role of a tripartite efflux pump in the symbiosis between...

DEPARTAMENTO DE

ROLE OF A TRIPARTITE EFFLUX PUMP IN

THE SYMBIOSIS BETWEEN

MELILOTI

MESTRADO EM

UNIVERSIDADE DE LISBOA

FACULDADE DE CIÊNCIAS

EPARTAMENTO DE BIOLOGIA VEGETAL


THE SYMBIOSIS BETWEEN SINORHIZOBIUM

AND LEGUMINOUS PLANTS

Andreia Filipa Tomás Marques

ESTRADO EM MICROBIOLOGIA APLICADA

2011


SINORHIZOBIUM


DEPARTAMENTO DE


THE SYMBIOSIS BETWEEN

MELILOTI

Dissertação orientada por

e Prof. D

MESTRADO EM

UNIVERSIDADE DE LISBOA

FACULDADE DE CIÊNCIAS

EPARTAMENTO DE BIOLOGIA VEGETAL




Dissertação orientada por Prof. Doutora Leonilde Moreira (IST)

e Prof. Doutora Sandra Chaves (FCUL)


ESTRADO EM MICROBIOLOGIA APLICADA

2011

ii


SINORHIZOBIUM


Leonilde Moreira (IST)

iii



MELILOTI AND LEGUMINOUS PLANTS


MASTER THESIS

2011

This thesis was fully performed at the Biological Sciences Research Group of Instituto Superior Técnico of the Technical University of Lisbon under the direct supervision of Prof. Dra. Leonilde Moreira.

Prof. Dra. Sandra Chaves was the internal designated supervisor in the scope of the Master in Applied Microbiology of the Faculty of Sciences of the University of Lisbon.

Role of a tripartite efflux pump in the symbiosis between Sinorhizobium meliloti and leguminous plants

iv

Acknowledgements

This master thesis reflects the support of many people who influenced my life and this work,

and who I would like to thank.

I am very thankful to Prof. Dra. Leonilde Moreira from IST for giving me the opportunity to

develop this research work under her careful guidance and for all her attention in the very

beginning of my scientific path. I acknowledge her patience, encouragement and cheerfulness and

all the help in the writing of this thesis.

Second, I would like to acknowledge as well the Ph.D. student Mário Santos as my lab-

supervisor for all his patience for teaching me the basics of the scientific research and for

transmitting to me part of his knowledge on Sinorhizobium meliloti.

Thanks also to the group members, Dr. Sofia Ferreira and Inês Silva, for accompany me

from the beginning, helping me to clarify doubts and sharing their knowledge with me.

Heartfelt thanks to Prof. Dr. Sandra Chaves from FCUL, who was designated to be my

internal supervisor in the scope of the Master in Applied Microbiology, and from the start proved to

be always available.

Furthermore I would like to thank all members of BSRG by their welcoming, and last but not

least, my “thank you” to my family and friends for all their constant support.

This work was supported by Fundação para a Ciência e a Tecnologia (FCT), Portugal

(project PTDC/BIA-MIC/113733/2009).


v

Resumo

Sinorizhobium meliloti é uma bactéria fixadora de azoto que estabelece uma relação

simbiótica com plantas leguminosas do género Medicago. Durante o processo simbiótico as raízes

da planta são infectadas, ocorrendo uma troca de sinais entre os dois simbiontes e iniciando-se o

desenvolvimento de um órgão único, o nódulo, aonde após colonização pelo microssimbionte

ocorre a fixação do azoto. Durante este processo, as bactérias estão sujeitas a diferentes tipos de

stress que afectam o estabelecimento da simbiose e impõem limitações durante a fixação de

azoto, entre eles o stress oxidativo, osmótico e pH do solo.

SMc03167, SMc03168 e SMc03169 são três genes presentes no genoma de S. meliloti que

ainda não foram caracterizados, mas cuja expressão surge alterada na literatura sob algumas

condições de stress. Está previsto que os genes SMc03167 e SMc03168 codifiquem para um

transportador do tipo MFS (Major Facilitor Superfamily) que constituem uma família de bombas de

efluxo responsáveis pela resistência a vários antibióticos e compostos tóxicos. O gene SMc03167

partilha semelhanças com membros da subfamília ErmB/QacA e TetB, enquanto o gene

SMc03168 apresenta um domínio conservado da proteína HlyD. Observou-se que a expressão

destes genes de S. meliloti se encontrava induzida num mutante tolC em resposta a condições de

stress que afectam a estabilidade da parede celular. O gene SMc03169, adjacente aos genes

SMc03167 e SMc03168, é um possível regulador de transcrição da família TetR, provavelmente

envolvido no controlo da transcrição desses transportadores e na resposta a condições de stress.

Assim, decidiu-se analisar o papel destes três genes em S. meliloti e procedeu-se à construção de

mutantes de eliminação. Uma vez que não se obteve um mutante eliminação para o gene

SMc03168, é apenas apresentada uma caracterização dos mutantes obtidos para os genes

SMc03167 e SMc03169.

Várias experiências foram feitas na tentativa de descobrir qual o papel desempenhado pelos

genes SMc03167 e SMc03169, nomeadamente na resposta a vários stresses e avaliar o seu

envolvimento no estabelecimento da simbiose. Para se atingir estes objectivos, comparou-se o

crescimento dos mutantes em relação à estirpe selvagem em meio complexo TY e meio mínimo

GMS, analisou-se o seu comportamento a diferentes valores de pH, mediu-se a sua sensibilidade

a alguns agentes antimicrobianos, comparou-se a actividade de efluxo ao composto tóxico

brometo de etídio e caracterizou-se o seu fenótipo simbiótico em plantas da espécie Medicago

sativa.

Não se observaram alterações no crescimento dos mutantes SMc03167 e SMc03169

quando comparados à estirpe selvagem em meio complexo TY. No entanto, em meio GMS (pH

7.0) o mutante SMc03169 apresentou uma menor formação de biomassa final. Apesar desta

diferença observada, a morfologia das células vistas ao microscópio era semelhante entre as três

estirpes e uma análise das proteínas totais não revelou diferenças óbvias na expressão proteica.


vi

A expressão do gene SMc03169 aparece alterada na literatura em resposta a pH ácido.

Para se investigar a influência do pH no crescimento deste mutante, vários pH foram testados. A

pH 4.0 e 5.0 não se observou crescimento quer no mutante quer na estirpe selvagem apesar das

células se manterem viáveis. A pH 6.0 e 7.0 não havia alterações no crescimento para qualquer

das estirpes. Estabeleceu-se o pH 5.5 como o pH mínimo tolerado para o crescimento de S.

meliloti, tendo-se observado que para este valor de pH o crescimento do mutante SMc03169 era

muito inferior ao da estirpe selvagem. Estudos de complementação do mutante pela introdução de

um plasmídeo que expressava o gene SMc03169 sob o controlo do seu próprio promotor,

restabeleceram a capacidade de crescer a pH 5.5. Este resultado sugere um possível

envolvimento deste gene na adaptação de S. meliloti ao stress imposto pelo ácido.

Uma vez que os genes SMc03167 e SMc03169 codificam para um possível transportador e

regulador da transcrição, respectivamente, que poderão estar envolvidos na resistência a

compostos tóxicos, testou-se o comportamento dos mutantes na presença de concentrações

tóxicas de vários compostos químicos, através da medição dos halos de inibição do crescimento.

Testaram-se três compostos antimicrobianos derivados de plantas: a berberina, o ácido p-

coumárico e a genisteína; os agentes de stress oxidativo H2O2 e o hidroperóxido de cumeno; e

ainda o detergente SDS. O mutante SMc03167 apresentou halos de inibição idênticos aos halos

da estirpe selvagem para todos os compostos e concentrações estudadas. O mutante SMc03169

revelou um comportamento semelhante, excepto para os compostos hidroperóxido de cumeno e

SDS onde os halos de inibição foram superiores aos halos obtidos na estirpe selvagem, revelando

a sua maior sensibilidade a estes agentes de stress.

A capacidade de excreção do composto tóxico brometo de etídio foi comparada entre as

três estirpes, tendo-se usado como controlo uma estirpe mutante para o gene tolC que exibe

defeitos na parede celular e, como tal, é incapaz de excretar este composto tóxico. O mutante tolC

tornou-se fluorescente devido à acumulação de brometo de etídio, mesmo a baixas

concentrações. Os mutantes para os genes SMc03167 e SMc03169 apresentaram uma baixa

fluorescência comparável à da estirpe selvagem devido ao transporte deste composto, mostrando

que a eliminação de ambos os genes não afectou o efluxo deste composto.

As propriedades simbióticas dos genes em estudo foram testadas através de ensaios de

simbiose com plantas da espécie M. sativa, nomeadamente pela contagem dos nódulos induzidos

durante cinco semanas. Os nódulos brancos foram os primeiros a aparecer e depois evoluíram

para nódulos maiores e que apresentavam uma cor rosa. A estirpe selvagem apresentou o maior

número de nódulos ao longo das 5 semanas, estando o mutante SMc03167 logo a seguir com

uma diferença média de um nódulo a menos. Esta pequena diferença mostra que este mutante é

tão competitivo como a estirpe selvagem. As plantas inoculadas com estas duas estirpes

apresentavam-se verdes e saudáveis, com raízes longas e ramificadas. O mutante SMc03169

apresentou uma nodulação muito inferior à da estirpe selvagem, originando uma média de 50%

nódulos a menos. Apesar desta diferença no número de nódulos ser significativa, não houve

qualquer diferença a nível morfológico dos mesmos. Contudo, as plantas inoculadas eram mais

pequenas, encontravam-se menos saudáveis e com raízes pouco ramificadas, o que revela uma


vii

menor eficiência na nodulação em M. sativa e consequente fixação de azoto e desenvolvimento da

planta. No final do ensaio simbiótico, alguns nódulos brancos e rosa foram recolhidos das plantas,

esmagados e os CFUs bacterianos calculados. Ainda que se tenham observado valores diferentes

para cada nódulo esmagado, concluiu-se que os nódulos rosa estavam efectivamente colonizados

por bactérias.

