adenosine-5′-triphosphatase (SERCA) pump inhibitor cyclopiazonic acid (CPA) inthe absence of extracellular Ca2+. This treatment caused a transient Ca2+

signal, followed by a second [Ca2+]i increase, after the addition of externalCa2+, that attained a peak signal that exceeded the basal Ca2+ concentration,suggesting the presence of CCE (Fig. 3A). CCE was reduced in Stim2−/−

neurons compared to that in wild-type controls (27 ± 9 nM versus 82 ±16 nM; n = 7; P < 0.05; Fig. 3A), whereas no significant alterations inpeak CCE were found in neurons from STIM1-deficient (15) and Orai1-deficient (23) mice compared to the respective controls (Fig. 3A). Thus,CCE in cultured neurons is regulated by STIM2 but does not requireSTIM1 or Orai1, the essential components of CCE in nonexcitable cells.

Brandman et al. have shown that STIM2 regulates basal Ca2+ con-centrations in the cytosol and the ER of various nonneuronal cell lines(19). Consistent with this study, we found that Stim2−/− neurons had lowerbasal [Ca2+]i than did wild-type neurons (62 ± 9 nM versus 103 ± 12 nM;n = 7; P < 0.05), whereas no such difference was seen in Stim1−/− andOrai1−/− neurons (Fig. 3A). To evaluate the Ca2+ content of intracellularstores, we measured Ca2+ release from this compartment in response toapplication of the membrane-permeant calcium ionophore ionomycin inthe absence of extracellular Ca2+ (19). The peak amplitude of Ca2+ releasewas decreased in Stim2−/− neurons compared to that in control neurons(0.12 ± 0.02 versus 0.33 ± 0.07; n = 5; P < 0.05), whereas the subsequentCa2+ entry after readdition of extracellular Ca2+ was indistinguishable(Fig. 3B). This observation is consistent with the notion that STIM2 reg-ulates store refilling (11, 20), as well as the basal cytosolic Ca2+ concen-tration (19) in neurons by sensing ER Ca2+ content and, if it is too low,activating CCE. In wild-type neurons, the resulting Ca2+ influx will beused to refill Ca2+ stores. Consequently, ER Ca2+ content and the cytosolicCa2+ concentration will be decreased in Stim2−/− neurons compared towild-type neurons.

ww

During brain ischemia, excess [Ca2+]i is thought to play a criticalrole in triggering neuronal cell death (2). To evaluate the possible in-volvement of CCE in this process, we performed Ca2+-imaging experi-ments on wild-type and Stim2−/− neuronal cultures under conditions ofoxygen-glucose deprivation (OGD), in some cases combined with adecreased pH (24), an established system for investigating calcium-dependent and calcium-independent mechanisms in neuronal injury(25, 26). OGD has been reported to lead to increased [Ca2+]i, which islargely reversible when the duration of the insult is limited to 1 hour (26).We observed a robust increase in [Ca2+]i in the wild-type neurons (131 ±46 nM; n = 5) but only a small increase in [Ca2+]i during 1 hour of OGDin Stim2−/− cells (11 ± 15 nM; n = 5; P < 0.05; Fig. 3C). A marked in-crease in [Ca2+]i was apparent in Stim2−/− cultures only when OGD wasextended to 2 hours. The mitochondrial uncoupling agent carbonyl cya-nide m-chlorophenylhydrazone (CCCP, 2 mM, 30 min) elicited a large,rapid [Ca2+]i increase in both wild-type and Stim2−/− neurons (Fig. 3D).However, after a 1-hour washout of CCCP, [Ca2+]i declined more rapidlyand completely in Stim2−/− neurons than in wild-type cells (89 ± 3% ver-sus 72 ± 3%; n = 5; P < 0.05; Fig. 3D). Thus, ischemia-induced increasesin [Ca2+]i develop more slowly and recover more rapidly in Stim2−/− neu-rons compared to that in wild-type neurons, an observation that may, inpart, be explained by the lower store content in these cells. It has beenreported that anoxia causes slow depletion of the ER Ca2+ store and thatSERCA plays a major role in cytosolic Ca2+ clearance in sensory neurons(27). Thus, a lower ER Ca2+ content would decrease the cytosolic Ca2+

load emanating from the ER and might also facilitate SERCA-mediatedCa2+ recovery under postischemic conditions.

The marked suppression of OGD-induced Ca2+ accumulation in Stim2−/−

neurons indicated a possible neuroprotective effect of STIM2 deficiencyunder ischemic conditions. To test this possibility directly, we subjectedcultured hippocampal neurons to OGD (Fig. 4, A and B). After 5 to 7 daysunder control culture conditions, 80.6 ± 4.4% (n = 5) of wild-type neurons

Fig. 2. Stim2−/− and wild-type (WT)littermates in the Morris Water Mazetask. (A) Total duration and dis-tance mice swam before findingthe hidden platform; the arrowsindicate the start of the reversaltrials, where the platform was movedto a different position. Values areshown as mean ± SEM; F1,12 =19.73, P < 0.001 [comparison ofStim2−/− and wild-type mice inthe acquisition phase (trials 1 to12)], analysis of variance (ANOVA)for repeated measures. (B) Analy-sis of Stim2−/− mice and wild-typelittermates in the elevated plusmaze to assess anxiety-like behav-ior. Values are shown as mean ±SEM, Student’s t test. not signifi-cant. The top and middle panelsrepresent the percent of total timemice spent in either the open orthe closed arm of the maze, re-spectively. The last panel displaysthe number of total visits to theclosed arms.

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 3

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

were viable, in agreement with previous studies (28). There was a com-parable number of viable Stim1−/− neurons (76.7 ± 7.8%; n = 5; P >0.05), whereas neurons prepared from Stim2−/− mice showed increasedviability (88.7 ± 2.6%; n = 3; P < 0.01). After 6 hours under ischemicconditions (low glucose, N2, pH 6.4) (24), we observed a similarlystrong decrease in viability in wild-type and Stim1−/− neurons (51.9 ±8.4% versus 52.4 ± 6.6%, n = 5, P > 0.05), whereas Stim2−/− neuronssurvived significantly better (72.9 ± 4.3%; n = 3, P < 0.001; Fig. 4, Aand B).

