ribosomal dna analysis of a harmful algal bloom … · selected for 18s rdna amplification. the...

1

RIBOSOMAL DNA ANALYSIS OF A HARMFUL ALGAL BLOOM (HAB) SPECIES, PYRODINIUM BAHAMENSE VAR. COMPRESSUM

AND ITS ASSOCIATED MARINE MICROBES

Chin, W. L., Teoh P. L., Anton A. and Kumar S. V. Biotechnology Research Institute

Universiti Malaysia Sabah Jalan UMS, 88400 Kota Kinabalu E-mail: [email protected]

ABSTRACT Harmful algal blooms in Sabah occur mostly in the coastal waters of west Sabah, where one of the causative organisms is the toxin-producing dinoflagellate, Pyrodinium bahamense var. compressum. Pyrodinium bahamense var. compressum cells were successfully isolated from four locations, namely, Sepanggar Bay, Gaya Bay, Kinarut and Kota Belud and cultured in f/2 medium. The 18S rDNA sequences of all the Pyrodinium isolates were also obtained (Accession numbers: DQ500119 to DQ500123), and the length size of the sequences ranged from 1,580 to 1,544 bp. Based on the sequence information, a Pyrodinium-specific oligonucleotide primer, CWL1R, was designed. In order to confirm the specificity of this primer, a group of dinoflagellates, namely Cochlodinium polykrikoides, Gymnodinium catenatum, Amphidinium sp., Gambierdiscus sp., Prorocentrum micans, Prorocentrum lima, Ostreopsis sp., Coolia sp., Alexandrium minutum, Alexandrium tamarense, Crypthecodinium cohnii, Gonyaulax cochlea, Lingulodinium polyedra, Peridinium sp. and Pyrocystis lunula were selected for 18S rDNA amplification. The results showed that the oligonucleotide primer could only amplify the rDNA of Pyrodinium. Therefore, the primer CWL1R has a great potential to be developed as a PCR-based DNA probe for the identification of Pyrodinium bahamense var. compressum. Another study to determine the identification of bacteria associated with Pyrodinium based on ribosomal DNA-based restriction enzyme analysis was also conducted. A total of 16 marine bacterial isolates were successfully obtained from the clonal cultures of Pyrodinium. The study revealed that all bacterial isolates were Gram negative except for two isolates, which were Gram positive. Restriction enzyme analysis yielded eight different ribotypes. The 16S rDNA sequences of bacteria associated with Pyrodinium were also obtained (Accession numbers: EF688604 to EF688619). Based on the sequencing results of 16S rDNA, the community of extracellular microbes associated with Pyrodinium were limited to the Phyla Proteobacteria and Actinobacteria. The majority of bacteria were Alcanivorax sp. and Hyphomonas sp., whereas Kocuria sp., Nesterenkonia sp., Alteromonas sp., Roseobacter sp., Xanthomonas sp., and Acinetobacter sp. were identified as minor isolates. These results showed that the dinoflagellate, Pyrodinium bahamense var. compressum co-exists, symbiotically or not, with various bacteria in the natural environment. Keywords: red tides, dinoflagellates, oligonucleotide primer, small subunit ribosomal DNA INTRODUCTION Harmful algae are planktonic algae or phytoplankton. They are microscopic, single-celled plants. These algae serve as energy provider at the base of the marine food web for filter-feeding bivalve shellfish, such as oysters and mussels. Occasionally, multiplication or proliferation of the algae until they reach such high concentrations (up to millions of cells per litre) that the surface of the sea becomes discolored (so called ‘red-tides’). HAB is usually not

2

harmful, but small percentage of the blooms are considered harmful because the algae can produce potent natural poisons known as biotoxins. These biotoxins can be transferred through the food web where they affect and kill higher forms of life such as zooplankton, shellfish, fish, birds, marine mammals and even humans that feeds either directly or indirectly on them. Harmful algal blooms (HABs) in Sabah only occur in the South China Sea and in the coastal waters of the west Sabah. It was first reported in 1976, where the causative organism is the dinoflagellate, Pyrodinium bahamense var. compressum (Anton et al., 2000). The species, Pyrodinium bahamense var. compressum is an armored, bioluminescent dinoflagellate. It is the major species involved in the tropical Indo-Pacific red tides. This HAB species produces saxitoxin, as a by-product, in filter-feeding bivalve shellfish that can cause Paralytic Shellfish Poisoning (PSP) that eventually causes paralyses and deaths in humans. PSP is the syndrome caused by toxins called saxitoxins. Saxitoxins are neurotoxins that act to block movement of sodium through nerve cell membranes, stopping the flow of nerve impulses causing the symptoms of PSP, which then causes symptoms such as, numbness, paralysis, disorientation and also death through respiratory paralysis. There is no antidote for PSP. Malaysia has reported a total of 609 PSP cases and 44 deaths (Azanza et al., 2001). Identification of HAB species in discrete water samples has relied traditionally on microscopy. Although the traditional microscope-based method has been proven reliable, this method is time-consuming and requires technical expertise to recognize the different morphological characters of the HAB species (Scholin & Anderson, 1998). Besides that, some species exists as a variety of strains, or ‘subspecies’, that are not possible to delineate using morphological criterias. Therefore, molecular studies of HAB will be very beneficial in species identification as the morphological features of these species may change or evolve with environmental conditions or life history. Molecular or DNA probes assays provide fast and accurate descriptions of different kinds of HAB species. DNA probes are probes that detect specific DNA sequences that serve as unique identifiers of a species or group of species (Scholin & Anderson, 1998). DNA probes provide fast and accurate descriptions of different kinds of HAB species. Besides that, they also speed up and refine analyses of seawater samples for faster or rapid detection and identification of potential toxic blooms. The nucleotide sequence of a selected micro-alga that makes up its genetic code is compared with that of other related algae. Unique segments (consists of 15 to 50 nucleotides) are selected to develop into probes. In this study, the main focus is to design a DNA probe that is species-specific for the identification of HAB species, P. bahamense var. compressum infesting the coastal waters of West Sabah. In another hand, it is understood that the toxins were secreted by the algae themselves during the bloom. However, in the recent years, bacteria associated with toxic algae have also been implicated as a source of PSP toxins. Bacteria and dinoflagellates have always been important members of the coastal plankton and their metabolism has a major input to energy flow and nutrient cycling through the water column (Alverca et al., 2002). Bacteria can live loosely or tightly with the phytoplankton or even live inside the microalgae cells (Córdova et al., 2003; Töbe, 2003). Hold et al. (2001) showed that certain bacteria are common to general dinoflagellate cultures, whereas others appear to be specifically unique to a particular dinoflagellate. In this study, the identification of bacteria associated with P. bahamense var. compressum, can contribute to future research on bacteria-associated harmful algae by comparing the diversity of bacteria associated with different kind of harmful algae found in the waters of Sabah.