Apesar de não se ter identificado o tipo de substrato para o transportador MFS

SMc03167/SMc03168, este trabalho identificou um novo gene com relevância para o

estabelecimento da simbiose. É pois de todo o interesse caracterizar a proteína SMc03169 de

forma a identificar a sua importância quer na resistência a pH ácido quer na interacção com

plantas de forma a aumentar a nossa compreensão desta importante simbiose.

Palavras-Chave: Sinorhizobium meliloti, Medicago sativa, Major Facilitor Superfamily

(MFS), simbiose, fixação do azoto.


viii

Abstract

Sinorizhobium meliloti is a bacterium capable of establishing a symbiotic nitrogen fixation

relationship with leguminous plants. The symbiotic process involves root infection mediated by

exchange of signals between the two symbionts, which then culminates by development of a root

nodule. During this process, bacteria are exposed to various stresses. The expression of

SMc03167 and SMc03168 genes, encoding a transporter of the Major Facilitor Superfamily (MFS),

was found to be induced in a S. meliloti TolC mutant in response to cell wall perturbations and

oxidative stress. Similarly, the adjacent SMc03169 gene, encoding a putative transcriptional

regulator TetR, was predicted to be involved in the transcriptional control of the previous genes and

perhaps also having a role in stress response. In this work, we characterized the two deletion

mutants for ORFs SMc03167 and SMc03169. When compared with the wild-type, the SMc03167

mutant showed no growth defects in complex and minimal medium, and its capacity for ethidium

bromide extrusion and resistance phenotype to antimicrobial and oxidative stress agents was not

affected. Moreover, the symbiotic assays with Medicago sativa revealed that SMc03167 mutant

was as competitive as wild-type for nodulation. Contrastingly, the SMc03169 mutant showed a

reduced biomass formation in minimal medium, although no changes were observed in the

morphology of the cells. In addition, its sensitivity to low pH was altered which suggests a possible

involvement on S. meliloti tolerance to acid conditions. In trans complementation of the SMc03169

mutant rescued its ability to grow at low pH. Simultaneously, the SMc03169 mutant was more

sensitive to the cell envelope-disrupting agent SDS and oxidative stress agent cumene

hydroperoxide. Plants inoculated with SMc03169 mutant showed a reduced number of nodules and

did look not quite as healthy as plants inoculated with the wild-type strain. Together, our data

suggests that SMc03169 gene plays a role in cell’s adaptation to acid environments and in

symbiosis establishment. Further studies are needed to understand the exact role of this

transcriptional regulator in S. meliloti-plant interaction.

Keywords: Sinorhizobium meliloti, Medicago sativa, Major Facilitor Superfamily (MFS),

symbiosis, nitrogen-fixation.


ix

Table of Contents

Acknowledgements ............................................................................................................... iv

Resumo .................................................................................................................................. v

Abstract ............................................................................................................................... viii

1. Introduction .................................................................................................................... 1

1.1. The importance of Biological Nitrogen Fixation .................................................... 1

1.2. Symbiosis between Rhizobia and Legumes ............................................................ 1

1.3. The genome of Sinorhizobium meliloti 1021 .......................................................... 4

1.3.1. Transport systems ............................................................................................ 4

1.3.2. Adaption of S. meliloti to stress conditions ..................................................... 5

1.4. Role of multidrug efflux systems in symbiosis ....................................................... 8

2. Objectives .................................................................................................................... 10

3. Experimental Approach ............................................................................................... 10

4. Materials and Methods ................................................................................................. 11

4.1. Bacterial strains and plasmids ............................................................................... 11

4.2. Bacteria growth conditions ................................................................................... 12

4.3. Plant growth conditions ......................................................................................... 12

4.4. Extraction of genomic and plasmid DNA ............................................................. 12

4.5. Construction of S. meliloti deletion mutants ......................................................... 13

4.6. Mutant genotype confirmation .............................................................................. 14

4.7. Growth curves ....................................................................................................... 15

4.8. Polyacrylamide gel electrophoresis ....................................................................... 15

4.9. Zone inhibition assays ........................................................................................... 15

4.10. Ethidium bromide supplemented agar screening method.................................. 15

5. Results and Discussion ................................................................................................ 16

5.1. Sequence analysis of ORFs SMc03167, SMc03168 and SMc03169 ................... 16

5.2. Construction of deletion mutant strains ................................................................ 20

5.3. Assessment of phenotypic properties .................................................................... 24

5.3.1. Growth of S. meliloti deletion mutants in rich and minimal medium ............ 24

5.3.2. Growth of S. meliloti SMc03169 mutant at pH 5.5 ....................................... 27

5.3.3. Sensitivity of the mutants to antimicrobials of plant origin and other stress

agents.... ....................................................................................................................... 27

5.3.4. Efflux activity of the mutants in the presence of a toxic compound ............. 28

5.3.5. Symbiotic properties of the mutants .............................................................. 29

6. Conclusions .................................................................................................................. 32

7. References .................................................................................................................... 35


1

1. Introduction

1.1. The importance of Biological Nitrogen Fixation

Nitrogen is one of the most abundant elements on Earth and it is also one of the most

limiting for biological growth of plants because it is found in its inaccessible dinitrogen (N2) form for

them. Since the reduced availability of nitrogen in the soil represents a problem for agriculture,

various industrial fertilizers rich in nitrogen are used in order to achieve maximum productivity. The

production of fertilizers uses large amount of fossil fuel, which is costly and consumes many natural

resources. Furthermore, the carbon dioxide (CO2) released in the process of combustion of fossil

fuels and the nitric oxide released during decomposition of fertilizers contribute to the increased

greenhouse effect. The use of nitrogenous fertilizers has also resulted in unacceptable levels of

water pollution (increasing concentrations of toxic nitrates in drinking water supplies) and the

eutrophication of lakes and rivers, beyond the wastes of energy and economic resources (Zahran,

1999). It is then needed to reduce dependence on chemical fertilizers and find alternative methods

that provide the nitrogen necessary for the plant.

The largest input of nitrogen in the biosphere comes from a process called Biological

Nitrogen Fixation (BNF) by which chemically inert N2 present in the atmosphere is enzymatically

reduced to the metabolically usable form ammonia (NH3) through the action of nitrogenase. The

ability to catalyze the conversion of N2 to NH3 has evolved only among microbes, including archea,

cyanobacteria, azobacteria, Frankia and rhizobia (Gibson et al., 2008).

Rhizobia and legumes have evolved a mutualistic endosymbiosis of major ecological

importance that contributes between 25-30% of available nitrogen. Crop legumes can fix about 23-

176 kg N ha-1 year-1 and some tree legumes fix as much as 600 kg N ha-1 year-1, depending on the

plant species and also on the rhizobia species (Lindström et al., 2010; Zahran, 1999). Rhizobium

spp. and legume symbiosis also represents a significant research model for symbiosis and the

signal exchange between rhizobia and their host plants has been elucidated in some detail.

1.2. Symbiosis between Rhizobia and Legumes

Rhizobia are gram-negative bacteria with the ability to establish a N2-fixing symbiosis on

legume roots. Although require a plant host to fix nitrogen, they can survive in soil over periods of

several years even in the absence of their legume hosts. Rhizobia form a group which falls into two

classes of the proteobacteria, α-proteobacteria and β-proteobacteria. Most belong to families within

the α-proteobacteria (order Rhizobiales) and are closely related to nonsymbiotic soil bacteria.

However, symbiotic nitrogen-fixing β-proteobacteria (β-rhizobia) also have been reported, and the

evolution of new diverse strains of rhizobia is attributed to the horizontal transfer of symbiosis

genes into different types of bacteria (Becker et al., 2009).


2

Rhizobia establish a symbiosis with legume plants, leading to the formation of root structures

called nodules, containing many nitrogen-fixing bacteria. By supplying its host with nitrogen,

rhizobia can enhance host photosynthesis and increase their own access to the plant carbon

sources, enabling the synthesis of energy-rich storage molecules like polyhydroxybutyrate (PHB)

which increases bacterial survival and reproduction after they return to the soil (Prell & Poole,

2006). This type of infection develops as a consequence of several different stages of interaction

between bacteria and a specific host-legume pairing. Signaling between rhizobia and legumes is

one of the best examples of signal exchange identified in interactions between bacteria and their

eukaryotic hosts. The legumes secrete signals, usually phenolics (often flavonoids or

isoflavonoids), which can passively diffuse across the bacterial membrane. The bacteria recognize

these signals using a positively acting transcriptor factor, usually encoded by nodD gene. NodD

belongs to the LysR family of DNA-binding transcription factors, which have an N-terminal ligand-

binding domain that regulates the activity of the associated C-terminal DNA-binding domain. The

NodD is thought to function as a flavonoid receptor and induces the expression of the nod genes

whose products are involved in Nodulation Factors (Nod Factors) biosynthesis. Nod Factors are

oligomers of usually four or five 1,4-linked N-acetyl-glucosamine residues that carry an N-linked

acyl group. Different legumes secret different types of signals and rhizobia have different NodD

proteins that recognize these root-exudate signals, allowing a highly specific relationship. For

instance, the bacterium Sinorhizobium meliloti is compatible with Medicago (alfalfa), Trigonella and

Melilotus species, whereas Rhizobium etli is compatible only with Phaseolus species (bean). Nod

Factors can induce plant responses like root-hair deformation, alterations in the root hair

cytoskeleton, calcium oscillations (called calcium-spiking) at low concentrations as little as 10-13 M

and production of reactive oxygen species in root hairs (Downie, 2010).