We performed experiments to discriminate among the effects of anoxia,low glucose concentration, and decreased pH on the survival of wild-typeand Stim2−/− neurons. Lowering the extracellular pH or glucose concen-tration reduced the survival of both wild-type and Stim2−/− neurons com-pared to that in control conditions, although Stim2−/− neurons survivedboth conditions significantly better than did wild-type cells. A strong pro-tective effect of STIM2 deficiency was also apparent when the cells wereexposed to anoxia alone or to anoxia in combination with low pH andreduced glucose concentration (fig. S3).

In the next set of experiments, we assessed the role of STIM2 in otherapoptosis-inducing pathways. Here, we treated cultured neurons with stauro-sporine, which modulates intracellular Ca2+ (29), or with N, N, N ′, N′-

ww

tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), which induces pro-tein synthesis–dependent, caspase-11–mediated apoptosis that is largelyCa2+ independent (30). We found that Stim2−/− neurons were protectedfrom staurosporine (300 nM)-induced cell death compared to wild-typeneurons (Fig. 4C), whereas TPEN (2 mM) induced apoptosis in wild-type and Stim2−/− neurons to the same extent (Fig. 4D).

We also monitored neuronal death under ischemia-like conditionsin mouse hemi-brain slices (Fig. 4, E and F). After 6 hours, slices fromwild-type mice kept under control conditions (normoglycemia, O2, pH7.25) showed 16.0 ± 1.7 dead neurons per square millimeter, whereas,in consecutive slices maintained under ischemic conditions, this num-ber was increased (hypoglycemia, N2, pH 6.4; 30 ± 0.9; n = 3, P <0.01). Compared to that in wild-type mice, fewer dead neurons werefound in slices from Stim2−/− mice under both control (7.7 ± 5.7, n = 3,P < 0.05) and ischemic conditions (18.6 ± 0. 4, n = 3, P < 0.05; Fig. 4,E and F).

Stim2−/− mice are protected from ischemic strokeTo determine the in vivo relevance of the above findings, we studied thedevelopment of neuronal damage in Stim2−/− mice in response to 1-hourocclusion of the middle cerebral artery (MCA), a model of transient focal

Fig. 3. STIM2 regulates Ca2+ homeostasis in cortical neurons. (A) Neu-ronal cultures [5 to 9 days in vitro (DIV 5 to 9)] were loaded with fura-2and averaged [Ca2+]i responses in Stim2−/− neurons were compared tothose in wild-type (WT) cells, in Stim1−/− compared to Stim1+/+ cells, andin Orai1−/− compared to Orai1+/+ cells (n = 5 to 7 experiments per group,each representing the average signal from 20 to 35 cells). Cells werestimulated with CPA (20 mM) followed by replacement of 1 mM EGTAwith 2 mM Ca2+. Basal and peak [Ca2+]i were determined during thetime intervals indicated. Store-operated [Ca2+]i increases (D[Ca2+]i)were calculated by subtracting basal [Ca2+]i from peak [Ca2+]i. (B)Ca2+ release from intracellular stores was elicited by the addition of 5

mM ionomycin in the presence of EGTA. This Ca2+ release was normal-ized to the maximum response observed after replacement of 1 mMEGTA with 2 mM Ca2+. (C) Effect of combined OGD on [Ca2+]i. Culturedneurons (DIV 12 to 14) were exposed for 1 hour (WT) or 2 hours (Stim2−/−)to a glucose-free bath solution continuously bubbled with N2. The slight[Ca2+]i increase after about 70 min in the Stim2−/− neurons occurred onlyin this particular experiment. (D) Chemical anoxia was induced in Stim2−/−

or WT cells by CCCP (2 mM, 30 min). Recovery from increased [Ca2+]iwas determined after washout of CCCP for 60 min. All bars representmeans of five to seven experiments. Error bars indicate SEM. *P < 0.05,two-tailed Mann-Whitney U test.

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 4

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

cerebral ischemia (31). Twenty-four hours after MCA occlusion, infarctvolumes in Stim2−/− mice were <40% the size of those in wild-typemice, as assessed by 2,3,5-triphenyltetrazolium chloride (TTC) staining(18.6 ± 5.5 versus 57.9 ± 13.1 mm3, P < 0.01) (Fig. 5, A and B). The dif-ference in infarct size was functionally relevant; the Bederson score as-sessing global neurological function was significantly better in Stim2−/−

mice than in controls (1.6 ± 0.8 versus 3.0 ± 1.0, respectively; P < 0.05),as was the grip test, which measures motor function and coordination(2.0 ± 1.3 versus 4.1 ± 0.9, respectively; P < 0.05) (Fig. 5, C and D).

ww

Serial magnetic resonance imaging (MRI) on living mice up to day 5after MCA occlusion showed that infarct volume did not increase overtime in Stim2−/− mice, indicating a sustained protective effect (fig. S4).Consistent with this, histological analysis revealed infarcts restricted tothe basal ganglia in Stim2−/− mice, but extending into the neocortex inwild-type mice (Fig. 5E). Wild-type mice reconstituted with Stim2−/−

bone marrow developed infarcts like those of control wild-type mice,whereas infarcts were small in Stim2−/− mice transplanted with wild-typebone marrow (Fig. 5, A to D). Thus, STIM2 deficiency protects mice

Fig. 4. Lack of STIM2 is neuroprotective under ischemic conditions in hours to induce mainly Ca2+-independent cell death. (E) Representative

vitro and ex vivo. (A) Representative images of apoptotic (caspase-3positive, Casp3, red) cultured hippocampal neurons (MAP2a/b, green)from wild-type and Stim2−/− mice under control (0 hours, O2) conditionsand after in vitro ischemia (6 hours, N2). Scale bar represents 50 mm. (B)Bar graph representation of dead neurons (%) under the different exper-imental conditions. (C) Bar graph representation of dead WT and Stim2−/−

neurons (%) under the different experimental conditions. Staurosporine(Stauro.; 300 nM) was used to induce an alternative Ca2+-dependent celldeath pathway. (D) TPEN (2 mM) was added to neuronal cell cultures for 10

images of caspase-3 (Casp3, red)–positive hippocampal neurons (neuron-specific antigen-positive cells, NeuN, green) in brain slices under is-chemic and control conditions. DAPI counterstaining (DAPI, blue). Whitearrows indicate Casp3-positive neurons. Scale bars represent 10 (left) or100 mm (right). (F) Bar graph representation of neuronal cell death (deadneurons per square millimeter) under control (6 hours, O2 black columns)and ischemic conditions (6 hours, N2, gray columns) in Stim2−/− mice andcontrol littermates. The results are presented as mean ± SD. *P < 0.05,**P < 0.01, ***P < 0.001, modified Student’s t test.