3

OBJECTIVES The research objectives of this study are as follows: (a) To design an oligonucleotide primer that is species-specific for the identification of

Pyrodinium bahamense var. compressum based on the ribosomal DNA sequence, and (b) To identify the bacteria diversity that are extracellularly associated with the toxic algae,

Pyrodinium bahamense var. compressum based on the ribosomal DNA sequence. METHODOLOGY (I) Molecular Characterization and Identification of Pyrodinium bahamense var. compressum

(a) Collection and isolation of algae Pyrodinium cells were collected whenever there were reports of Pyrodinium blooms in the coastal waters of Sabah. A total of five strains of Pyrodinium bahamense var. compressum from four different offshore locations in west Sabah have been successfully isolated and established in culture. The strains were labeled as G1, KBE3, PG, PS and PYRO. The origin of each sample and date of sampling are described in Table 1. Table 1: Pyrodinium samples used in this study, with locations and date of sampling for each samples.

Sample Location Date of Sampling G1 Kinarut January 2004

KBE3 Kota Belud April 2004 PG Gaya Bay September 2003 PS Sepanggar Bay September 2003

PYRO Gaya Bay December 2000 At each sampling site, triplicate seawater samples were collected for laboratory analysis. Plankton net with the mesh size of 20 μm was used to scoop the seawater from the dockside, shore or alongside the boat and transferred in plastic bottles (250 ml). Freshly collected seawater samples were examined under a light microscope and single-cells of Pyrodinium were isolated using drawn-out micropipettes method.

(b) Algal culturing

Pyrodinium cells were cultured in f/2 medium according to the protocol of Guillard & Ryther (1962) and Guillard (1975). The cultures were maintained at culture room with temperature range of 25 to 28 °C, a 12:12 light:dark cycle under cool white fluorescent light (3,800 – 4,500 lux).

(c) DNA extraction After the cultures have reached its mid-exponential growth, the cells were harvested by repeated centrifugation. DNA was then extracted from these cells using a modified CTAB (cetyltrimethylammonium bromide) extraction method reported by Doyle and Doyle (1987). The harvested cell pellet was resuspended in 2 x CTAB buffer containing 100 mM Tris (pH 8.0), 1.4 M NaCl, 20 mM ethyl-enediamine tetra-acetic acid (EDTA), pH 8.0, and 2% CTAB, and was then incubated at 65 °C for one hour. The mixture was extracted twice

4

with chloroform-isoamyl alcohol (24:1). DNA was precipitated by the addition of 0.7 volume of 100 % isopropanol. The DNA was rinsed with 70 % ethanol and dissolved in 25 μl of TE buffer. The DNA extraction sample was kept in –20°C for further usage. Prior PCR, gel electrophoresis on a 1% agarose gel was done to determine the quality and quantity of the DNA samples.

(d) PCR amplification and sequencing determination of P. bahamense var.

compressum The 18S rDNA region was amplified from total DNA using TPL1F (5’- TAAGCCATGCATGTCTCAG-3’) and TPL1R (5’-GGATCACTCAATCGGTAGG-3’). Both primers used were designed based on Pyrodinium bahamense small subunit rRNA gene sequence in the GenBank database. Amplification was carried out in a 50 μl reaction mixture containing 2.5 U ProofStart DNA polymerase, 1 x Proofstart PCR buffer, 1 x Q-solution (Qiagen), 300 μM dNTPs (Promega), 1 μM each primer and 1:25 (v/v) genomic DNA. Thermocycling was as follows: 5 minutes initial activation step at 95 °C, followed by 35 cycles of denaturation at 94 °C for 1 minute, annealing at 55 °C for 1 minute, and extension at 72 °C for 2 minutes, and the final extension at 72 °C for 7 minutes. Amplifications were carried out on a MJ Research PTC-200 Thermal Cycler. The PCR products were analyzed by electrophoresis on a 2% agarose gel. The desired bands were excised and purified by using QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. The purified PCR products (≈20 ng µl-1) were used in a 20-µl PCR reactions using the BigDye terminator v3.1 cycle sequencing kit as suggested by the manufacturer. Sequencing reactions were run on an ABI3130 Genetic Analyzer. The SSU rDNA sequences were determined with the same primers, TPL1F and TPL1R, used to amplify these DNA fragments in the PCR reactions.

(e) Sequence analysis and Pyrodiniumspecific oligonucleotide primer design

Analysis of the 18S rDNA sequences of different isolates of Pyrodinium was conducted using the software Lasergene 6.1 (DNASTAR, Inc., USA). The five partial SSU rDNA sequences were then aligned together with several dinoflagellates’ sequences obtained from NCBI’s GenBank database. The selected sequences were from dinoflagellates that are present in the coastal waters of Sabah, such as Cochlodinium polykrikoides, Prorocentrum micans, Prorocentrum lima, Gymnodinium cateantum, Amphidinium sp., Gambierdiscus sp., Coolia sp., and Ostreopsis sp.. After identifying the locus, a specific oligonucleotide primer for the identification of Pyrodinium bahamense var. compressum was designed using the Primer3 software (Rozen & Skaletsky, 2000).

(f) Specificity study The specific primer was screened for PCR amplification in a collection of pure dinoflagellate cultures available in the laboratory, which includes Amphidinium sp. Cochlodinium polykrikoides, Coolia sp., Gambierdiscus sp., Gymnodinium catenatum, Ostreopsis sp., Prorocentrum lima, Prorocentrum micans, Alexandrium minutum (CCMP113), Alexandrium tamarense (CCMP1493), Crypthecodinium cohnii (CCMP316), Gonyaulax cf. cochlea (CCMP1592), Lingulodinium polyedra (CCMP1738), Peridinium sp. (CCMP626), and Pyrocystis lunula (CCMP731).

After testing the specific oligonucleotide primer on laboratory cultures, the primer was also tested on field samples. Field samples were collected from the coastal waters of west Sabah, where Pyrodinium was previously reported. The oligonucleotide primer was tested against a batch of field samples collected around the month of August and

5

September 2007. Specificity study on both laboratory cultures and field samples was carried out in a 50-µl PCR reaction mixture. PCR cocktails and PCR amplification was conducted according the previous mentioned PCR method, except that the annealing temperature was set at 56 °C.

(II) Molecular characterization and identification of marine microbes associated with Pyrodinium bahamense var. compressum

(a) Bacteria isolation and culturing The cultures were checked for bacterial growth after two weeks from the initial isolation/culturing of Pyrodinium cells were done. Approximately 100 μl of Pyrodinium cultures (≈ 200 cells/ml) were spread on the surface of marine agar media (Difco, USA) and kept in a 37 °C incubator for overnight incubation. Preparation of pure bacteria culture was done based on the streak plate method. The isolated cultures were then used for Gram-staining and then followed by 16S rDNA PCR amplification.

(b) Gram staining

The Gram staining method was used to differentiate bacteria into two major groups, Gram positive bacteria and Gram-negative bacteria. Gram staining was done according to the standard method described by Beveridge & Daview (1983).

(c) DNA preparation and PCR amplification of the 16S rDNA

The bacterial genome DNA was obtained from heat shock method. A single bacterial colony was picked from the pure cultures and mixed with 20 μl of sterile distilled water in a 0.2 ml PCR tube. The mixture was incubated at 100 °C for 10 min in a thermal cycler. After incubation, the PCR tube was centrifuged at maximum speed for 5 min to obtain the supernatant, which contained the bacterial genome DNA. Approximately 1 μl of supernatant was used for each PCR reaction.