The formation of nodules capable of nitrogen fixation requires two different bacterial

programs: one to activate plant nodule morphogenesis and the other leading to nodule infection. In

many legumes such as peas, clovers, beans, soybean, Medicago spp. and Lottus spp., infection is

usually initiated by bacteria attached near root hair tips. Nod Factors promote the deformation of

root hairs growth on itself trapping intimately the bacteria, which are then able to invade the root

through a host-derived structure called the infection thread (Downie, 2010). This structure

continues its growth via deposition of new cell wall material while carries bacteria from the root

surface into the host cell cytoplasm by a process that resembles endocytosis (Fig. 1.1a).

Simultaneous, Nod Factor stimulates root cortex cells to reinitiate mitosis, occurring a

differentiation of quiescent (G0) root cortical cells into an actively dividing meristem (Capela et al.,

2006; Gibson et al., 2008). These dividing meristem cells form the nodule primordium. A subset of

these meristem cells enter in a modified cell cycle program that results in endoreduplication and

produces greatly enlarged cells, that will receive the invading rhizobia for the purpose of nitrogen

fixation. The bacteria are budded off the end of the infection threads before the synthesis of the

plant cell wall surrounding the infection thread and the release into the plant cell. As the bacteria

differentiate into bacteroids, they also undergo endoreduplication to yield a chromosome count of

24 compared to one or two for free-living bacteria. The plant infected cells become large polyploid


3

cell harboring thousands of organelle-like structures known as symbiosomes, where many genes

required for nitrogen fixation are expressed and nitrogen is fixed (Oldroyd et al., 2011; Saeki,

2011).

Fig. 1.1 - Signal exchange and root hair invasion in Rhizobium-plant symbiosis. Flavonoids produced by the host plant

induce rhizobial nod genes and leads to production of Nod Factors. (a) Infection thread passes the root cortex toward a

cluster of dividing cells that will become a nodule primordium. (b) An indeterminate nodule originates from the root inner

cortex and has a persistent meristem (Zone I). The nodule also contains an invasion zone (Zone II) and a nitrogen-fixing

zone (Zone III). In older nodules, a senescent zone (Zone IV) develops, in which both plant and bacterial cells degenerate.

Generally, nodules fall into two morphological classes based on their pattern of meristem

growth: determinate, with a meristem derived from outer cortical cells (e.g. Glycine max, Lotus

japonicus, Vicia faba), and indeterminate, with a meristem derived from inner cortical cells (e.g.

Medicago sativa, Medicago truncatula, Pisum sativum and Trifolium species). Determinate and

indeterminate nodules also differ in the relative persistence of meristem proliferation. Determinate

nodules lacks a persistent meristem, are usually round, and display a relatively homogenous

population of developing plant and bacterial cells at any given time point. In contrast, indeterminate

nodules are elongated and create a persistent meristem that continually gives rise to new nodule

cells that are subsequently infected by rhizobia residing in the nodule (Fig. 1.1b). As a result, each

developmental stage required to establish the symbiosis is present within a single mature

indeterminate nodule and in a spatially organized manner from the young meristem at the nodule

tip to the older senescent tissue near the root (Gibson et al., 2008). The environment within the

nodule is very unusual and forms a rather special case of an interaction that involves quite specific

nutrient uptake systems and a specialized electron transport chain that operates at low oxygen

concentrations.


4

1.3. The genome of Sinorhizobium meliloti 1021

Since the genome of S. meliloti is well characterized, this rhizobia specie is considered as

ideal candidate to study. S. meliloti genome contains a circular chromosome (3.65 Mb) and two

megaplasmids, pSymA (1.35 Mb) and pSymB (1.68 Mb) (Galibert et al., 2001) with a 6204

predicted protein-encoding genes: 3341 on the chromosome (Capela et al., 2001), 1293 on pSymA

(Barnett et al., 2001), and 1570 on pSymB (Finan et al., 2001).

At the time of S. meliloti genome sequence determination, there was no experimentally

prove function for a vast majority of the predicted genes and 40% could not be placed into a

functional category. Moreover, 8% were orphan genes, defined as those not found in any other

sequenced genome. Becker et al. (2009) published a S. meliloti genome annotation update which

incorporates information published from 2001 to 2008. With improved prediction tools, they

identified 86 new putative genes, removed 66 previously predicted orphan genes and adjust the

start positions of 360 coding regions. As a result, more than 71 % of genes have now a predicted

function.

During evolution, Sinorhizobium’s genome has been acquiring new functions through

acquisition of new transport and regulatory genes (Galibert et al., 2001). The megaplasmid pSymA

carries the most genes required for nodulation and nitrogen fixation (nod, nif, and fix genes),

carbon metabolism, transport and stress responses, whereas pSymB reveals a high number of

genes involved in polysaccharide biosynthesis.

In this section it will be described S. meliloti genes and proteins with relevance to this work.

1.3.1. Transport systems

Two membranes separate the cytoplasm from the external medium in gram-negative

bacteria like rhizobia. The two membranes are permeable only to small uncharged molecules and

neutral lipophilic molecules. All other molecules require dedicated transport systems. The

exchange of substances between cytoplasm and periplasm is regulated by highly specific transport

systems, whereas the exchange between periplasm and environment occurs via porins which may

be unspecific or specific for groups of substances (Saier, 2000). Rhizobia face unfavorable

conditions both in the soil environment and during symbiosis establishment due to plant defense

activation. Transporters allow them to survive in most cases. A large number of ABC transporters

are encoded by pSymB. Using 2-D gel electrophoresis followed by peptide mass fingerprint,

Djordjevic et al. (2003) identified 23,9% of the proteins encoded by the 430 ABC transport system-

encoding genes reported by Finan et al. (2001).

After ABC transporters, the Major Facilitor Superfamily (MFS) class is the second largest

family of membrane transporters found. Members of this superfamily are typically single-

polypeptide secondary carriers, comprising 10-14 transmembrane α-helices, which are able to


5

transport small solutes such as sugars or toxins in response to chemiosmotic ion gradients. MFS

can also be multidrug efflux pumps involved in the resistance to various antibiotics and toxic

compounds. In S. meliloti, tep1 gene product shows similarities with members of the MFS

transporters and is a transmembrane protein which can confer chloramphenicol resistance by

expelling the antibiotic outside from bacteria. Moreover, a deletion mutant for this protein showed

an improved nodulation of alfalfa (Dillewijn et al., 2009).

Several others transporters are present in the S. meliloti genome and some of them play an

important role in the physiology and biochemistry of nodule bacteria. Sugars are not utilized by

bacteroids, instead amino acids are an important carbon source. Therefore, no protein involved in

sugar transport has been detected in nodule bacteria, but several transporters for amino

compounds are present. These transporters are encoded by genes SMc01946 (leucine);

SMc02118, SMc00140 and SMb20428 (amino acids); SMb21196 (oligopeptides); and SMc04439

(glycine betaine). Multiple transporters for iron (FbpA and SitA) and phosphate (PhoD and

SMc02146) are also present (Djordjevic et al., 2003).

1.3.2. Adaption of S. meliloti to stress conditions

The process of nitrogen fixation is dependent on the physiological state of the host plant and

the availability of nitrogen in the soil, directly affecting its symbiotic partner. In addition, S. meliloti

must adapt to the stress situation imposed by plant defenses during the infection process and to

the nodule environment. Exopolysaccharides (EPS), capsular polysaccharides (KPS),

lipopolysaccharides (LPS) and cyclic-β-glucans are important factors for rhizobial invasion of plant

tissues, avoiding plant defense responses and helping bacteroid maintenance in symbiosomes

(Batut et al., 2011). However, several environmental conditions are also limiting factors to the

growth and activity of both plants and bacteria, like water stress, salinity, soil pH, temperature,

heavy metals, nutrient deficiency and mineral toxicity (Fig. 1.1). Response and adaptation to

environmental stresses by both organisms constitute a complex phenomenon involving many

physiological and biochemical processes that reflect changes in gene expression and in the

activities of enzymes and transport proteins. Since the genes we are studying are predicted to be

involved in various stress conditions, the present knowledge on the mechanisms used by S. meliloti

to adapt to some of these environmental stress conditions is described below.

Oxidative stress

The key enzyme of nitrogen fixation, the nitrogenase, is subjected of an irreversible

inactivation by oxygen. Therefore, nodules have a diffusion barrier in the cortex to limit oxygen

passage and also leghemoglobin, a plant oxygen carrier that delivers the necessary oxygen to the

bacteroids. However, a high respiration rate is required to support the nitrogen fixation process,

and this leads to the generation of large amounts of reactive oxygen species (ROS) such as


6

superoxide radicals (O2−) and hydrogen peroxide (H2O2), which can also inactivate the nitrogenase.

H2O2 accumulation was observed in some infection threads but never inside bacteroids, indicating

an efficient H2O2-scavenging system (Jamet et al., 2005). S. meliloti encodes a set of enzymes

against ROS, including superoxide dismutases, catalases and alkylhydroperoxidases, but this

oxidative stress is a complex process not yet fully understood. In fact, some genes required for

defense against ROS in the free-living state are dispensable for symbiosis, as well as different

responses may be required only at different stages to allow bacteria to further proceed in

symbiosis.