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 5

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

from ischemic neuronal damage independently of functional alterationswithin the hematopoietic system.

DISCUSSION

Our data show that STIM2 regulates CCE in neurons and that its ab-sence from these cells leads to altered Ca2+ homeostasis. These datademonstrate that CCE, which is a well-established phenomenon in var-ious cell types, is of (patho)physiological significance in cerebral neu-rons. The central role of STIM2 in this process was unanticipated giventhe essential role of STIM1 in CCE in the other cell types studied thus far(14–16). It is not clear why neurons should use STIM2 rather than STIM1to regulate CCE, but differences between individual cell types in overallCa2+ homeostasis may provide a possible explanation. Refilling of de-pleted intracellular Ca2+ stores, widely accepted as the foremost actionof CCE in nonexcitable cells (9), may not be its main function in neuronswhere the continuous Ca2+ load associated with regular neuronal activity(32) should provide a sufficient supply of Ca2+. Furthermore, localizeddendritic Ca2+ release events occurring during synaptic activity (33) arerapidly compensated for by shuttling of Ca2+ within the large continuousER that extends to all parts of the neurons (3). However, the relative con-

ww

tribution of Ca2+ release from intracellular stores and Ca2+ entry to result-ing Ca2+ signals may differ in functionally distinct neurons and maydepend on the extent of synaptic activity. It is also conceivable that syn-aptic transmission produces a moderate but persistent deficit in ER [Ca2+]because of release through ER inositol 1,4,5-trisphosphate (IP3) receptorand ryanodine receptor (RyR) channels. Whereas primary Ca2+ signals inhematopoietic (and other nonexcitable) cells involve brief but massive Ca2+

release and require rapid refilling of depleted intracellular stores, a moresustainable but lower-amplitude CCE may be needed in neurons. The ap-parently lower Ca2+ sensitivity of STIM2 compared with that of STIM1leads to the activation of STIM2 at a higher ER Ca2+ concentration, so thatit is partially activated under basal conditions (19). Consequently, a re-duced fraction of nonactivated STIM2 is available for mediating SOCchannel activation, limiting the CCE signal. STIM1 and STIM2 havehigh sequence similarity (>65%) and an analogous structure, includingthe composition of the ER luminal Ca2+-sensing domain responsible forSTIM oligomerization and activation of ORAI channels (34, 35). How-ever, the STIM2 oligomerization rate is markedly slower than that ofSTIM1 (36) because of the stably folded state of the Ca2+-sensing do-main in STIM2 but not in STIM1 (37). The distinct oligomerization ki-netics of the two STIM isoforms suggest that STIM2 elicits persistent CCE

Fig. 5. Stim2−/− mice are protected from neuronal damage after cerebralischemia. (A to D) Wild-type and Stim2−/− mice were subjected to tMCAOand analyzed after 24 hours. Experiments were also performed with wild-type mice transplanted with Stim2−/− bone marrow (Stim2+/+BM−/−) andStim2−/− mice transplanted with wild-type bone marrow (Stim2−/−BM+/+).(A) Representative TTC stains of three corresponding coronal brain sec-tions of the groups. Infarcted areas are indicated by arrows. (B) Braininfarct volumes as measured by planimetry at day 1 after tMCAO (n =

8 to 10 per group). (C) Neurological Bederson score and (D) grip test asassessed at day 1 after tMCAO. Graphs plot mean ± SD (n = 8 to 10 miceper group). (B to D) *P < 0.05, **P < 0.01, Bonferroni one-way ANOVA testedagainst wild-type mice. (E) Hematoxylin and eosin–stained sections inthe ischemic hemispheres of wild-type (WT) and Stim2−/− mice. Infarcts(white area) are restricted to the basal ganglia in Stim2−/− mice, butconsistently include the neocortex in the wild-type mice (10 of 10). Scalebars, 300 mm.

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 6

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

activation along with a small amplitude of Ca2+ entry, whereas STIM1delivers a rapid, large-magnitude CCE signal.

The physiological roles of neuronal CCE may encompass unex-pected functions, such as neurotransmitter release and synaptic plastic-ity (38). Indeed, we found impaired spatial learning in Stim2−/− micesimilar to that observed after blockade of NMDA-type ionotropic glu-tamate receptors (39). Further studies are required to draw a full pictureof (i) the physiological role of STIM2 in neurons, (ii) the molecularpartners with which STIM2 interacts (for instance, ORAI or TRP chan-nels or both) (9, 20), (iii) the neuronal activity that stimulates CCE (forinstance, burst firing or high-frequency discharges of excitatory in-puts), and (iv) whether STIM2 deficiency affects synaptic transmissionand plasticity.

Our study assigns a pathophysiological role to CCE in Ca2+-dependentcell death, a process that evolves from or into glutamate-mediated neuro-toxicity (6). Anoxia not only reduces SERCA activity in neurons (25, 27),but also appears to involve active Ca2+ release from IP3 receptor and RyRchannels, as indicated by the ability of IP3 receptor or RyR blockade toprotect neurons from excitotoxic injury (40, 41). Together, the reduction inSERCA activity combined with active Ca2+ release from the ER lead toCa2+ accumulation in the cytosol and a corresponding store depletion,the latter eliciting an additional cytoplasmic Ca2+ load through CCE.In turn, CCE may trigger further Ca2+ influx by increasing the releaseof glutamate and the subsequent activation of ionotropic glutamate re-ceptors (6). The combination of CCE and glutamatergic Ca2+ entry maythen rapidly push cytosolic Ca2+ to dangerous concentrations. Neuronsdevoid of STIM2 may survive ischemic conditions better than wild-typeneurons because they do not undergo CCE. Moreover, because Ca2+ storesrely on functional CCE (9), neurons lacking STIM2 can be expected, asan additional benefit, to have a lower store content. Decreased store con-tent will limit the initial phase of Ca2+ release (see Fig. 3B) and enablethe better utilization of the remaining Ca2+ sequestration capacity duringan ischemic challenge.