PCR was then carried out in a 20 μl reaction mixturecontaining 1.0 U DNA polymerase (Promega, USA), 1 x PCR buffer (Promega, USA), 3.75 mM MgCl2 (Promega, USA), 500 μM dNTPs (Promega, USA), 1.25 μM each primer and 1:20 (v/v) genomic DNA. The PCR primers used for the 16S rDNA amplification of marine bacteria were 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-TACGYTACCTTGTTACGACT-3’). The PCR amplification was performed as follows: 2 min of initial denaturation step at 94 °C, followed by 35 cycles of denaturation at 94 °C for 30 seconds, annealing at 60 °C for 30 seconds, and extension at 72 °C for 1 minute, and the final extension at 72 °C for 2 minutes. The PCR was carried out on a PTC-200 thermal cycler (MJ Research, USA).

The PCR products were then analyzed on a 2 % agarose gel. The desired bands were then excised from the agarose gel and purified using QIAquick Gel Extraction Kit (Qiagen, USA). The purified products were then subjected to direct sequencing and restriction enzyme digestion.

(d) Restriction enzyme digestion of 16S rDNA sequence of bacteria associated with

Pyrodinium The purified PCR products were digested with four restriction enzymes (RE), HaeIII, DpnII, AluI, RsaI, BamHI and XhoI (New England Biolabs, USA). RE analysis was carried out in a 10 µl reaction mixture containing 1 x restriction enzyme buffer, 10 µg/µl BSA, 5.0 U of RE and 5.0 µl (1:2 v/v) of DNA template. A total of 20 μl of mineral oil was added to prevent evaporation of the sample. Restriction fragments were then analyzed on a 1.5 % agarose gel.

(e) Sequencing analysis of the 16S rDNA sequence of Pyro-Bac

6

All purified PCR products were sequenced by a service provider, First Base Laboratory (Selangor). The purified PCR products were sequenced on an ABI Prism 3100 using the BigDye Termination v3.1 kit. The primers used for the sequencing reactions were 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-TACGYTACCTTGTTACGACT-3’).

The 16S rDNA sequences of different isolates of bacteria associated with Pyrodinium was analyzed using the software Lasergene 6.1 (DNASTAR, Inc., USA). The edited and assembled sequences of bacteria associated with Pyrodinium were then identified by searching through rDNA sequences deposited in the GenBank.

RESULTS AND DISCUSSION (I) Molecular Characterization and Identification of Pyrodinium bahamense var. compressum

(a) Algal isolation and culturing Algal isolation was done to ensure that all Pyrodinium cultures were uniagal. The newly collected seawater samples were immediately checked for the presence of Pyrodinium using the drawn-out micropipette method. The freshly collected seawater samples was then transferred into culture media within 24 to 48 hours to avoid cell death due to unsuitable living environment (sampling bottle). Azanza-Corrales and Hall (1993) also reported that Pyrodinium is sensitive to agitation and small changes in temperature while being transported. Therefore, immediate isolation of Pyrodinium was necessary. The media used for culturing the five Pyrodinium isolates was f/2 media (Guillard & Ryther, 1962; Guillard, 1975). No further dilution of the media was done. In contrast, the Philippines representative of Pyrodinium grew very well in f/10 and f/20 media but did not grow well in f/2 and f/4 media (Azanza-Corrales and Hall, 1993). This is maybe due to the different tolerance level of the Pyrodinium cells towards different concentration of nutrients present in the media. Figure 1 is a four-cell chain of Pyrodinium. Figure 1: A four-cell chain of Pyrodinium bahamense var. compressum (100x magnification).

(b) DNA extraction and PCR amplification The CTAB DNA extraction method used in this study was an organic extraction method. Basically, this method uses organic solvents to remove contaminants from cell lysates (Duncan et al., 2003). The Pyrodinium cells were lysed using CTAB buffer. CTAB is a one of the popular choices because CTAB is a cationic detergent that could precipitate genomic DNA and had the ability to remove polysaccharides from both bacterial and plant preparations (Weising et al., 2005).

7

Fresh Pyrodinium cultures (newly sub-cultured) were used for DNA extraction. The best growth phase of algal cultures for DNA extraction was during the exponential phase, where the cells were actively replicating and dead cells has not set in. The quality of DNA is at its highest when purifying genomic DNA from freshly harvested cells (Duncan et al., 2003).

The extracted DNA was then visualised on a 1 % agarose gel (Figure 2). The DNA concentration of the five Pyrodinium isolates was not calculated because based on Figure 2, the DNA bands of the isolates were of high quality and sufficient for PCR amplification. Figure 2: DNA extracted using a modified CTAB DNA extraction method. Lane M: λ DNA / HindIII ladder; Lane 1: sample G1; Lane 2: sample KBE3; Lane 3: sample PG; Lane 4: sample PS; Lane 5: sample PYRO. DNA extracted from the five Pyrodinium isolates was amplified with rDNA primer pair, TPL1F and TPL1R. The primers TPL1F and TPL1R amplified DNA fragments of expected size of about 1.6 kb from cultured cells of Pyrodinium (Figure 3).

Figure 3: Purified PCR products of Pyrodinium of about 1.6 kb in size. Lane M1: 100 bp DNA ladder; Lane 1: sample G1; Lane 2: sample KBE3; Lane 3: sample PG; Lane 4: sample PS; Lane 5: sample PYRO; Lane M2: 1 Kb DNA ladder.

23,130 bp

M 1 2 3 4 5

M1 1 2 3 4 5 M2

1,500 bp ≈1,600 bp

8

(c) DNA sequence and primer design The sequences of the five isolates were obtained and the sizes of sequences for sample G1, KBE3, PG, PS and PYRO were 1,545 bp, 1,580 bp, 1564 bp, 1544 bp and 1576 bp, respectively (GenBank accession nos: DQ500119 to DQ500123). A Pyrodinium-specific primer was then designed after comparing the five obtained sequences with sequences of dinoflagellates that are present in the Sabah coastal waters using the BLAST program. As the designed primer would eventually be tested against sea water samples from the coastal waters of Sabah, it is therefore crucial that the Pyrodinium sequence be compared with sequences of co-occurring dinoflagellates in the sea, rather than of closely related species. A reverse primer CWL1R (5’-CAG CCA CCC TTA GCA GAA-3’) was then designed using the Primer3 software. This priming site (Figure 4) was chosen because it showed the most nucleotide differences with the eight mentioned dinoflagellates. However, no forward primer was designed. The same forward primer, TPL1F (5’- TAA GCC ATG CAT GTC TCA G-3’) used in the PCR amplification was instead used along with the designed primer. The expected amplicon size for both loci were approximately 600 bp.

PYRO AAAAAGCTCGTAGTTGGATTTCTGCTAAGGGTGGCTGGTCCGCCCTCTG KBE3 ................................................. PG ................................................. PS ................................................. G1 ................................................. P. micans .........................CG...AC.ACC........-.... C. polykrikoides .........................CG...ACAA.C............. G. catenatum ........................T.G...AC.ATC............. P. lima ..............C..........CG...AC.ACC............. Amphidinium sp. ........................TC....ACAAT............C. Gambierdiscus sp. ....G............T.C......GGT....TC...........T.. Coolia sp. ................A.......T.G....C..TC............. Ostreopsis sp. G...............A..G.T......T.A..ACC..........T..