S. meliloti has two monofunctional catalases encoded by katA and katC genes, a bifunctional

catalase-peroxidase encoded by katB, superoxide dismutases encoded by sodA and sodB and

other uncharacterized ROS scavenging enzymes. Mutation of any of the three kat genes does not

affect H2O2 sensitivity, but a katA/katC and a katB/katC double mutants are deficient in nodule

formation and nitrogen fixation (Jamet et al., 2003; Saeki, 2011), whereas a disruption of the global

regulator of H2O2 protection, oxyR, makes the free-living strain extremely sensitive to H2O2 but

does not affect symbiosis (Jamet et al., 2005).

Iron and manganese are important metals for oxidative stress protection. Iron is used as a

cofactor of defense enzymes such as catalase, although in the Fe2+ state it can produce hydroxyl

radicals from peroxides through Fenton chemistry. Manganese ions help by scavenging both H2O2

and O2-, as part of low-molecular-weight complexes with cellular ligands such as phosphate,

lactate, or bicarbonate. A mutation of sitA, a periplasmic binding-protein of the putative

iron/manganese ABC transporter SitABCD reveals a high sensitivity to ROS, leading to a severe

decrease in SodB protein level and activity (Davies & Walker, 2007a).

Other gene important in either symbiosis or oxidative stress protection is cycK. This gene is

part of the cycHJKL operon and is involved in cytochrome c-type biosynthesis. In S. meliloti, c-type

cytochromes are required for nitrate reduction in free-living form and nitrogen fixation in root

nodules (Davies & Walker, 2007b).

Osmotic stress

Nearly 40% of the world’s land surface has potential salinity problems (Zahran, 1999). Most

legumes are sensitive to relatively low levels of salinity and rhizobia are sensitive to salinity both at

the free-living stage and during the symbiotic process. M. sativa is salt tolerant, but the Rhizobium

spp. and legume symbiosis is highly sensitive to salt or osmotic stress, since these conditions may

inhibit the initial steps of the symbiotic interaction like root colonization, nodule infection and nodule

development and also have a negative effect on nitrogen fixation. Nogales et al. (2002) observed

that Rhizobium tropici mutants by the adaptation to high salinity showed deficiencies in their

symbiotic capacity. Soybean root hairs also displayed little curling or deformation when inoculated

with Bradyrhizobium japonicum in the presence of 170 mM NaCl, and nodulation was completely

suppressed by 210 mM NaCl (Tu, 1981).


7

S. meliloti may use distinct mechanisms for osmotic adaptation upon salt stress, such as the

intracellular accumulation of low-molecular-weight organic solutes called osmolytes, which are

described as compatible solutes because they do not interfere with the metabolism. Some

exogenous osmolytes identified in bacteria are: sugars (e.g. sucrose, trehalose), polyols (e.g.

sorbitol, mannitol), amino acids and derivates (e.g. proline, glutamate, glutamine), pipecolic acid,

ectoine, glycine betaine and derivatives (Costa et al., 1998; Fernandez-Aunión et al., 2010). The

osmoregulation strategy in S. meliloti is atypical compared to other bacteria, since only the

osmoprotectant glycine betaine is accumulated within stressed cells, while the others are

catabolized (Fernandez-Aunión et al., 2010). BetS was identified as a major glycine betaine

transporter required for early osmotic adjustment in S. meliloti to high salt concentrations (Rüberg

et al., 2003). Besides the protection of glycine betaine, the primary response to a hyperosmotic

stress is the stimulation of potassium (K+) uptake. S. meliloti has four potassium uptake systems:

Kup1, Kup2, Trk, and Kdp. Two of these K+ transport systems, Trk and Kup1, were reported as

required for bacterial growth even under osmotically balanced conditions and the absence of both

systems leads to a reduced infectivity and competitiveness of the bacteria in alfalfa roots

(Domínguez-Ferreras et al., 2009).

Acid tolerance

Approximately ¼ of the world’s agriculture soils are acidic and there is an increasing concern

about soil acidification (Tiwari et al., 1996a). Soil acidity affects both the growth and survival of

Rhizobium and its host plants. Most leguminous plants require a neutral or slightly acidic soil for

growth, especially when they depend on symbiotic nitrogen fixation. When in the soil, rhizobia face

an acidic environment due to the presence of protons and organic acids excreted by the plant. S.

meliloti has been described as the most sensitive rhizobia to low pH. It presents poor survival at pH

values below 6.0, whereas some strains of Mesorhizobium loti have shown a high degree of acid

tolerance in laboratory, being capable of growing at pH values as low as 4.0 (Rickert et al., 2000).

Most bacteria maintain a relatively constant internal pH (pHi) over a range of external pH

(pHe). S. meliloti maintains a slightly alkaline pHi even when the pHe is acidic. This control of pH

presumably involves one or more mechanisms for regulating the influx and efflux of protons across

the cytoplasmic membrane. Little is known about such mechanisms or how the cells sense

changes in the pHe, but it has been proposed that S. meliloti may have a signal transduction

system for pH environment sensing and response (Tiwari et al., 1996a). Four genes have been

reported as essential for S. meliloti growth at acid pH: a gene pair (actS/actR), an ATPase (actP),

and another gene involved in lipid metabolism (actA). actR/actS encode the response regulator

ActR which is activated by its corresponding sensor histidine kinase ActS, whose loss leads to

sensitivity to low pH. ActR also regulates the expression of some genes involved in nitrate

assimilation as well as the nitrogen fixation regulator genes fixK and nifA (Hellweg et al., 2009;

Reeve et al., 2002).


8

Copper homeostasis is another mechanism for the acid tolerance of root nodule bacteria

which prevents this heavy metal from becoming overtly toxic in acidic conditions. Higher free

copper concentrations will occur at lower pH, resulting in greater influx into the cell and the means

for exporting excess copper are essential to the cell (Reeve et al., 2002). ActP is a P-type ATPase

that belongs to the CPx family with considerable similarity to putative cation-transporting P-type

ATPases from numerous organisms, which recognizes and transport heavy metals like copper

(Reeve et al., 2002). In the same way, ActA is a lipid-metabolizing protein which, if inactivated,

results in an heavy metals-sensitive phenotype (Tiwari et al., 1996b).

Beyond these genes, S. meliloti has a range of acid-responsive genes, which are not

themselves critical to growth at low pH. One of these (phrR) is itself a regulator gene induced by

acid pH and a range of stresses including high concentrations of Zn2+, Cu2+, H202 or ethanol, but

not controlled by the ActS/ActR system (Reeve et al., 1998). Another, a putative transmembrane

protein lpiA, responds specifically to acidity and may be an antiporter related to nhaB, which is

involved in Na+ transport in other bacteria (Reeve et al., 2006).

1.4. Role of multidrug efflux systems in symbiosis

An important group of inner membrane efflux pumps interacts with the outer membrane

channel proteins to form complexes that transverse the inner membrane, periplasm, and outer

membrane. In E. coli, TolC is the major outer membrane channel, which plays an important role in

the excretion of a wide range of molecules, including antibiotics, bile salts, organic solvents,

enterobactin, several antibacterial peptides, and also a large protein toxin, α-hemolysin (Horiyama

et al., 2010). TolC protein folds into a remarkably similar three-dimensional homotrimeric structure

with an outer membrane-embedded β-barrel domain and a large α-helical domain extending into

the periplasm (Misra & Bavro, 2009). TolC associates with different inner-membrane protein

systems such as the Resistance Nodulation Division (RND) family transporter AcrB or the MFS

transporter ErmB, both driven by proton influx, or the ABC transporter MacB driven by ATP

hydrolysis. The cognate periplasmic Membrane Fusion Protein (MFP) such as AcrA, ErmA and

MacA, respectively, stabilize these transporter-channel interactions (Deininger et al., 2011).

AcrAB/TolC is a well known tripartite efflux pump involved in the resistance to various compounds,

such as acriflavine, colicin, antibiotics and lipophilic molecules in E. coli (Kang & Gross, 2005;

Misra & Bavro, 2009).

TolC protein of S. meliloti was identified as important for nitrogen fixation symbiosis. Cosme

et al. (2008) observed that a tolC gene insertion mutant of S. meliloti induced none or only very few

nodules in M. sativa roots and these nodules did not fix nitrogen. This mutation also affects the

bacterial resistance to antimicrobial plant agents such as coumaric acid, genistein and berberine

and cells became more susceptible to osmotic and oxidative stress. In order to understand the

contribution of TolC protein from S. meliloti to the physiology of the cell, Santos et al. (2010)

compared the transcriptome of TolC mutant with the one of wild-type S. meliloti 1021. Data showed


9

an increased expression in the tolC mutant of genes that encode for proteins involved in stress

response, central metabolic pathways and many transporters. Genes whose expression was found

decreased are involved in nitrogen metabolism, transport and cell division. In the analysis of the

genes with increased expression and involved in transport processes, it was observed that genes

SMc03167 and SMc03168 were more than 40-fold upregulated when the tolC mutant

transcriptome was compared against the wild-type. In the wild-type strain, these genes encode a

MFS-like transporter system that, together with TolC protein, forms a tripartite efflux pump probably

responsible to excrete toxic compounds and/or not yet identified cellular metabolites. Although,

there is no biochemical data on SMc03167 and SMc03168 proteins, several experiments showing

their altered expression under several conditions is found in the literature. As an example, Rüberg

et al. (2003) monitored the S. meliloti 1021 gene expression in response to an osmotic upshift and

found that the expression of SMc03167 and SMc03168 was repressed. Furthermore, Hellweg et al.