In conclusion, our data establish STIM2 as a mediator of neuronalCCE and show that this pathway plays a critical role in hypoxia-inducedneuronal death. Our findings may thus serve as a basis for the develop-ment of novel neuroprotective agents for the treatment of ischemic strokeand possibly other neurodegenerative disorders in which disturbances incellular Ca2+ homeostasis constitute a major pathophysiological compo-nent (4, 5).

MATERIALS AND METHODS

MiceExperiments were conducted in accordance with the regulations of the localauthorities (Regierung von Unterfranken) and were approved by the insti-tutional review boards of all participating institutions. The STIM2knockout mouse was generated by deletion of most of exons 4 to 7 ofthe Stim2 gene by standard molecular techniques. Briefly, two genomicDNA clones encoding the mouse Stim2 gene (RPCI22-446E8; RPCI22-394I22) were isolated from a 129Sv BAC library (Chori) with a probespecific for mouse Stim2 exon 4 isolated by PCR. The targeting constructwas designed to delete most of exons 4 to 7. Stim2 was targeted by homol-ogous recombination in R1 embryonic stem (ES) cells derived from the129Sv mouse strain. Targeted stem cell clones were screened by Southernblot with a gene-specific external probe. Stim2+/− ES cells were injectedinto a C57BL/6 blastocyst to generate chimeric mice. Chimeric mice werebackcrossed with C57BL/6 (Harlan Laboratories) and subsequent progenywere intercrossed to obtain Stim2−/− mice. Genotypes were determined by

ww

PCR analysis with the following primer pairs: Stim2 wild-type 5′, CCCA-TATGTAGATGTGTTCAG; Stim2 wild-type 3′, GAGTGTTGTTC-CCT-TCACAT; Stim2 knockout 5′, TTATCGATGAGCGTGGTGGTTATGC;Stim2 knock-out 3′, GCGCGTACATCGGGCAAATAATATC.

Stim1−/− and Orai1−/− mice were generated as previously described(15, 23).

For the generation of bone marrow chimeras, 5- to 6 week-old Stim2+/+

and Stim2−/− female mice were irradiated with a single dose of 10 Gy,and bone marrow cells from 6-week-old Stim2+/+ or Stim2−/− mice fromthe same litter were injected intravenously into the irradiated mice (4 ×106 cells per mouse).

Western blotsWestern blot was performed with standard protocols on total proteinlysates from different mouse organs extracted with radioimmunoprecip-itation assay buffer. The following primary antibodies were used forWestern analysis: rabbit antibodies against STIM2-CT (1:400, ProSci)and STIM1 (1:500, Cell Signaling) and rat antibody against a-tubulin(1:1000, Chemicon International). All horseradish peroxidase–conjugatedantibodies were purchased from Jackson ImmunoResearch or Dianova.Bound antibodies were detected with enhanced chemiluminescent WesternLightning Plus-ECL (Perkin Elmer).

RT-PCR analysisMouse mRNA from 50 single hippocampal neurons isolated by laser capturemicrodissection was extracted and reverse-transcribed. Stim1 and Stim2mRNA was detected by amplification of the 3′ region (most heteroge-neous region among STIMs) by RT-PCR with specific primers, as follows:Stim1RT 5′, CTTGGCCTGGGATCTCAGAG; Stim1RT 3′, TCAGC-CATTGCCTTCTTGCC; Stim2RT 5′, GCAGGATCTTTAGCCAGAAG;Stim2RT 3′, ACATCTGCTGTCACGGGTGA. Orai primers were as pre-viously described (23).

HistologyParaffin-embedded (Histolab Products AB) paraformaldehyde-fixed or-gans were cut into 5-mm-thick sections and mounted. After removal ofparaffin, tissues were stained with hematoxylin and eosin (Sigma) or withthe Nissl staining method according to standard protocols.

ImmunocytochemistryHippocampal cell cultures were fixed with 4% paraformaldehyde (Merck,Germany), washed three times with 10 mM phosphate-buffered saline(PBS), and incubated for 60 min at 4°C in 10 mM PBS containing 5% goatserum (PAA Laboratories) and 0.3% Triton X-100 (Sigma). Primary anti-bodies (mouse antibody against MAP2a/b, 1:200, Abcam; rabbit antibodyagainst cleaved caspase-3, 1:150, Cell Signaling) were diluted in 10 mM PBSand incubated for 12 hours at 4°C. The membranes were washed with 10 mMPBS and then incubated with secondary antibodies (Alexa 488-labeled goatantibody against mouse immunoglobulin G (IgG), 1:100, BD Bioscience;Cy-3-labeled goat antibody against rabbit IgG, 1:300, Dianova) in the samemanner. Staining with 4,6′-diamidino-2-phenylindole (DAPI, 0.5 mg/ml,Merck) was performed for 7 min. Finally, cultures were washed and thencovered with DABCO (1,4-diazabicyclo-[2,2,2]-octane, Merck). Imageswere obtained by immunofluorescence microscopy (Axiophot; Zeiss).

In one set of experiments, cultured neuronal cells as well as isolatedmurine CD4+ T cells from wild-type mice were placed on coverslips coatedwith poly-L-lysine (Sigma), fixed with 4% paraformaldehyde, and stainedwith antibodies against STIM1 (Cell Signaling) or STIM2 (Cell Signal-ing) antibodies followed by Cy-3–labeled goat antibody against rabbitIgG (Dianova). Cell nuclei were stained with DAPI (Merck).