Figure 4: Multiple sequence alignment of Pyrodinium rDNA sequence with sequences of other dinoflagellates, indicating the site of the designed reverse primer, CWL1R.

(d) Specificity analysis of the designed oligonucleotide primer, CWL1F, against unialgal cultures and field samples The oligonucleotide primers designed in this study amplified DNA fragments of expected size from cultured cells of Pyrodinium (Figure 5). The primers specific for Pyrodinium bahamense var. compressum did not yield any product with a wide range of unialgal cultures from isolated from the coastal waters of Sabah (Figure 6) as well as those closely related with Pyrodinium, but not found in the Sabah waters (Figure 7). Table 2 showed the list of unialgal cultures used in the specificity test against the designed oligonucleotide primers.

9

Figure 5: PCR products produced using the designed primer CWL1R and TPL1F against the five Pyrodinium isolates resolved on an ethidium bromide-stained 2.0 % agarose gel. Lane M: 100 bp DNA ladder; Lane 1: sample G1; Lane 2: sample KBE3; Lane 3: sample PG; Lane 4: sample PS; Lane 5: sample PYRO; Lane 6: negative control; Lane M: 100 bb DNA ladder.

Figure 6: PCR amplification using the designed primer CWL1R and TPL1F against dinoflagellates found in Sabah waters. Lane M: 100 bp DNA ladder; Lane 1: Pyrodinium; Lane 2: Amphidinium sp.; Lane 3: Cochlodinium polykrikoides; Lane 4: Coolia sp.; Lane 5: Gambierdiscus sp.; Lane 6: Gymnodinium catenatum; Lane 7: Ostreopsis sp.; Lane 8: Prorocentrum lima; Lane 9: Prorocentrum micans; Lane 10: negative control; Lane M: 100 bp DNA ladder. Figure 7: PCR amplification using the oligonucleotide primer against dinoflagellates that are closely related with Pyrodinium. Lane M: 100 bp DNA ladder; Lane 1: Alexandrium minutum; Lane 2: Alexandrium tamarense; Lane 3: Crypthecodinium cohnii; Lane 4: Gonyaulax cf

M 1 2 3 4 5 6 M

600 bp 600 bp

M 1 2 3 4 5 6 7 8 9 10 M

600 bp

M 1 2 3 4 5 6 7 8 9 M

600 bp

10

cochlea; Lane 5: Lingulodinium polyedra; Lane 6: Peridinium sp.; Lane 7: Pyrocystis lunula; Lane 8: positive control (Pyrodinium); Lane 9: negative control Table 2: Algal cultures used in oligonucleotide primer specificity study.

Culture location Species (isolate name) ORDER (Family)

Universiti Malaysia Sabah

Pyrodinium bahamense var. compressum (G1)

GONYAULACALES (Goniodomataceae)

Pyrodinium bahamense var. compressum (KBE3)


Pyrodinium bahamense var. compressum (PG)


Pyrodinium bahamense var. compressum (PS)


Pyrodinium bahamense var. compressum (PYRO)


Amphidinium sp. GYMNODINIALES (Gymnodiniaceae)

Cochlodinium polykrikoides GYMNODINIALES (Gymnodiniaceae)

Coolia sp. GONYAULACALES (Ostreopsidaceae)

Gambierdiscus sp. GONYAULACALES (Goniodomataceae)

Gymnodinium catenatum GYMNODINIALES (Gymnodiniaceae)

Ostreopsis sp. GONYAULACALES (Ostreopsidaceae)

Prorocentrum lima PROROCENTRALES (Prorocentraceae)

Prorocentrum micans PROROCENTRALES

(Prorocentraceae)

CCMP

Alexandrium minutum (CCMP113)


Alexandrium tamarense (CCMP1493)


Crypthecodinium cohnii (CCMP316)

GONYAULACALES (Crypthecodiniaceae)

Gonyaulax cf. cochlea (CCMP1592)

GONYAULACALES (Gonyaulacaeae)

Lingulodinium polyedra (CCMP1738)

GONYAULACALES (Gonyaulacaeae)

Peridinium sp. (CCMP626)

PERIDINIALES (Peridiniaceae)

Pyrocystis lunula (CCMP731) GONYAULACALES (Pyrocystaceae)

For many molecular probe applications, it is very important that a probe could label its targeted organism reproducibly under the organism’s natural environment. There is possibility that a species-specific probe to cross-amplify with something found in the

11

nature but not in a culture collection (Scholin & Anderson, 1998). Thus, the responses of a probe towards the target species in the nature could be determined when there is a probe, a particular geographic location, and also natural populations in those locations. In this study, the target geographical location is Sepanggar Bay, coastal waters of west Sabah, where Pyrodinium bloom has been reported and identified. Each field samples, two bottles of sea water were collected. The details of each field samples are recorded in Table 3. Out of the ten samples, only three field samples contained Pyrodinium cells. In field sample number 4, 7 and 10, the number of Pyrodinium cells observed was 5 cells, 2 cells and 6 cells respectively. Only 3 ml to 5 ml of sea water samples were used for microscopic observation, due to the reason that the remaining sea water samples would be used for DNA extraction. Table 3: The description of each field samples used in this study.

Field Sample

No. Date of

Sampling Location Label Presence of Pyrodinium

1 14 August 2007 Sepanggar Bay FS1, FS2 No

2 29 August 2007 Sepanggar Bay FS3, FS4 No

3 3 September 2007

Sepanggar Bay FS5, FS6 No

4 7 September 2007

Sepanggar Bay FS7, FS8 Yes

5 10 September 2007


6 14 September 2007


7 17 September 2007


8 19 September 2007


9 21 September 2007


10 24 September 2007


Field samples, FS7, FS8, FS13, FS19 and FS20 showed positive results, whereas the remaining field samples showed negative results (Figure 8). These positive results showed similarity with the microscopic observation, where Pyrodinium cells were seen in field samples number 4, 7 and 10, except for FS 14 where no amplification (Figure 8B, lane 16). This is probably due to the low quantity of cells in field sample number 7, where only two Pyrodinium cells were observed. The negative result for FS14 is maybe due to the presence of DNA from other species and the relatively low concentration of the target species, Pyrodinium, in FS14 that were not readily amplified by direct PCR. It could be explained by a failure in the procedure of extracting DNA from that particular sample (Godhe et al., 2001).