(2009) carried a global transcriptional analysis of S. meliloti 1021 genome to identify genes

responding to a pH shift from 7.0 to pH 5.75. The response to acidic pH involved whole sets of

genes associated with various cellular functions and, among these genes, SMc03167, SMc03168

and SMc03169 were transiently up-regulated during a short period of time following the pH shift. In

another report, Capela et al. (2005) analyzed the S. meliloti transcriptome in response to the

overexpression of nodD1 and the plant flavonoid luteolin. They identified new genes regulated by

both luteolin and NodD1 and among them were SMc03167 and SMc03168 with a 16-fold increase

in the presence of luteolin. SMc03168 gene was also found to have a luteolin-induction by Barnett

et al. (2004), showing to be repressed by NodD1 in the absence of luteolin, whereas it was

expressed upon luteolin addition. Moreover, a SMc03167 null mutant showed to be as competitive

as wild-type for nodulation. Data also showed that SMc03169, a divergently transcribed

transcription regulator, was induced 3-fold by luteolin. Although its role remains to be determined

(Capela et al., 2005), SMc03169 protein belongs to a family of repressors (TetR) and might be

responsible for the induction of these genes.


10

2. Objectives

Many S. meliloti genes have no confirmed function and some of them may have a role in

symbiosis. Among these uncharacterized genes are SMc03167, SMc03168 and SMc03169 which

are expected to be related to bacterial resistance to toxic compounds. The aim of this thesis was to

further elucidate the role of the two transporter encoding genes (SMc03167/SMc03168), as well as

the adjacent gene SMc03169 encoding a putative transcriptional regulator, to determine under

which conditions are they expressed and evaluate their possible involvement in the establishment

of symbiosis with Medicago plants.

3. Experimental Approach

In order to fulfill these objectives the following experiments were performed:

1. In silico analysis of the genes and their predicted functions;

2. Construction of deletion mutant strains;

3. Comparison of the growth curves in complex and minimal medium between wild-type and

mutants;

4. Analysis of the behavior at low pH between wild-type and SMc03169 mutant;

5. Measurement of the sensitivity towards antimicrobials and other stresses between wild-

type and mutants;

6. Comparison of the efflux activity of a toxic compound ethidium bromide between wild-type

and mutants;

7. Characterization of the symbiotic phenotype with the leguminous plant M. sativa, by

performing symbiosis assays between wild-type and mutants.

With this set of experiments we expected to get a better knowledge on the role of this efflux

system and on the mechanisms underlying the establishment of the symbiosis between S. meliloti

and M. sativa.


11

4. Materials and Methods

4.1. Bacterial strains and plasmids

Bacterial strains and plasmids used in this study are listed in Table 4.1. Fresh cultures were

obtained by transferring a portion of the frozen cellular material at -80ºC to plates of selective solid

medium (described in 4.2), followed by incubation at proper temperature, until visible cell growth.

These cultures were then maintained at 4ºC until further use.

Table 4.1. Strains and plasmids used in this study.

Strains/Plasmids Relevant characteristics References

S. meliloti

Sm1021 Sm1021 Wild-type, Su47 Smr Leigh et al., 1985

SmLM030-2 Sm1021, pLS378 integrated into the tolC gene region, Neor Smr Cosme et al., 2008

Sm1021-7 Sm1021∆ SMc03167, Smr This work

Sm1021-9 Sm1021∆ SMc03169, Smr This work

Sm1021/pMAS17 Sm1021::pMAS17 Smr Tetr This work

Sm1021-9/pMAS17 Sm1021-9::pMAS17 Smr Tetr This work

E. coli

S-17 E. coli 294, thi RP4-2-Tc::Mu-Km::Tn7 chromosomally integrated Simon et al., 1983

XL1-Blue (supE44 hsdR17recA1 endA1 gyrA96 thi relA1 lac- ) F´[proAB

+ lacIq

lacZ∆M15 Tn10(tetr). The F´in this strain allows blue/white screening on X-

Gal

Bullock et al., 1987

αDH5 recA1 ∆lacU169,φ80 lacZ∆M15 BRL

Plasmids

pk19mobG oriColE1 Mob+ lacZ+, Kmr in E. coli, Neor in S. meliloti Katzen et al., 1999

pPHU231 broad host range low copy vector in E. coli, Tetr Reyes et al., 1996

pLS378 pK19mob2ΩHMB containing a 1368 bp internal fragment of tolC gene Cosme et al., 2008

pAFM01-2 pK19mobG containing the 2040 bp and the 2020 bp fragments upstream

and downstream, respectively, of SMc03167 gene, Kmr

This work



This work



This work

pMAS17 pPHU231 containing a 1207 bp fragment with the SMc03169 gene under the

control of its own promoter in E. coli S-17, Tetr

This work

Nxr, Smr, Tetr, Neor and Kmr = resistant to nalidixic acid, streptomycin, tetracycline, neomycin and kanamycin,

respectively.


12

4.2. Bacteria growth conditions

E. coli strains were grown in Luria Broth (LB) medium (Sambrook et al., 1989) at 37ºC with

orbital agitation (250 rpm). S. meliloti strains were grown in Triptone-Yeast (TY) medium (Beringer,

1974) or Glutamate–Mannitol–Salts (GMS) medium (York & Walker, 1997) at 30ºC with orbital

agitation (180 rpm). Solid medium was prepared by adding 20.0 g/L Agar.

Media was supplemented with antibiotics when required at the following concentrations

(µg/ml): for S. meliloti 1021 (a streptomycin-resistant strain), streptomycin 600, neomycin 120 and

tetracycline 10; for E. coli, kanamycin 50 and tetracycline 10. With the exception of tetracycline, the

antibiotics were dissolved in water and sterilized by filtration with 0.2 µm pore size filter.

Tetracycline was dissolved in 70% ethanol. Stock solutions at 10 mg/ml were prepared for p-

coumaric acid, berberine (5,6-dihydro-9,10-dimethoxybenzo-1,3-benzodioxoloquinolizimium) and

genistein (4,5,7-trihydroxyisoflavone). p-coumaric acid was dissolved using 95% ethanol, berberine

was dissolved in water and genistein was dissolved in DMSO. 5-Bromo-4-chloro-3-indoxyl-β-D-

glucuronide CHA salt (X-Gluc) was dissolved in N,N-dimethylformamide at 80 mg/ml stock solution.

Ethidium bromide was dissolved in water at 5 mg/ml stock solution and luteolin was dissolved in

100% ethanol at 4 mg/ml stock solution.

4.3. Plant growth conditions

M. sativa seeds were surface sterilized with concentrated sulfuric acid for 10 min and

washed several times with large volumes of sterile water. Seeds were kept at 4ºC over 2 days, and

then allowed to germinate on 1.5% agar plates at 30ºC, in the dark for 24h. Seeds were then grown

on BNM medium (Rolfe et al., 1980) and inoculated with cultures of S. meliloti strains. Each plate

contained three plantlets which were inoculated with 200 µl of S. meliloti cell suspension

(OD600nm=0.0001; 104 cells). Plants were grown under a 16h light: 8h dark cycle for 5 weeks. The

nodulation process was followed by counting the number of white (immature) and pink (mature)

nodules of each plant on a weekly basis.

Bacteria were isolated from several nodules and colony forming units (CFU) counted. Briefly,

the nodules were harvested from the roots of M. sativa, surface-sterilized with 70% ethanol for 1

min, washed with sterile water, and crushed in TY medium. These bacterial suspensions were

diluted and plated on TY plates containing streptomycin.

4.4. Extraction of genomic and plasmid DNA

Genomic DNA extraction from S. meliloti 1021 was carried out using glass beads to lyse

cells, followed by purification with phenol/chloroform and precipitation with isopropanol as

described in Sambrook & Russell (2001). For restriction analysis, plasmid DNA from E. coli was


13

extracted using the minipreps method described by Sambrook & Russell (2001). When higher

purity was required, plasmid extraction was carried out using the QIAprep® Spin Miniprep Kit

(Qiagen) following the procedures recommended by the manufacturer.

4.5. Construction of S. meliloti deletion mutants

For the construction of the SMc03167, SMc03168 and SMc03169 deletion mutants, the

flanking regions of each gene were cloned into the suicide vector pK19mobG. The primers used to

amplify the region upstream and downstream of the ORFs under study are present in Table 4.2.

Amplification reactions were carried out using an initial step of denaturation for 3 min at 94ºC,

followed by 30 cycles of 45 s at 94ºC for denaturation, 30 s at an optimized annealing temperature

for primer annealing (Table 4.2), 2.5 min at 72ºC for polymerization; and a final elongation step at

72ºC for 10 min. All PCR products were visualized after electrophoresis in a 0.8% agarose gel and

staining with GelRed (Biotium).

Table 4.2. Primers used to amplify the flanking regions of the SMc03167, SMc03168 and SMc03169 ORFs.