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 7

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

Neuronal cell culturesNeuronal cultures were obtained from Stim1−/−, Stim2−/−, or control miceat E18 (embryonic day 18) according to previously described protocols(42). In brief, pregnant mice were killed by cervical dislocation andembryos were removed and transferred into warmed Hank’s buffered saltsolution (HBSS). After the preparation of hippocampi, tissue was col-lected in a tube containing 5 ml of 0.25% trypsin in HBSS. After 5 minof incubation at 37°C, the tissue was washed twice with HBSS. There-after, the tissue was dissociated in 1 ml of neuronal medium by trituratingwith fire-polished Pasteur pipettes of decreasing tip diameter. Neuronswere diluted in neuronal medium [10% 10× modified Eagle’s medium(MEM), 0.22% sodium bicarbonate, 1 mM sodium pyruvate, 2 mML-glutamine, 2% B27 supplement (all Gibco); 3.8 mM glucose, 1%penicillin-streptomycin (Biochrom AG)] and plated at a density of60,000 cells/cm2 on poly-D-lysine–coated coverslips in four-well plates(Nunc). Before the experiments, all cell cultures were incubated at37.0°C and 5% CO2 and maintained in culture for up to 5 to 7 days. Cellviability was assessed by propidium iodide (57.14 ng/ml, Merck) stainingand antibody staining for activated caspase-3 (1:200, Cell Signaling). Forischemic conditions, the pH was changed to 6.4, glucose concentrationswere lowered to 5 mM, and O2 was restricted as described for slice prepa-rations. In additional sets of experiments, staurosporine (300 nM) or TPEN(2 mM) (both Sigma) was added to the cell cultures.

For calcium measurements, primary neuronal cultures were obtainedfrom Stim1−/−, Stim2−/−, Orai1−/−, or control mice (E18 to postnatalday 0) as described above except for the following: Tissue was collectedfrom whole cortices and cells were cultured in Neurobasal-A mediumcontaining 2% B27 supplement, 1% GlutaMAX-I, and 1% penicillin-streptomycin (all Gibco). Cells were plated at a density of 50,000cells/cm2 on poly-L-lysine–coated coverslips in 24-well plates (Sarstedt)and were maintained in culture for up to 14 days.

Calcium imagingMeasurements of [Ca2+]i in single cortical neurons were carried out withthe fluorescent indicator fura-2 in combination with a monochromator-based imaging system (T.I.L.L. Photonics) attached to an inverted micro-scope (BX51WI, Olympus). Emitted fluorescence was collected by acharge-coupled device camera. Cells were loaded with 5 mM fura-2-AM(Molecular Probes) supplemented with 0.01% Pluronic F127 for 35 min at20°C to 22°C in a standard bath solution containing (in mM) 140 NaCl,5 KCl, 1 MgCl2, 2 CaCl2, 10 glucose, and 10 Hepes adjusted to pH 7.4with NaOH. For measurements of [Ca2+]i, cells were kept in a standardbath solution and fluorescence was excited at 340 and 380 nm. Fluores-cence intensities from single cells were acquired at intervals of 2 or 20 s.After correction for the individual background fluorescence, the fluores-cence ratio R = F340/F380 was calculated. Quantities for [Ca2+]i werecalculated with the equation [Ca2+]i = KDb(R − Rmin)/(Rmax − R), whereKD = 224 nM, b = 2.64, Rmin = 0.272, and Rmax = 1.987, obtained fromsingle dye-loaded cells in the presence of 5 mM ionomycin added to stan-dard bath solution or to a solution containing 10 mM EGTA instead of2 mM CaCl2. Individual cells in a given culture dish showed variable ki-netics but similar peak amplitudes of the Ca2+ transients. Thus, for the av-erage example traces illustrated in Fig. 3, the peak amplitudes, but not thekinetics, are comparable between dishes or cell types or both. In general,STIM2-mediated CCE signals were comparable to those in T cells and fi-broblasts (14) but substantially smaller than those observed in other celltypes, for example, HeLa cells (19).

For OGD experiments, cells were immediately transferred to a sealed,N2-purged (~2 liters/min) chamber continuously superfused with a N2-bubbled solution containing (in mM) 140 NaCl, 5 KCl, 1 MgCl2, 2 CaCl2,

ww

and 10 Hepes, adjusted to pH 7.4. All experiments were carried out at20° to 22°C. All chemicals were obtained from Sigma.

Brain slice preparationBrain slices including the hippocampus were prepared from 6- to 10-week-old Stim2−/−mice and wild-type littermates as previously described (43). Inbrief, coronal sections were cut on a vibratome (Vibratome, Series 1000Classic) in an ice-chilled solution containing (in mM) 200 sucrose, 20 Pipes,2.5 KCl, 1.25 NaH2PO4, 10 MgSO4, 0.5 CaCl2, and 10 dextrose; pH wasadjusted to 7.35 with NaOH. After preparation, slices were transferred to aholding chamber continuously superfused with a solution containing (inmM) 120 NaCl, 2.5 KCl, 1.25 NaH2PO4, 30 Hepes, 2 MgSO4, 2 CaCl2,and 10 dextrose. pH values were adjusted with HCl. To induce in vitro is-chemic conditions, we reduced the pH from 7.25 to 6.4 and lowered the glu-cose concentration to 5 mM under hypoxic conditions. Restriction of O2 wasachieved by perfusion with an external solution that had been bubbled withnitrogen for at least 60 min before and throughout the recordings (24).

Morris Water MazeThe water maze consisted of a dark gray circular basin (120-cm diameter)filled with water (24° to 26°C, 31 cm deep) that was made opaque bythe addition of nontoxic white tempera paint. A circular platform (8-cmdiameter) was placed 1 cm below the water surface in the center of thegoal quadrant, 30 cm from the wall of the pool. Distant visual cues fornavigation were provided by the laboratory environment; proximal visualcues consisted of four different posters placed on the inside walls of thepool. Animals were transferred from their cages to the pool in an opaquecup and were released from eight symmetrically placed positions on thepool perimeter in a predetermined but not sequential order. Mice wereallowed to swim until they found the platform or until 180 s had elapsed.In the latter case, animals were guided to the platform and allowed to restfor 20 s. The animals were submitted to six trials per day for 5 days, usinga hidden platform at a fixed position (southeast) during the first 3 days(18 trials, acquisition phase) and in the opposite quadrant (northwest) forthe last 2 days (12 trials, reversal phase). Trials 19 and 20 were defined asprobe trials to analyze the precision of the spatial learning.