12

Figure 8 (A, B): PCR products of field samples (FS1 – FS20) resolved in an ethidium bromide-stained 2.0 % agarose gel. Lane 1: FS1; Lane 2: FS2; Lane 3: FS3; Lane 4: FS4; Lane 5: FS5; Lane 6: FS6; Lane 7: FS7; Lane 8: FS8; Lane 9: FS9; Lane 10: FS10; Lane 11: negative control; Lane 12: Pyrodinium G1 isolate; Lane 13: FS11; Lane 14: FS12; Lane 15: FS13; Lane 16: FS14; Lane 17: FS15; Lane 18: FS16; Lane 19: FS17; Lane 20: FS 18; Lane 21: FS19; Lane 22: FS20; Lane 23: negative control; Lane 24: Pyrodinium G1 isolate; Lane M: 100 bp DNA ladder. The five positive results were subjected to direct sequencing to verify the Pyrodinium bahamense var. compressum PCR amplicon. Direct sequencing of the amplicons was done using the forward primer TPL1F. The sequencing results of FS7, FS8, FS13, FS19 and FS20 are listed in Table 4. All five sequences were then compared with sequences found in the NCBI GenBank database, under the BLASTN program. The BLASTN search results of the five field samples confirmed that the samples were indeed Pyrodinium bahamense var. compressum, with a maximum identify of 99 % to 100 %. The sequencing results of the five field samples (F7, F8, F13, F19 and F20) further confirmed the specificity of the designed primer, CWL1R, where it only amplify the desired target, Pyrodinium bahamense var. compressum, even in its natural habitat. The sequencing results suggested the oligonucleotide primer designed in this study has high specificity and selectivity towards the HAB alga, Pyrodinium bahamense var. compressum. However, given the interdisciplinary nature of field trials, the primer should be evaluated under field conditions for several years before completion (Scholin & Anderson, 1998). In this study, only ten field samples were tested against the primer and one target location was chosen, therefore long-term field studies should be done to really eliminate possibility of interference in the natural samples such as humid acids or salts that could inhibit polymerase activity. Other than that, natural communities of algae also exhibit differential growth phases, as opposed to unialgal cultures, which could further affect the PCR reaction (Godhe et al., 2001).

1 2 3 4 5 6 7 8 9 10 11 12 M

600 bp

A

13 14 15 16 17 18 19 20 21 22 23 24 M

600 bp

B

13

Table 4: Partial sequences of ribosomal DNA of field samples FS7, FS8, FS13, FS19 and FS20.

Field Samples Sequences (5’ – 3’)

FS7

GCTCATTAAAACAGTTATAATTTATTTGGTGGTCATTCTCTACATGGATAACTGTGGTAATTCTATAGCTAATACATGCTTACCAACCCAACTTCATGGAAGGGTTGTGGTTATTAGTTACAGAACCAACCCAAGCTTTGCTTGGTCTTGCGGTGATTCATGATGACTGAATGAATTGCATGGCATTGCTGGCGATATATCATTCAAGTTTCTGACCTATCAGCTTCCGACGGTAGGGTATTGGCTTACCGTGGCAATGACGGGTAACGGAGGATTAGGGTTTGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACTGGGAGGTAGTGACAAGAAATAACAATACAGGGCATCCATGTCTTGTAATTGGAATGAATGGAAATTAAACCTCTTTGTAAGTATCGATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGGATTTCTGCTAAGGGTGGCTGA

FS8

TCATTAAAACAGTTATAATTTATTTGGTGGTCATTCTCTACATGGATAACTGTGGTAATTCTATAGCTAATACATGCTTACCAACCCAACTTCATGGAAGGGTTGTGGTTATTAGTTACAGAACCAACCCAAGCTTTGCTTGGTCTTGCGGTGATTCATGATGACTGAATGAATTGCATGGCATTGCTGGCGATATATCATTCAAGTTTCTGACCTATCAGCTTCCGACGGTAGGGTATTGGCTTACCGTGGCAATGACGGGTAACGGAGGATTAGGGTTTGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACTGGGAGGTAGTGACAAGAAATAACAATACAGGGCATCCATGTCTTGTAATTGGAATGAATGGAAATTAAACCTCTTTGTAAGTATCGATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGGATTTCTGCTAGGG

FS13

CAGTTATAATTTATTTGGTGGTCATTCTCTACATGGATAACTGTGGTAATTCTATAGCTAATACATGCTTACCAACCCAACTTCATGGAAGGGTTGTGGTTATTAGTTACAGAACCAACCCAAGCTTTGCTTGGTCTTGCGGTGATTCATGATGACTGAATGAATTGCATGGCATTGCTGGCGATATATCATTCAAGTTTCTGACCTATCAGCTTCCGACGGTAGGGTATTGGCTTACCGTGGCAATGACGGGTAACGGAGGATTAGGGTTTGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACTGGGAGGTAGTGACAAGAAATAACAATACAGGGCATCCATGTCTTGTAATTGGAATGAATGGAAATTAAACCTCTTTGTAAGTATCGATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGGATTTCTGCTAGGGG

FS19

CTCATTAAACAGTTATAATTTATTTGGTGGTCATTCTCTACATGGATAACTGTGGTAATTCTATAGCTAATACATGCTTACCAACCCAACTTCATGGAAGGGTTGTGGTTATTAGTTACAGAACCAACCCAAGCTTTGCTTGGTCTTGCGGTGATTCATGATGACTGAATGAATTGCATGGCATTGCTGGCGATATATCATTCAAGTTTCTGACCTATCAGCTTCCGACGGTAGGGTATTGGCTTACCGTGGCAATGACGGGTAACGGAGGATTAGGGTTTGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACTGGGAGGTAGTGACAAGAAATAACAATACAGGGCATCCATGTCTTGTAATTGGAATGAATGGAAATTAAACCTCTTTGTAAGTATCGATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGGATTTCTG

FS20

CAGTTATAATTTATTTGGTGGTCATTCTCTACATGGAAACTGTGGTAATTCTATAGCTAATACATGCTTACCAACCCAACTTCATGGAAGGGTTGTGGTTATTAGTTACAGAACCAACCCAAGCTTTGCTTGGTCTTGCGGTGATTCATGATGACTGAATGAATTGCATGGCATTGCTGGCGATATATCATTCAAGTTTCTGACCTATCAGCTTCCGACGGTAGGGTATTGGCTTACCGTGGCAATGACGGGTAACGGAGGATTAGGGTTTGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCTAAGGAAGGCAGCAGGCGCGCAAATTACCCAATCCTGACACTGGGAGGTAGTGACAAGAAATAACAATACAGGGCATCCATGTCTTGTAATTGGAATGAATGGAAATTAAACCTCTTTGTAAGTATCGATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCGGTTAAAAAGCTCGTAGTTGGATTTCTGCTAAGGGGTGGCTG

14

(II) Molecular characterization and identification of marine microbes associated with Pyrodinium bahamense var. compressum

(a) Bacteria isolation and culture A total of 16 individual bacterial colonies (19A, 22A, 25A, 27A, 27B, 27C, 27D, 27E, 27F, 27G, 28A, 29A, 30B, B5, B9 and B18) were successfully isolated from the Pyrodinium cultures. Each isolated bacteria associated with Pyrodinium (Pyro-Bac) were then cultured overnight at 37 °C. Marine agar is usually used for cultivating heterotrophic marine bacteria. The media contain minerals that nearly duplicate the major mineral composition of sea water, in addition to peptone and yeast extract that provide good source of nutrients.

(b) Gram staining

Majority of the Pyro-Bac samples were stained pink (Gram negative) except for two Pyro-Bac, 27A and B5, which stained purple (Gram positive). Gram-positive bacteria stain purple because they have thick cell wall, where 90 % of it made of peptidoglycan, whereas for Gram-negative bacteria, they have a thinner layer, only 10 % of the cell wall is peptidoglycan. Gram-negative bacteria also have an additional outer membrane which contains lipopolysaccharide, and is separated from the cell wall by periplasmic space (Beveridge & Davies, 1983). Besides able to differentiate bacteria into Gram positive and Gram negative groups, the morphology of the bacteria could also be seen under microscope after Gram staining. Table 5 showed the summary of the morphology and also Gram stain of the 16 Pyro-Bac samples after Gram staining. Based on Table 5, majority of the Pyro-Bac samples were rod-like or bacillus shape, except for three Pyro-Bac, 27A, 27E and B5, where their morphology was cocoid or spherical shape and sometimes short rod-like shape could also be seen. Table 5: The morphology and Gram stain of the 16 Pyro-Bac samples used in this study.