ORF Fragments Primer UP Primer LOW Anneling

(ºC)

Size

(bp)

SMc03167 Left CAT GAATTC CTG GAA ACC CTC CTG GGTACC GCC AAG CCA CAA 55,0 2040

Right TGT GGTACC TGC GGC CAT TTC CCG AAGCTT GCT GGT CGA GAT 55,0 2020

SMc03168 Left CAA GGTACC TCG GCT TTC CTC GTC GGATCC GCG AAG TAA AGG 56,0 2067

Right GGC GGATCC CGA ATG AGT ATC TCC AAGCTT GGA CAC GAC AGA 56,0 2155

SMc03169 Left GGC GGTACC TTC CTC CAG CAC CTC GAATCC CTT CGC TGA TAC 56,7 2233

Right ACG GGATCC AAG GAG TAA AAG CCG AAGCTT GCA AAG ATC ACC 55,0 1959

The plasmids that contained the correct construction, pAFM01-2, pAFM09-1 and pAFM09-2

(Table 4.1), were introduced in electrocompetent E. coli S-17 cells by electrotransformation. A

volume of 5 µl of plasmid DNA was mixed with an aliquot of 100 µl of electrocompetent E. coli cells

and the suspensions were transferred into an appropriate cuvette. The electrotansformation

apparatus (400 Ω, 25 µFD, 2.5 kV) was applied to the cuvette. After electrotransformation, cell

suspensions were recovered from the cuvette with 1 ml of liquid LB media and incubated for 1h at

37ºC with orbital agitation (250 rpm). These cultures were plated onto the surface of LB plates

supplemented with 40 µl/plate X-Gal (25 mg/ml) and 10 µl/plate IPTG (25 mg/ml) followed by

incubation overnight at 37ºC. White colonies were selected.

After transformation, the plasmids were mobilized to S. meliloti 1021 by conjugation and

colonies were selected in the presence of neomycin for the first crossover. For this, bacterial

strains E. coli S-17 and S. meliloti strains were grown in selective liquid media until the exponential

growth phase (OD640nm≈0.4 for E. coli and OD600nm≈1.6 for S. meliloti), the suitable volume from


14

each strain (Table 4.3) was then harverested and mixed in the same tube, cells were then washed

by centrifugation for 1 min at 13000 rpm, at room temperature in a table-top microcentrifuge and

ressuspended in TY medium. Cells were harvested by a second centrifugation. The resulting pellet

was re-suspended in residual supernatant and spot-inoculated on the surface of a TY plate

followed by overnight incubation at 30ºC. The bacterial layer on the surface of the plate was re-

suspended in TY medium, dilutions were prepared and 50 µl were plated on appropriate selective

medium, thus enabling the positive selection of transconjugants.

Table 4.3. Co-relation between OD and volume used in

conjugation.

OD640nm Volume

E. coli

0.3 200 µl

0.4 150 µl

0.6 100 µl

OD600nm Volume

S. meliloti

1.6 200 µl

2.2 150 µl

Strains with the first recombination event were grown in TY medium at 30ºC with orbital

agitation (180 rpm) during 8 days. Colonies where the second crossover occurred were selected by

blue/white screen in the presence of X-Gluc (80 mg/ml).

In order to complement the SMc03169 deletion mutant, a 1207 bp fragment containing

SMc03169 under the control of its own promoter was amplified by PCR using primers P03169-up

(5’ - GGCGAATTCTCCACCAATCAT) / P03169-low (5’ – GGCGAATTCGCTTTTACTCCT) and

Sm1021 genomic DNA as a template. The amplified fragment was inserted into the EcoRI site of

broad host range vector pPHU231 and the resulting plasmid was named pMAS17 (Table 4.1).

4.6. Mutant genotype confirmation

The confirmation of the deletion of each of the genes under study from the constructed

mutants was done by PCR amplification using primers for the gene that was eliminated. PCR

reactions were done for each candidate, differing only in the DNA template used (DNA from the

mutant or from the wild-type strain). To prepare the template DNA for PCR, cells were harvested

from a plate and ressuspended in 50 µl of sterile water, boiled for 5 min and then centrifuged for 1

min at 13000 rpm. The supernatant was then used for PCR as DNA template.


15

4.7. Growth curves

Growth behavior was examined as follows: 50 ml of liquid TY or GMS media supplemented

with appropriated antibiotics were inoculated with the strains under study (Sm1021 or the deletion

mutants), and incubated overnight at 30ºC, with orbital agitation (180 rpm). Then, 50 ml of liquid TY

or GMS medium were inoculated with previously grown culture to an initial OD600nm=0.1 and

incubated under the same conditions. Growth was followed spectrophotometrically by measuring

OD at 600nm for approximately 72h. To confirm the differences observed in GMS medium, colony

forming units (CFUs) counting was also performed.

4.8. Polyacrylamide gel electrophoresis

To search for changes in the strains protein expression patterns, an appropriate culture

volume was harvested (V=1.2/DO600nm) at different times to prepare cell extracts. Cells were then

centrifuged for 2 min at 13200 rpm at room temperature and the pellets were solubilized in SDS

sample buffer (100 mM Tris-HCl pH 6.8; 4% (w/v) SDS; 20% (v/v) glycerol; 0.2 M β-

mercaptoethanol; 0.2% (w/v) bromophenol blue) to yield a preparation of total cellular proteins.

Proteins from cell extracts were visualized by vertical SDS-PAGE in 12.5% acrylamide (Sambrook

& Russell, 2001) stained with Coomassie Brilliant Blue R-250 (40% Methanol, 10% Glacial acetic

acid, 0.05% Brilliant Blue R-250).

4.9. Zone inhibition assays

Cultures of strains under study were grown overnight and approximately 106 cells were

plated in TY or GMS agar. Sterile paper disks with 6 mm diameter were placed on the surface of

the agar. A total of 10 µl of p-coumaric acid (750, 1000 and 1500 µg/ml), berberine (2000, 2500

and 3000 µg/ml), genistein (2000 and 3000 µg/ml), SDS (10 and 20% [wt/vol]), H2O2 (10, 50 and

100 mM and 1 M), cumene hydroperoxide (5% [wt/vol]), and DOC (10% [wt/vol]) was pipetted onto

separate disks. The plates were incubated for 48h at 30ºC and the diameters (in millimeters) of the

inhibition zones were measured.

4.10. Ethidium bromide supplemented agar screening method

To analyze the extrusion capacity of the mutants to the toxic compound ethidium bromide,

cultures of strains under study were swabbed onto TY plates containing ethidium bromide

concentrations ranging from 0.5 to 1.5 mg/L, following the procedure described by Couto et al.

(2008). The plates were incubated at 30ºC for 24h and fluorescence was viewed under UV light.


16

5. Results and Discussion

5.1. Sequence analysis of ORFs SMc03167, SMc03168 and SMc03169

ORFs SMc03167, SMc03168 and SMc03169 are present on the chromosome of S. meliloti

1021 and are expected to be related to bacterial resistance to toxic compounds. DNA sequence

analysis suggests that the two first genes may encode a transporting system that together with

TolC protein forms a tripartite efflux system and the last one a transcriptor factor. SMc03167 and

SMc03168 ORFs are located in the negative strand, between positions 3127155 to 3128744 and

3128773 to 3129921, respectively. SMc03169 ORFs is encoded in the positive strand between

positions 3130227 to 3130937 (Fig. 5.1). These three ORFs are predicted to encode proteins of

529, 382 and 236 amino acids, respectively. In silico analysis of the amino acid sequence encoded

by these three genes using various online tools available on the web was carried out.

Fig. 5.1 - Genetic organization of the SMc03167, SMc03168 and SMc03169 ORFs (information retrieved from the S. meliloti

genome website http://iant.toulouse.inra.fr/bacteria/annotation/cgi/rhime.cgi).

ORF SMc03167 is predicted to contain typical domains of MFS transporters of the

subfamilies ErmB/QacA and TetB (Fig. 5.2A). Several members of the MFS family are multidrug

efflux pumps involved in the resistance to various antibiotics and toxic compounds. Examples are

ErmB from E. coli, involved in the excretion of toxic compounds (Lomovskaya & Lewis, 1992) and

QacA, a multidrug efflux protein from Staphylococcus aureus, being important in the maintenance

and dissemination of important Methicillin-resistant Staphylococcus aureus (MRSA) strains (Costa

et al., 2010). In order to predict the cellular location of the SMc03167 protein, a TMHMM module

available on the Expasy server was used. SMc03167 protein has a signal peptide and is predicted

to be integrated into the inner membrane, with 13 transmembrane helices (Fig. 5.3A).

The protein encoded by SMc03168 contains a conserved domain of HlyD protein (Fig. 5.2B),

which makes the connection between the inner membrane and outer membrane protein TolC. This

protein has a signal peptide and a transmembrane helix in the N-terminal and should be inserted in

the inner membrane, facing the periplasm (Fig. 5.3B).

SMc03169 encodes a protein which shares homology with transcription regulators from the

TetR family and is predicted to have an N-terminal DNA-binding site of helix-turn-helix (HTH) type

(Fig. 5.2C). TetR family is a family of repressors which are involved in the transcriptional control of

multidrug efflux pumps, pathways for the biosynthesis of antibiotics, response to osmotic stress

and toxic chemicals (Ramos et al., 2005). This protein is more likely cytoplasmic, showing no

transmembrane helix domains (Fig. 5.3C).


17

Fig. 5.2 - Conserved motifs present in SMc03167 (A), SMc03168 (B) and SMc03169 (C) proteins. These motifs were

obtained using the InterProScan tool available in www.expasy.ch.

Fig. 5.3 - Predicted number of transmembrane helices of SMc03167 (A), SMc03168 (B) and SMc03169 (C), using the

TMHMM software from www.expasy.ch.