Elevated Plus Maze testThe animals were placed in the center of a maze with four arms arrangedin the shape of a plus. Specifically, the maze consisted of a central quad-rangle (5 × 5 cm), two opposing open arms (30 cm long, 5 cm wide), andtwo opposing closed arms of the same size but equipped with 15-cm highwalls at their sides and the far end. The device was made of opaque grayplastic and was elevated 70 cm above the floor. The light intensity at thecenter quadrangle was 70 lux, in the open arms 80 lux, and in the closedarms 40 lux.

At the beginning of each trial, the animals were placed on the centralquadrangle facing an open arm. The movements of the animals during a5-min test period were tracked by a video camera positioned above thecenter of the maze and recorded with the software VideoMot2 (TSE Sys-tems). After the test this software was used to evaluate the animal tracksand to determine the number of their entries into the open arms, the timespent on the open arms, and the total distance traveled in the open andclosed arms during the test session. Entry into an arm was defined as theinstance when the mouse placed its four paws on that arm.

Transient MCA occlusion modelExperiments were conducted on 10- to 12-week-old Stim2−/− or controlchimeras according to published recommendations for research inmechanism-driven basic stroke studies (44). Transient MCA occlusion

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 8

R E S E A R C H A R T I C L E

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

(tMCAO) was induced under inhalation anesthesia with the intra-luminal filament (6021PK10; Doccol Company) technique. After 60min, the filament was withdrawn to allow reperfusion. For measure-ments of ischemic brain volume, animals were killed 24 hours afterinduction of tMCAO and brain sections were stained with 2% TTC(Sigma). Brain infarct volumes were calculated and corrected for edemaas previously described (45). Neurological function and motor functionwere assessed by two independent and blinded investigators 24 hoursafter tMACO as described (45).

Stroke assessment by MRIMRI was performed repeatedly at 24 hours and 5 days after stroke on a1.5-T MR unit (Vision Siemens) as described (45). For all measurements,a custom-made dual-channel surface coil designed for examination ofmice heads was used (A063HACG; Rapid Biomedical). The imageprotocol comprised a coronal T2-w sequence (slice thickness, 2 mm)and a coronal three-dimensional T2-w gradient echo CISS (constructedinterference in steady state; slice thickness, 1 mm) sequence. MR imageswere visually assessed blinded to the experimental group with respect toinfarct morphology and the occurrence of intracranial hemorrhage.

Statistical analysisThe statistical methods used are given in the figure legends.

SUPPLEMENTARY MATERIALSwww.sciencesignaling.org/cgi/content/full/2/93/ra67/DC1Fig. S1. Characterization of Stim2−/− mice.Fig. S2. Brain structure of Stim2−/− mice.Fig. S3. Stim2−/− neurons are protected from hypoxia-induced apoptosis.Fig. S4. Sustained neuroprotection after tMCAO in Stim2−/− mice.

REFERENCES AND NOTES1. M. J. Berridge, M. D. Bootman, H. L. Roderick, Calcium signalling: Dynamics, ho-

meostasis and remodelling. Nat. Rev. Mol. Cell Biol. 4, 517–529 (2003).2. P. Lipton, Ischemic cell death in brain neurons. Physiol. Rev. 79, 1431–1568

(1999).3. M. J. Berridge, Neuronal calcium signaling. Neuron 21, 13–26 (1998).4. U. Wojda, E. Salinska, J. Kuznicki, Calcium ions in neuronal degeneration. IUBMB

Life 60, 575–590 (2008).5. M. P. Mattson, Calcium and neurodegeneration. Aging Cell 6, 337–350 (2007).6. M. Arundine, M. Tymianski, Molecular mechanisms of glutamate-dependent neurode-

generation in ischemia and traumatic brain injury. Cell. Mol. Life Sci. 61, 657–668(2004).

7. N. Burnashev, A. Rozov, Presynaptic Ca2+ dynamics, Ca2+ buffers and synaptic ef-ficacy. Cell Calcium 37, 489–495 (2005).

8. V. R. Rao, S. Finkbeiner, NMDA and AMPA receptors: Old channels, new tricks.Trends Neurosci. 30, 284–291 (2007).

9. A. B. Parekh, J. W. Putney Jr., Store-operated calcium channels. Physiol. Rev. 85,757–810 (2005).

10. J. W. Putney Jr., Capacitative calcium entry in the nervous system. Cell Calcium 34,339–344 (2003).

11. P. Várnai, L. Hunyady, T. Balla, STIM and Orai: The long-awaited constituents ofstore-operated calcium entry. Trends Pharmacol. Sci. 30, 118–128 (2009).

12. J. Liou, M. L. Kim, W. D. Heo, J. T. Jones, J. W. Myers, J. E. Ferrell Jr., T. Meyer, STIM isa Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr. Biol. 15,1235–1241 (2005).

13. S. L. Zhang, Y. Yu, J. Roos, J. A. Kozak, T. J. Deerinck, M. H. Ellisman, K. A. Stauderman,M. D. Cahalan, STIM1 is a Ca2+ sensor that activates CRAC channels and migrates fromthe Ca2+ store to the plasma membrane. Nature 437, 902–905 (2005).

14. M. Oh-Hora, M. Yamashita, P. G. Hogan, S. Sharma, E. Lamperti, W. Chung, M. Prakriya,S. Feske, A. Rao, Dual functions for the endoplasmic reticulum calcium sensors STIM1and STIM2 in T cell activation and tolerance. Nat. Immunol. 9, 432–443 (2008).

15. D. Varga-Szabo, A. Braun, C. Kleinschnitz, M. Bender, I. Pleines, M. Pham, T. Renne,G. Stoll, B. Nieswandt, The calcium sensor STIM1 is an essential mediator of arterialthrombosis and ischemic brain infarction. J. Exp. Med. 205, 1583–1591 (2008).