Pyro-Bac Sample Gram stain Shape 19A Red Rod 22A Red Rod 25A Red Rod 27A Purple Cocoid / Short Rod 27B Red Rod 27C Red Rod 27D Red Rod 27E Red Cocoid / Short Rod 27F Red Rod 27G Red Rod 28A Red Rod 29A Red Rod 30B Red Rod B5 Purple Cocoid / Short Rod B9 Red Rod

B18 Red Rod

15

(c) PCR amplification and restriction enzyme analysis of the 16S rDNA of the Pyro-Bac samples The PCR amplification was conducted using the universal primers 27F (5’-AGA GTT TGA TCM TGG CTC AG-3’) and 1492R (5’- TAC GYT ACC TTG TTA CGA CT-3’), where both primers amplified the 16S rDNA region of the Pyro-Bac samples. Figure 9 showed the PCR amplification of the 16 Pyro-Bac samples, which yielded the expected size of approximately 1.5 kb.

Figure 9 (A, B): PCR amplification of the 16 Pyro-Bac samples using the universal primers 27F and 1492R. Lane M1: 100 bp DNA ladder; Lane 1:Pyro -Bac 28A; Lane 2: Pyro-Bac 22A; Lane 3: Pyro-Bac B18; Lane 4: Pyro-Bac 27A; Lane 5: Pyro-Bac 27B; Lane 6: Pyro-Bac 27C; Lane 7: Pyro-Bac B5; Lane 8: Pyro-Bac 25A;Lane 9: Pyro-Bac B9; Lane 10: Pyro-Bac 19A; Lane 11: Pyro-Bac 29A; Lane 12: Pyro-Bac 30B; Lane 13: Pyro-Bac 27G; Lane 14: Pyro-Bac 27D; Lane 15: Pyro -Bac 27E; Lane 16: Pyro-Bac 27F; Lane M2: 1 kb DNA ladder.

Restriction enzyme analysis was used in this study to compare the rDNA sequences of the 16 isolates of Pyro-Bac, 19A, 22A, 25A, 27A, 27B, 27C, 27D, 27E, 27F, 27G, 28A, 29A, 30B, B5, B9 and B18. In this study, a total of six restriction enzymes, HaeIII, DpnII, AluI, RsaI, BamHI and XhoI, were used to evaluate the DNA sequence variation among the 16 Pyro-Bac samples. The six restriction enzymes were chosen because they contain frequent 4-base recognition sites. Restriction patterns of the 16 Pyro-Bac samples produced by HaeIII, DpnII, AluI, RsaI, BamHI and XhoI were shown in Figure 10 (A – F), respectively.

Figure 10 (A–F): Digestion of the 16S rDNA of bacteria associated with Pyrodinium bahamense var. compressum with HaeIII (A), DpnII (B), AluI (C), RsaI (D), BamHI (E) and XhoI (F). Lane 1: 28A; Lane 2: 22A; Lane 3: B18; Lane 4: 27A; Lane 5: 27B; Lane 6: 27C; Lane 7: B5; Lane 8: 25A; Lane 9: B9; Lane 10: 19A; Lane 11: 29A; Lane 12: 30B;Lane 13: 27G; Lane 14: 27D; Lane 15: 27E; Lane 16: 27F; Lane M: 100 bp DNA ladder.

1,500 bp

M1 1 2 3 4 5 6 7 8 M2

A B

1,500 bp

M1 9 10 11 12 13 14 15 16 M2

1,500 bp

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M

500 bp

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M

500 bp

16

Referring to Figure 10, HaeIII, DpnII, AluI and RsaI yielded positive results, whereas for RE BamHI and XhoI, no clear restriction patterns were observed. Figure 11 showed the summary of the restriction patterns among the 16 Pyro-Bac samples in a chart form. Based on the Figure 11, the four restriction enzymes, HaeIII, DpnII, RsaI and AluI, had successfully produced eight riboprint (riboprint A – H) according to their restriction patterns.

Figure 11: Division of the 16 Pyro-Bac samples based on the restriction patterns produced by RE HaeIII, DpnII, RsaI and AluI.

According to Figure 11, the major population of bacteria associated with Pyrodinium bahamense var. compressum belonged to riboprint C, where there were seven Pyro-Bac samples, followed by riboprint D with three Pyro-Bac samples. The remaining 6 riboprints had one Pyro-Bac sample each.

According to Clark (1997), twelve enzymes with four-base recognition sequence could yield up to 15 % of the interested gene sequence without necessary cloning or DNA sequencing. This is because rDNA fingerprinting is a cost-effective method meant to evaluate the DNA sequence variation without DNA sequencing (Weising et al., 2005; Clark, 1997). The main advantages of rDNA fingerprinting are cost-effective and have high reproducibility. However, there are also some drawbacks, such as tedious experimental procedures and the requirement of microgram amounts of relatively pure and intact DNA (Weising et al., 2005). Due to the low quantity of restriction enzymes used and also the presence of non-specific restriction fragments in this analysis, the 16 Pyro-Bac samples were subjected to direct sequencing to confirm their identity. The restriction enzyme analysis data will be combined with the sequencing data to produce a better data comparison and interpretation (Dowling et al., 1996).

(d) Sequence analysis of the 16S rDNA of Pyro-Bac samples

The purified PCR products of the 16 Pyro-Bac samples were sequenced by a service provider, First Base Laboratory (Selangor), using ABI PRISM 377 DNA sequencer and BigDye Terminator v3.1 cycle sequencing kit. The primers used for sequencing were same as the primers used for PCR amplification, 27F (5’-AGA GTT TGA TCM TGG CTC AG-3’) and 1492R (5’- TAC GYT ACC TTG TTA CGA CT-3’). The estimated length of the rDNA sequence using the two primers is approximately 1.5 kb.

27A, B5 28A, B18, 27C, 25A, B9, 29A, 30B Riboprint C

22A, 27B, 27F, 19A

27D Riboprint H

27G, 27E

DpnII

27A Riboprint A

B5 Riboprint B 22A, 27B,

27F Riboprint D

19A Riboprint E

27G Riboprint F

27E Riboprint G

AluI / RsaI

No cutting site

HaeIII

27A, B5, 28A, B18, 27C, 25A, B9, 29A, 30B, 22A, 27B, 27F, 19A, 27D, 27G, 27E

17

All partial sequences that were obtained were approximately 500 bp to 850 bp in size, where those forward and reverse partial sequences of more than 750 bp were able to be assembled into one long complete sequence contig. The partial sequences of each Pyro-Bac samples were able to be assembled except for three Pyro-Bac samples, 27A, 29A and B5, where there had been early signal loss when sequencing the forward and reverse strand of the PCR products. All sequences of Pyro-Bac samples were also deposited into the NCBI GenBank database, EF688604 to EF688619. Table 6 recorded the size and NCBI accession number of each Pyro-Bac samples used in this study. The assembled and the three partial sequences were identified using the BLASTN program available in the NCBI GenBank webpage. The summary of the BLASTN results was shown in Table 7.