A

B

C

A B

C


18

Simultaneous with the tool used before, a basic alignment search involving the BLASTP tool

from the National Center for Biotechnology Information database (NCBI) was employed, confirming

the homology between our proteins and proteins from databases. Again, SMc03167 shares

homology with multidrug efflux pumps from other organisms (Table. 5.1A); SMc03168 is

homologous with the other component from efflux pumps like HlyD (Table. 5.1B), an adaptor

component of the Hly transporter in which the N-terminal end interacts with the substrate in the

cytoplasm (Delepelaire, 2004); and SMc03169 is a probable transcription regulator from TetR

family (Table. 5.1C), generally involved in the repression of genes that control susceptibility to

hydrophobic compounds and detergents. As expected, the analysis of these protein sequences

showed a highest similarity between members of the Rhizobiaceae order, such S. medicae, S.

fredii and R. etli (above 75% identity).

Table 5.1 - Similarity searches for SMc03167 (A), SMc03168 (B) and SMc03169 (C) at the amino acid level using the

BLASTP algorithm.

Homologous Proteins Organisms Identity (%) /

Similarity (%) Access. Nº

A. SMc03167

Drug resistance transporter, EmrB/QacA

subfamily

Sinorhizobium medicae WSM419 97 / 98 ABR61624.1

Sinorhizobium fredii NGR234 90 / 94 ACP26695.1

Probable multidrug efflux transporter, permease

protein Rhizobium etli CIAT 652 77/ 89 ACE92859.1

Bcr/CflA subfamily drug resistance transporter Brucella suis bv. 5 str. 513 70 / 81 EEY27557.1

Multidrug resistance protein B Rickettsia felis URRWXCal2 51 / 69 AAY61975.1

B. SMc03168

Secretion protein HlyD family protein Sinorhizobium medicae WSM419 92 / 95 ABR61625.1

Putative multidrug resistance protein Sinorhizobium fredii NGR234 84 / 92 ACP26696.1

Multidrug resistance efflux protein Rhizobium etli CFN 42 74 / 85 ABC92407.1

HlyD family secretion protein Brucella pinnipedialis B2/94 60 / 75 ZP_05173194.1

Secretion protein HlyD family protein Burkholderia multivorans ATCC

17616 44 / 61 ABX18359.1

C. SMc03169

TetR family transcriptional regulator Sinorhizobium medicae WSM419 89 / 91 ABR61626.1

Putative transcriptional regulator, TetR family Sinorhizobium fredii NGR234 82 / 90 ACP26697.1

Transcriptional regulator, TetR family Rhizobium leguminosarum bv.

trifolii WSM2304 57 / 73 ACI56683.1

Transcriptional regulator, TetR family protein Brucella sp. NF 2653 48 / 60 EFM63755.1

TetR family transcriptional regulator Rhodopseudomonas palustris

BisB5 41 / 56 ABE40631.1

Role of a tripartite efflux pump in the symbiosis

To get further insights into

proteins could be involved, the

genes of S. meliloti genome were analyzed

possible to infer much about their

Fig. 5.4 - Genetic organization and putative role of the adjacent genes of the ORFs SMc03167, SMc03168 and SMc03169.

To evaluate whether SMc03167, SMc03168 and SMc03169

within the S. meliloti encoding

S. meliloti genome using the MultA

show in Fig. 5.5.

Fig. 5.5 - Phylogram tree comprising the SMc03167 (A), SMc03168 (B) and SMc03169 (C)

proteins of S. meliloti 1021. The sequences were aligned by Mult

http://iant.toulouse.inra.fr/bacteria/annotation/cgi/rhime.cgi) and sorted by Tree View.

clusters.

The cluster obtained for SMc03167 gene relate

drug or other small molecules efflux. The SMc03167

A

Role of a tripartite efflux pump in the symbiosis between Sinorhizobium meliloti

further insights into the function or process in which these putative

the surrounding genetic organization and putative role of the adjacent

were analyzed (Fig. 5.4). However, from the neighbor genes it

much about their function since they are flanked by non-characterized genes.

Genetic organization and putative role of the adjacent genes of the ORFs SMc03167, SMc03168 and SMc03169.

SMc03167, SMc03168 and SMc03169 proteins had other homolog

encoding genes with similar functions, their sequences were aligned

using the MultAlin server. The phylograms obtained from these alignments are

tree comprising the SMc03167 (A), SMc03168 (B) and SMc03169 (C) proteins

1021. The sequences were aligned by MultAlin server from the S. meliloti

http://iant.toulouse.inra.fr/bacteria/annotation/cgi/rhime.cgi) and sorted by Tree View. The square

obtained for SMc03167 gene related with MFS transport systems involved in

ecules efflux. The SMc03167 must related homologues are SMc00563, a

B C

inorhizobium meliloti and leguminous plants

19

putative efflux system

surrounding genetic organization and putative role of the adjacent

rom the neighbor genes it was not

characterized genes.

Genetic organization and putative role of the adjacent genes of the ORFs SMc03167, SMc03168 and SMc03169.

proteins had other homologues

were aligned against

obtained from these alignments are

proteins and homologous

S. meliloti genome website

quares are the considered

with MFS transport systems involved in

homologues are SMc00563, a


20

putative transport protein with transmembrane domains, SMb20698, a putative transport protein

similar to E. coli protein EmrB encoded by pSymB, and SMc01217, another predicted MFS

transport protein. The SMc03168 gene is integrated in a cluster of secretion proteins, which

constitute adaptors to multidrug systems. The SMc03168 homologues are SMb20699, a putative

multidrug resistance efflux protein located on pSymB; and SMc00564, a multidrug resistance

protein involved in a small molecules transport. The cluster related with SMc03169 included

regulators not yet classified, but most of them included in the TetR family.

In order to model the three-dimensional structures of the proteins under study, their

sequences were submitted to the Swiss-Model server. It was possible to obtain a tridimensional

model for the three proteins under study. The model of the protein SMc03167 was obtained based

on the crystal structure of the glycerol-3-phosphate transporter (1pw4) from E. coli (Fig. 5.6A). The

SMc03168 structure was based on the crystal structure of the MacA protein (3fpp) from E. coli (Fig.

5.6B), which is involved in macrolide transport. It was also possible to obtain the model of the

SMc03169 protein based on the crystal structure of TetR-family transcriptional regulator (3bhq)

from Mesorhizobium loti (Fig. 5.6C).

Fig. 5.6 - Models for tridimensional structure of SMc03167 (A), SMc03168 (B) and SMc03169 (C) proteins computed at

swissmodel.expasy.org. Sequence identity between the protein models and the queries SMc03167, SMc03168 and

SMc03169 were 14, 20 and 21%, respectively.

5.2. Construction of deletion mutant strains

In order to construct single S. meliloti SMc03167, SMc03168 and SMc03169 gene deletion

mutants, the flanking regions of the gene under study were cloned into the suicide vector

pK19mobG (Fig. 5.7). This vector is Mob+, which enables plasmid transfer by RP4-mediated

conjugation and has a gusA gene encoding a β-glucuronidase enzyme, which facilitates discerning

between gene replacement and plasmid integration by simply observing the color of the colonies in


21

the presence of X-Gluc. A lacZα gene also enables blue-white selection in E. coli (Katzen et al.,

1999).

Fig. 5.7 - Schematic representation of the S. meliloti SMc03167 deletion mutant construction. This strategy was applied to

all the ORFs under study.

The construction of the S. meliloti mutants was done by following the strategy described in

Materials and Methods. This strategy was applied for all the ORFs under study and the following

steps were carried out:

1. PCR amplification of the left and right flanking regions

2. Restriction of the vector and the purified PCR products

3. Ligation of the left fragment to the vector and electrotransformation

4. Candidate selection by extraction of the plasmid DNA and restriction analysis

5. Ligation of the right fragment to the previous construction and electrotransformation

6. Candidate selection by extraction of the plasmid DNA and restriction analysis to confirm

the final construction.

7. Electrotransformation to E. coli S-17

8. Bi-parental mating to Sm1021 and selection for single recombination (neomycin

resistance)

9. Screening for double recombination induced by nutrient starvation

10. Mutant confirmation by PCR

As an example of the followed strategy the construction of the mutant on SMc03167 will be

fully described. As a first step, PCR conditions had to be optimized by variation of annealing

temperature, until all fragment amplifications were achieved (Fig. 5.8). The only exception was the

SMc03167 flanking regions, which was necessary a different polymerase, namely the Platinum Taq

polymerase (Invitrogen).


22

Fig. 5.8 - Example of PCR amplification of different fragments separated by agarose gel electrophoresis (0.8%). Lane M,

1kb DNA ladder; lanes 1 and 2, right fragment of ORF SMc03167 with expected size of 2020bp; lanes 3 and 4, left fragment

of ORF SMc03168 with expected size of 2067bp; lanes 5 and 6, right fragment of ORF SMc03168 with expected size of

2155bp; lanes 7 and 8, left fragment of ORF SMc03169 with expected size of 2223bp.

After obtaining the SMc03167L (left fragment of SMc03167 ORF) purified PCR amplification

product and vector (Fig. 5.9), both were restricted with the restriction endonucleases EcoRI and

KpnI, ligated, and the recombinant plasmid was then electrotransformed into E. coli.

Fig. 5.9 - Example of SMc03167L purified PCR amplification product (a) and the vector pK19mobG digested with KpnI (b)

separated by agarose gel electrophoresis (0.8%). Lane M, 1kb DNA ladder.