16. J. Stiber, A. Hawkins, Z. S. Zhang, S. Wang, J. Burch, V. Graham, C. C. Ward, M. Seth,E. Finch, N. Malouf, R. S. Williams, J. P. Eu, P. Rosenberg, STIM1 signalling controls

ww

store-operated calcium entry required for development and contractile function in skel-etal muscle. Nat. Cell Biol. 10, 688–697 (2008).

17. S. Feske, Y. Gwack, M. Prakriya, S. Srikanth, S. H. Puppel, B. Tanasa, P. G. Hogan,R. S. Lewis, M. Daly, A. Rao, A mutation in Orai1 causes immune deficiency by ab-rogating CRAC channel function. Nature 441, 179–185 (2006).

18. M. Vig, C. Peinelt, A. Beck, D. L. Koomoa, D. Rabah, M. Koblan-Huberson, S. Kraft,H. Turner, A. Fleig, R. Penner, J. P. Kinet, CRACM1 is a plasma membrane proteinessential for store-operated Ca2+ entry. Science 312, 1220–1223 (2006).

19. O. Brandman, J. Liou, W. S. Park, T. Meyer, STIM2 is a feedback regulator that sta-bilizes basal cytosolic and endoplasmic reticulum Ca2+ levels. Cell 131, 1327–1339(2007).

20. S. Parvez, A. Beck, C. Peinelt, J. Soboloff, A. Lis, M. Monteilh-Zoller, D. L. Gill, A. Fleig,R. Penner, STIM2 protein mediates distinct store-dependent and store-independentmodes of CRAC channel activation. FASEB J. 22, 752–761 (2008).

21. R. T. Williams, S. S. Manji, N. J. Parker, M. S. Hancock, L. Van Stekelenburg, J. P. Eid,P. V. Senior, J. S. Kazenwadel, T. Shandala, R. Saint, P. J. Smith, M. A. Dziadek, Iden-tification and characterization of the STIM (stromal interaction molecule) gene fam-ily: Coding for a novel class of transmembrane proteins. Biochem. J. 357, 673–685(2001).

22. R. Morris, Developments of a water-maze procedure for studying spatial learning inthe rat. J. Neurosci. Methods 11, 47–60 (1984).

23. A. Braun, D. Varga-Szabo, C. Kleinschnitz, I. Pleines, M. Bender, M. Austinat, M. Bosl,G. Stoll, B. Nieswandt, Orai1 (CRACM1) is the platelet SOC channel and essential forpathological thrombus formation. Blood 113, 2056–2063 (2009).

24. L. D. Plant, P. J. Kemp, C. Peers, Z. Henderson, H. A. Pearson, Hypoxic depolarizationof cerebellar granule neurons by specific inhibition of TASK-1. Stroke 33, 2324–2328(2002).

25. M. P. Goldberg, D. W. Choi, Combined oxygen and glucose deprivation in cortical cellculture: Calcium-dependent and calcium-independent mechanisms of neuronal injury.J. Neurosci. 13, 3510–3524 (1993).

26. M. Aarts, K. Iihara, W. L. Wei, Z. G. Xiong, M. Arundine, W. Cerwinski, J. F. MacDonald,M. Tymianski, A key role for TRPM7 channels in anoxic neuronal death. Cell 115,863–877 (2003).

27. M. Henrich, K. J. Buckler, Effects of anoxia and aglycemia on cytosolic calcium reg-ulation in rat sensory neurons. J. Neurophysiol. 100, 456–473 (2008).

28. H. J. Kim, K. A. Martemyanov, S. A. Thayer, Human immunodeficiency virus protein Tatinduces synapse loss via a reversible process that is distinct from cell death. J. Neurosci.28, 12604–12613 (2008).

29. D. Jantas, M. Szymanska, B. Budziszewska, W. Lason, An involvement of BDNF andPI3-K/Akt in the anti-apoptotic effect of memantine on staurosporine-evoked celldeath in primary cortical neurons. Apoptosis 14, 900–912 (2009).

30. J. M. Lee, Y. J. Kim, H. Ra, S. J. Kang, S. Han, J. Y. Koh, Y. H. Kim, The involvementof caspase-11 in TPEN-induced apoptosis. FEBS Lett. 582, 1871–1876 (2008).

31. T. F. Choudhri, B. L. Hoh, H. G. Zerwes, C. J. Prestigiacomo, S. C. Kim, E. S. Connolly Jr.,G. Kottirsch, D. J. Pinsky, Reduced microvascular thrombosis and improved outcomein acute murine stroke by inhibiting GP IIb/IIIa receptor-mediated platelet aggregation.J. Clin. Invest. 102, 1301–1310 (1998).

32. F. Helmchen, K. Imoto, B. Sakmann, Ca2+ buffering and action potential-evoked Ca2+

signaling in dendrites of pyramidal neurons. Biophys. J. 70, 1069–1081 (1996).33. H. Takechi, J. Eilers, A. Konnerth, A new class of synaptic response involving calcium

release in dendritic spines. Nature 396, 757–760 (1998).34. P. B. Stathopulos, L. Zheng, G. Y. Li, M. J. Plevin, M. Ikura, Structural and mecha-

nistic insights into STIM1-mediated initiation of store-operated calcium entry. Cell 135,110–122 (2008).

35. X. Deng, Y. Wang, Y. Zhou, J. Soboloff, D. L. Gill, STIM and Orai: Dynamic intermem-brane coupling to control cellular calcium signals. J. Biol. Chem. 284, 22501–22505(2009).

36. P. B. Stathopulos, L. Zheng, M. Ikura, Stromal interaction molecule (STIM) 1 andSTIM2 calcium sensing regions exhibit distinct unfolding and oligomerization kinetics.J. Biol. Chem. 284, 728–732 (2009).

37. L. Zheng, P. B. Stathopulos, G. Y. Li, M. Ikura, Biophysical characterization of the EF-hand and SAM domain containing Ca2+ sensory region of STIM1 and STIM2. Biochem.Biophys. Res. Commun. 369, 240–246 (2008).