Table 6: The sizes and accession number of each Pyro-Bac samples used in this study.

Pyro-Bac Samples

NCBI Accession Number Size (bp)

19A EF688604 1396 22A EF688605 1336 25A EF688606 1394 27B EF688607 1330 27C EF688608 1420 27D EF688609 1324 27E EF688610 1414 27F EF688611 1334 28A EF688612 1421 30B EF688613 1421 B9 EF688614 1421

B18 EF688615 1410 27G EF688616 1421 27A EF688617 520 29A EF688618 630 B5 EF688619 598

Table 7: The summary of the BLASTN results of each Pyro-Bac samples.

Pyro-Bac Samples GenBank Database

Phyla Genus

27A Actinobacteria Kocuria

B5 Actinobacteria Nesterenkonia

28A, 27C, 25A, B9, 29A,30B, B18 γ-proteobacteria Alcanivorax

22A, 27B, 27F α-proteobacteria Hyphomonas

19A γ-proteobacteria Alteromonas

27D α-proteobacteria Roseobacter

27G γ-proteobacteria Xanthomonas

27E γ-proteobacteria Acinetobacter

18

According to Table 7, the genetic diversity of the extracellular bacteria associated with Pyrodinium bahamense var. compressum was limited to the Phyla Proteobacteria (α- and γ-proteobacteria) and Actinobacteria, which were similar with the findings by Azanza et al. (2006) and Alverca et al. (2002). Alverca and colleagues reported that γ-proteobacteria was found outside the dinoflagellate, Gyrodinium instriatum, whereas β-proteobacteria and Cytophaga-Flavobacterium-Bacteroides were observed in the cytoplasm and nuclear. No α-proteobacteria was detected either free-living or intracellular (Alverca et al., 2002).

The major bacteria associated with Pyrodinium bahamense var. compressum was from the genus Alcanivorax (97 % to 100 % homology), which belongs to γ-proteobacteria class. According to Liu and Shao (2005), there are four recognized species of the genus Alcanivorax, which are Alcanivorax borkumensis, Alcanivorax venustensis, Alcanivorax diesellolei and Alcanivorax jadensis. This marine bacterium had been previously described by Fernandez-Martinez et al. (2003) and Liu and Shao (2005), where the γ-proteobacteria was isolated from the Mediterranean Sea and Bohai Sea, respectively. In both reports, both authors described the Alcanivorax spp. as aerobic, Gram-negative, non-spore-forming, catalase- and oxidase-positive (Fernandez-Martinez et al., 2003; Liu & Shao 2005).

Another major bacterium associated with Pyrodinium bahamense var. compressum was from the genus Hyphomonas (98 % to 99 % homology), which belongs to α-proteobacteria class. In fact, the three isolates (22A, 27B, 27F) exhibited high sequence homology with an unknown bacterium strain, SCRIPPS_739, that is associated with toxic and non-toxic dinoflagellates, Alexandrium spp. and Scrippsiella trochoidea (Accession number: AF359546). The bacterium was reported by Hold et al. (2001). However, in the report, Hyphomonas spp. was one of the bacteria mentioned to be associated with the dinoflagellates (Hold et al., 2001). Hyphomonas spp. is a marine, biphasic prosthecate, which refers to an organism having a stalk or an appendage (Badger et al., 2005; Weiner et al., 2000). Hyphomonas species have a stereotypical biphasic life cycle, a GC DNA content of 57 to 64 %, an optimum temperature range of 22 to 37 °C, a requirement for sea salts, a characteristic fatty acid fingerprint with octadecenoic acid (18:1) as the major fatty acid. Most species grow only with proteins, peptides and/or amino acids and synthesize Q11 as the major quinone (Weiner et al., 2000).

The minor bacteria isolates identified in this study were Alteromonas spp., Xanthomonas spp., Acinetobacter spp., Roseobacter spp., Kocuria spp., and Nesterenkonia spp. (one isolate each). Alteromonas spp., Xanthomonas spp., Acinetobacter spp., and Roseobacter spp. belong to the Proteobacteria class, whereas Kocuria spp. and Nesterenkonia spp. belong to the Actinobacteria class. Bacteria from the genus Alteromonas and Roseobacter have been reported to be associated with the harmful algal bloom species of the genera Alexandrium. Jasti et al. (2005) investigated that the genera Roseobacter showed higher degree of association with the toxic dinoflagellate, Alexandrium spp. than with other bacterial group, where Alteromonas spp. was one of the identified bacteria associated with Alexandrium. However, they had only characterized and identified the bacteria associated with Alexandrium and did not do any toxicity test (Jasti et al., 2005).

According to Fox et al. (1992), 16S rDNA sequence identity might not necessarily be sufficient to guarantee species identity. Fox and colleague had compared the sequences of three different psychrophilic Bacillus strains. The strains exhibited more than 99.5% sequence identity and the results could be regarded as identical. In contrast, previously published DNA-DNA hybridization results had convincingly established that the three strains did not belong to the same species. These results emphasize that the identity of

19

the 16S rDNa sequence is not a good criteria to guarantee species identity. However, although 16S rDNA sequences could be used routinely to distinguish and establish relationships between genera and well-resolved species, very diverged species might not be recognizable (Fox et al., 1992). For this reason, all sequences of the sixteen Pyro-Bac samples were identified to its genus level only.

CONCLUSION Results of this study showed that the PCR method would be very useful for the detection of Pyrodinium bahamense var. compressum in field samples. It is very uncommon that the identification of harmful algae by molecular methods in their natural habitat can be execute, therefore making this study an important finding. The Pyrodinium cells detected in the field samples displayed in Table 3 were only estimation, however the low number of Pyrodinium cells detected can used as an indicator that the species of interest can be detected in rather low concentrations in their environment, and also among the complex plankton community. Therefore, PCR method could be used for identifying and confirming the presence of harmful algae due to its specificity, sensitivity and rapidity. Besides that, PCR amplification is not an expensive method compared to those high-end technologies that are expensive and required expertise. This technique could be helpful in monitoring programs and serve an early warning system for the presence of harmful algal species in low concentrations. Preliminary results in this study suggested that the CWL1R primer was specific only for Pyrodinium bahamense var. compressum. This primer can be developed as a DNA probe specifically for the identification of Pyrodinium bahamense var. compressum. However, the oligonucleotide primer should be evaluated under field conditions for several years before confirmation of its specificity. In another hand, the identification of marine microbes associated with Pyrodinium bahamense var. compressum in this study showed to be a very useful information for further studies, especially those identified microbes that are found to be similar with other marine microbes associated with toxic harmful algae. This study can be used as a reference to other bacteria associated with harmful algae species in the Sabah waters to determine the population diversity of bacteria associated harmful algae, for example the harmful algae, Cochlodinium polykrikoides. Another aspect of this research which can be continued is to determine whether the bacteria are involved in the production of PSP toxins. This is because present theory suggests bacteria play an important role in producing toxins. It is important to know whether the production of toxin is triggered by the algae or bacteria attached to the algae or both. Bacteria-algae interactions play an important role in HAB dynamics, where it has been postulated that they are regulators in the processes of algal bloom initiation, maintenance and decline (Ferrier et al., 2002). Additionally, it has been suggested that bacteria-algae association may play a direct or indirect role in toxin production. These toxin-producing bacteria can produce toxin autonomously and have the ability to metabolize the toxins, converting them from one derivative to another (Córdova et al., 2003). Thus, bacteria may be involved in both the production and modification of these toxins. ACKNOWLEDGEMENT The authors would like to thank Universiti Malaysia Sabah for funding this study under the fundamental grant (Research Grant No.: B-09-01-13-PR/U018).

20

REFERENCES Alverca, E., Biegala, I. C., Kennaway, G. M., Lewis, J. & Franca, S. 2002. In Situ Identification

and Localization of Bacteria Associated with Gyrodinium instriatum (Gymnodiniales, Dinophyceae) by Electron and Confocal Microscopy. European Journal of Phycology. 37: 523 – 530.

Anton, A., Alexander, J. & Estim, A. 2000. Harmful Algal Blooms in Malaysia: Revisiting Kimanis Bay. (Abstract). Proceedings of the 9th International Conference on Harmful Algal Blooms, Tasmania, Australia.

Azanza, P. V., Azanza, R. V., Vargas, V. M. D. & Hedreyda, C. T. 2006. Bacterial

Endosymbionts of Pyrodinium bahamense var. compressum. Microbiology Ecology. 52: 756 – 764.

Azanza-Corrales, R. & Hall, S. 1993. Isolation and Culture of Pyrodinium bahamense var.

compressum from the Philippines. In Smayda, T. J. & Shimizu, Y. (eds.). Toxic phytoplankton blooms in the sea. USA: Elsevier Science Publishers. 725 – 730.

Badger, J. H., Eisen J. A. & Ward, N. L. 2005. Genomic Analysis of Hyphomonas neptunium

Contradicts 16S rRNA Gene-based Phylogenetic Analysis: Implications for the Taxonomy of the Orders “Rhodobacterales” and Caulobacterales. International Journal of Systematic and Evolutionary Microbiology. 55: 1021 – 1026.

Beveridge, T. J. & Davies, J. A. 1983. Cellular Responses of Bacillus subtilis and Escherichia

coli to the Gram Stain. Journal of Bacteriology. 156: 846 – 858. Clark, C. G. 1997. Riboprinting: A Tool for the Study of Genetic Diversity in Microorganisms.

Journal of Eukaryotic Microbiology. 44: 277 – 283. Cordova, J. L., Escudero, C. & Bustamante, J. 2003. Bloom Inside the Bloom: Intracellular

Bacteria Multiplication Within Toxic Dinoflagellates. Revista de Biologia Marina y Oceanografia. 38: 57 – 67.

Doyle J. J. & Doyle J. L. 1987. A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue. Phytochemical Bulletin. 19: 11 – 15.

Dowling, T. E., Moritz, C., Palmer, J. D. & Rieseberg, L. H. 1996. Nucleic Acids III: Analysis of

Fragments and Restriction Sites. In Hillis, D.M., Moritz, C. & Mable, B.K. (eds.). Molecular Systematics (2nd edition). USA: Sinauer Associates, Inc.

Duncan, E., Setzke, E. & Lehmann, J. 2003. Isolation of Genomic DNA. In Bowien, B. &

Dϋrre, P. (eds.). Nucleic Acid Isolation Methods. USA: American Scientific Publishers. 7 – 19.

Fernandez-Martinez, J., Pujalte, M. J., Garcia-Martinez, J., Mata, M., Garay, E. & Rodriguez-

Valera, F. 2003. Description of Alcanivorax venustensis sp. nov. and Reclassification of Fundibacter jadensis DSM 12178T (Bruns and Berthe-Corti 1999) as Alcanivorax jadensis comb. nov. Members of the Emended Genus Alcanivorax. International Journal of Systematic and Evolutionary Microbiology. 53: 331 – 338.

Fox, G. E., Wisotzkey, J. D. & Jurtshuk, P. 1992. How Close Is Close: 16S rRNA Sequence

Identity May Not be Sufficient to Guarantee Species Identity. International Journal of Systematic Bacteriology. 42: 166 – 170.

21

Godhe, A., Otta, S. K., Rehnstam-Holm, A-S, Karunasagar, I. & Karunasagar, I. 2001.

Polymerase Chain Reaction in Detection of Gymnodinium Mikimotoi and Alexandrium minutum in Field Samples from Southwest India. Marine Biotechnology. 3: 152 – 162.

Guillard R. R. L. 1975. Culture of Phytoplankton for Feeding Marine Invertebrates. In Smith W. L. & Chanley M. H. (eds.), Culture of Marine Invertebrate Animals. New York: Plenum Press. 29 – 60.

Guilard R. R. L. & Ryther J. H. 1962. Studies of Marine Planktonic Diatoms. I. Cyclotella nana Hustedt and Detonula confervacea Cleve. Canadian Journal Microbiology. 8: 299.

Hold, G. L., Smith E. A., Rappé M. S., Maas E. W., Moore E. R. B., Stroempl C., Stephen J.

R., Prosser J. I., Birkbeck T. H. & Gallacher S. 2001. Characterisation of Bacterial Communities Associated with Toxic and Non-Toxic Dinoflagellates: Alexandrium spp. and Sprippsiella trochoidea. FEMS Microbiology Ecology. 37: 161-173.

Jasti, S., Sieracki, M. E., Poulton, N. J., Giewat M.W. & Rooney-Varga, J. N. Phylogenetic

Diversity and Specificity of Bacteria Closely Associated with Alexandrium spp. and Other Phytoplankton. Applied and Environmental Microbiology. 71: 3483 – 3494.

Liu, C. & Shao, Z. 2005. Alcanivorax dieselolei sp. nov., A Novel Alkane-Degrading Bacterium

Isolated From Sea Water and Deep-Sea Sediment. International Journal of Systematic and Evolutionary Microbiology. 55: 1181 – 1186.

Scholin, C. A. & Anderson, D. M. 1998. Detection and Quantification of HAB Species Using Antibody and DNA Probes: Progress to Date and Future Research Objectives. Xunta de Galicia and Intergovernmental Oceanographic Commission of UNESCO. 253 – 257

Tobe, K. 2003. Investigations into the Role of Bacteria/Dinoflagellate Interactions in Paralytic

Shellfish Poisoning. Germany: Bremen University. Weiner, R. M., Melick, M., O’Neill, K. & Quintero, E. 2000. Hyphomonas adhaerens sp. nov.,

Hyphomonas johnsonii sp. nov. and Hyphomonas rosenbergii sp. nov., Marine Budding and Prosthecate Bacteria. International Journal of Systematic and Evolutionary Microbiology. 50: 459 – 469.

Weising, K., Nybom, H., Wolff, K. & Kahl, G. 2005. DNA Fingerprinting in Plant: Principles,

Methods and Applications (2nd edition). USA: CRC Press. 81 – 205.

ribosomal dna analysis of a harmful algal bloom … · selected for 18s rdna amplification. the...

Documents