38. N. J. Emptage, C. A. Reid, A. Fine, Calcium stores in hippocampal synaptic boutonsmediate short-term plasticity, store-operated Ca2+ entry, and spontaneous transmitterrelease. Neuron 29, 197–208 (2001).

39. R. G. Morris, E. Anderson, G. S. Lynch, M. Baudry, Selective impairment of learningand blockade of long-term potentiation by an N-methyl-D-aspartate receptor antago-nist, AP5. Nature 319, 774–776 (1986).

40. A. Frandsen, A. Schousboe, Dantrolene prevents glutamate cytotoxicity and Ca2+ re-lease from intracellular stores in cultured cerebral cortical neurons. J. Neurochem. 56,1075–1078 (1991).

41. M. P. Mattson, H. Zhu, J. Yu, M. S. Kindy, Presenilin-1 mutation increases neuronalvulnerability to focal ischemia in vivo and to hypoxia and glucose deprivation in cell

w.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 9

R E S E A R C H A R T I C L E

culture: Involvement of perturbed calcium homeostasis. J. Neurosci. 20, 1358–1364(2000).

42. S. G. Meuth, O. J. Simon, A. Grimm, N. Melzer, A. M. Herrmann, P. Spitzer, P. Landgraf,H. Wiendl, CNS inflammation and neuronal degeneration is aggravated by impairedCD200-CD200R-mediated macrophage silencing. J. Neuroimmunol. 194, 62–69(2008).

43. S. G. Meuth, T. Budde, T. Kanyshkova, T. Broicher, T. Munsch, H. C. Pape, Contri-bution of TWIK-related acid-sensitive K+ channel 1 (TASK1) and TASK3 channels tothe control of activity modes in thalamocortical neurons. J. Neurosci. 23, 6460–6469(2003).

44. U. Dirnagl, Bench to bedside: The quest for quality in experimental stroke research.J. Cereb. Blood Flow Metab. 26, 1465–1478 (2006).

45. C. Kleinschnitz, M. Pozgajova, M. Pham, M. Bendszus, B. Nieswandt, G. Stoll, Tar-geting platelets in acute experimental stroke: Impact of glycoprotein Ib, VI, and IIb/IIIablockade on infarct size, functional outcome, and intracranial bleeding. Circulation115, 2323–2330 (2007).

www

46. We thank M. Heckmann for helpful suggestions and critical discussion of the project.We are grateful to M. Boesl for performing the blastocyst microinjection. This workwas supported by the Deutsche Forschungsgemeinschaft (DFG Ni556/7-1 and SFB688 TPA1, B1 to B.N. and G.S.) and the Rudolf Virchow Center. D.S. was supportedby a grant from the German Excellence Initiative to the Graduate School of LifeSciences, University of Würzburg.

Submitted 9 July 2009Accepted 1 October 2009Final Publication 20 October 200910.1126/scisignal.2000522Citation: A. Berna-Erro, A. Braun, R. Kraft, C. Kleinschnitz, M. K. Schuhmann, D. Stegner,T. Wultsch, J. Eilers, S. G. Meuth, G. Stoll, B. Nieswandt, STIM2 regulates capacitive Ca2+

entry in neurons and plays a key role in hypoxic neuronal cell death. Sci. Signal. 2, ra67(2009).

.SCIENCESIGNALING.org 20 October 2009 Vol 2 Issue 93 ra67 10

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from

Cell Death Entry in Neurons and Plays a Key Role in Hypoxic Neuronal2+STIM2 Regulates Capacitive Ca

Wultsch, Jens Eilers, Sven G. Meuth, Guido Stoll and Bernhard NieswandtAlejandro Berna-Erro, Attila Braun, Robert Kraft, Christoph Kleinschnitz, Michael K. Schuhmann, David Stegner, Thomas

DOI: 10.1126/scisignal.2000522 (93), ra67.2Sci. Signal. 

ischemia.Thus, the authors conclude that STIM2 is critical to neuronal CCE and that CCE plays a role in neuronal death in moreover, mice lacking STIM2 showed less neurological damage than did wild-type mice in a model of ischemic stroke.closely related molecule STIM2. Neurons from mice lacking STIM2 were resistant to the effects of hypoxia in vitro;

. found that CCE depended instead on theet alin mediating CCE in various cell types; in neurons, however, Berna-Erro ischemia-induced calcium entry and neuronal death. The calcium-sensing molecule STIM1 is known to play a crucial role

in(CCE), a process in which depletion of calcium from intracellular stores triggers its entry across the plasma membrane, . investigated the role of capacitive calcium entryet alinvolves a pathological increase in intracellular calcium. Berna-Erro

leads to the death of neurons, a process that−−as can occur during a stroke−−Loss of blood flow to the brainResisting Ischemia

ARTICLE TOOLS http://stke.sciencemag.org/content/2/93/ra67

MATERIALSSUPPLEMENTARY http://stke.sciencemag.org/content/suppl/2009/10/19/2.93.ra67.DC1

CONTENTRELATED

http://science.sciencemag.org/content/sci/348/6233/453.fullhttp://stke.sciencemag.org/content/sigtrans/8/359/ra3.fullhttp://stke.sciencemag.org/cgi/content/full/sigtrans;6/267/ra18http://stke.sciencemag.org/content/sigtrans/6/267/pe8.fullhttp://stke.sciencemag.org/content/sigtrans/6/267/ra18.fullhttp://stke.sciencemag.org/content/sigtrans/3/152/ec378.abstracthttp://stke.sciencemag.org/content/sigtrans/3/148/pe42.fullhttp://stke.sciencemag.org/content/sigtrans/3/122/ec149.abstract

REFERENCES

http://stke.sciencemag.org/content/2/93/ra67#BIBLThis article cites 45 articles, 11 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

is a registered trademark of AAAS.Science SignalingYork Avenue NW, Washington, DC 20005. The title (ISSN 1937-9145) is published by the American Association for the Advancement of Science, 1200 NewScience Signaling

Copyright © 2009, American Association for the Advancement of Science

on June 19, 2020http://stke.sciencem

ag.org/D

ownloaded from