The same strategy was applied to insert the SMc03167R (right fragment of SMc03167 ORF)

in the previous construction. Then, the final construction (pAFM01-2) was transferred to E. coli S-

17 by electrotransformation and the correct candidate was selected (Fig. 5.10).

a b


23

Fig. 5.10 - Restriction profiles in agarose gel electrophoresis (0.8%) of plasmid DNA extracted from independent pAFM01-2

recombinant plasmids after electrotransformation of E. coli S-17. Lane M, 1kb DNA ladder; lanes 1 and 3, double restriction

with endonucleases EcoRI and KpnI of two pAFM01-2 samples; lanes 2 and 4, double restriction with endonucleases EcoRI

and HindIII of the same pAFM01-2 samples. All clones showed the correct insertions.

Plasmid pAFM01-2 was then mobilized into Sm1021 by conjugation (described in 4.5) and

colonies with the plasmid integrated into the genome were selected in the presence of antibiotic

streptomycin and neomycin. A single recombinant colony was then grown for 8 days in order to

promote the double recombination due to nutrient limitation. After that, the culture was plated in the

presence of X-Gluc which, due to the presence of the gusA gene in the vector, allowed discerning

the white colonies where double recombination occurred from those blue that still had the

integrated plasmid. The correct mutant confirmation was achieved by PCR amplification (Fig. 5.11)

and was it named Sm1021-7 (Table 4.1).

Fig. 5.11 - Agarose gel electrophoresis (0.8%) of the PCR amplification products for mutant confirmation using primers that

amplify the region around the SMc03167 gene. Lane M, 1kb DNA ladder; lanes 1 and 3, wild-type Sm1021 amplified

fragment with expected size of 2040bp; lanes 2 and 4, SMc03167 deletion mutant amplified fragment with expected size of

430bp.

To obtain the SMc03168 and SMc03169 deletion mutants the same strategy was applied.

However, a SMc03168 deletion mutant was not successfully isolated in presence of X-Gluc. In fact,

some white colonies were obtained, but when confirmed by PCR amplification, a wild-type

SMc03168 fragment was present, which means that the cell lost the plasmid and reverted to wild-

type phenotype. The inability to isolate a SMc03168 deletion mutant could suggest that this gene is


24

essential, but it is more likely that one of the cloned flanking regions is to short for the

recombination event to take place. A new recombinant plasmid with bigger flanking regions should

be constructed in order to obtain this mutant. Following the same steps, the deletion mutant

obtained for SMc03169 was named Sm1021-9 (Table 4.1).

To complement the Sm1021-9 strain, a fragment containing the SMc03169 gene under

control of its own promoter was cloned into the EcoRI site of pPHU231 vector. The correct

construction was transferred to E. coli S-17 by electrotransformation and named pMAS17. The

plasmid pMAS17 was then mobilized into Sm1021 and Sm1021-9 by conjugation and colonies with

the correct plasmid were selected in the presence of antibiotic streptomycin and tetracycline.

5.3. Assessment of phenotypic properties

5.3.1. Growth of S. meliloti deletion mutants in rich and minimal medium

To determine if the mutations had any effect on cell growth and viability, the Sm1021-7 and

Sm1021-9 mutants were compared with wild-type Sm1021 in TY rich medium and GMS minimal

medium, at 30ºC, with orbital agitation for a period of approximately 72h (Fig. 5.12). In TY medium,

the growth curves obtained for the mutant strains were identical to the Sm1021 (Fig. 5.12a),

suggesting that the mutations had no effect on cell growth in complex medium. Since no

differences were observed in complex medium, a growth in minimal medium (GMS pH 7.0) medium

was performed (Fig. 5.12b). For Sm1021-7, the mutation did not affect cell growth since this mutant

showed identical growth rate to the Sm1021 strain. Contrastingly, deletion of SMc03169 gene had

an effect on cell growth since the final biomass of this mutant was decreased. Indeed, during the

first 10 hours the growth rate was similar for both strains; subsequently the Sm1021-9 showed

reduced biomass formation, suggesting that this minimal medium creates conditions that are

unfavorable for its optimal growth.

Fig. 5.12 - Growth curve of the wild-type Sm1021 (), Sm1021-7 () and Sm1021-9 () strains in TY (a) and GMS (b)

media. Experiments were repeated three times and similar growth trend was observed. Error bars indicate SD. The t-test

was performed using GraphPad Prism 5.0 software. A P-value of <0.0315 was considered significant compared to Sm1021

(*).

0,100

1,000

10,000

0 20 40 60 80

OD

(6

00

nm

)

Time (h)

0,100

1,000

10,000

0 20 40 60 80

OD

(6

00

nm

)

Time (h)

(a) (b)

*** * *


25

Capela et al. (2005) found that SMc03167 and SMc03169 genes were induced (16-fold and

3-fold, respectively), when S. meliloti transcriptome in response to overexpression of nodD1 and

the plant flavonoid luteolin was analyzed. NodD1 mediates the expression of nod genes in S.

meliloti and its expression can be initiate by the flavonoid inducer luteolin. In the presence of

luteolin, NodD1 exhibit an increased binding to nod gene promoters when compared to binding in

the absence of luteolin (Peck et al., 2006). Thus, to ensure that SMc03167 and SMc03169 genes

were being expressed, perhaps increasing the differences obtained in minimal medium, a growth

curve in the presence of luteolin (10 µM) was performed (data not shown). Results have shown that

the wild-type and mutant’s growth behavior were identical to growth curve displayed in Fig. 5.12b.

Due to the biomass difference found in GMS media, cell viability at several time points was

determined by counting the total number of colony forming units (CFUs) in TY plates. During the

first 10 hours the CFU numbers were similar for all strains; but from this point, for a given hour, the

Sm1021-9 formed fewer colonies than wild-type and Sm1021-7 (Fig. 5.13). This result confirms the

previously observed reduction of biomass formed by Sm1021-9 mutant when compared to the wild-

type strain and the Sm1021-7 mutant.

Fig. 5.13 - Average number of CFUs at each time point during growth in GMS medium. Wild-type Sm1021 (), Sm1021-7

() and Sm1021-9 () strains were plated on TY medium and the total number of colonies counted. Error bars indicate SD.

A P-value of <0.0329 was considered significant compared to Sm1021 (*).

To determine if there was any difference in the shape of the cells in GMS medium which

could justify the reduced biomass formation, light microscopy size visualization of the three S.

meliloti strains was performed at different time points (Fig. 5.14). The cellular morphology and size

of the two mutants resembles the ones of Sm1021, appearing as free-living rod forms. This

indicated that deletion of SMc03167 and SMc03169 genes has no effect on cell shape/size.

1,00E-01

5,00E+08

1,00E+09

1,50E+09

2,00E+09

2,50E+09

3,00E+09

0 10 20 30 40 50

CF

U/m

l

Time (h)

*** *


26

Fig. 5.14 - Light microscopy of S. meliloti strains grown in GMS medium at x100 magnification. Wild-type Sm1021 at 8

hours (a) and 48 hours (e); Sm1021-7 at 8 hours (b) and 48 hours (f); and Sm1021-9 at 8 hours (c) and 48 hours (g) of

growth.

Whole cell proteins were analyzed to determine if there was any evident difference in the

protein patterns during growth. No differences were detected at a given time between the wild-type

and mutant strains (Fig. 5.15). Similar results were obtained for 28, 32 and 48 hours (data not

shown).

Fig. 5.15 - Coomassie blue-stained SDS-PAGE displaying approximately 10 µl of the whole cell protein extracts. Extracts

were obtained with cells grown in GMS liquid medium. Lane 1, protein mass standard; lanes 2, 5 and 8, samples of wild-

type Sm1021 fraction collected after 8, 12 and 24 hours of growth, respectively; lanes 3, 6 and 9, samples of Sm1021-7

fraction collected after 8, 12 and 24 hours of growth, respectively; lanes 4, 7 and 10, samples of Sm1021-9 fraction collected

after 8, 12 and 24 hours of growth, respectively.

(a) (b) (c)

(e) (f) (g)


27

5.3.2. Growth of S. meliloti SMc03169 mutant at pH 5.5

Accordingly to Hellweg et al. (2009), SMc03169 gene appears to be expressed when S.

meliloti cells are exposed to an acid shift. So, the ability of this mutant to grow at acid pH was

investigated. Sm1021-9 was grown in GMS medium at pH 4.0, 5.0, 5.5 and 6.0. Both Sm1021 and

Sm1021-9 strains were unable to grow in liquid GMS at pH 4.0 and pH 5.0, but apparently survived

at this pH since aliquots of liquid culture were plated on TY plates and colonies were visible after

48 hours. The growth at pH 6.0 was similar to the growth at pH 7.0 for both strains (Fig. 5.12b) but

growth at pH 5.5 was greatly affected in Sm1021-9 mutant (Fig. 5.16). The defect could be

complemented by plasmid pMAS17, expressing the SMc03169 gene under the control of its own

promoter, which rescued the bacterium from pH sensitivity. Overexpression of SMc03169 gene in

the wild-type strain did not improve its ability to grow at this pH when compared to the wild-type

expressing the empty vector. This result shows that deletion of SMc03169 gene leads to an acid

sensitivity. Since this gene encodes a transcription factor, it is possibly involved in the

induction/suppression of other genes required for acid adaptation. Further studies need to be done

to find the target genes of this protein in acidic pH.

Fig. 5.16 - Growth curve of the wild-type Sm1021/pPHU231 (), Sm1021-9/pPHU231 (), Sm1021/pMAS17 (), and

Sm1021-9/pMAS17 (♦) strains in GMS medium pH 5.5. Experiments were repeated three times and similar growth trend

was observed. Error bars indicate SD. A P-value of <0.0128 was considered significant compared to Sm1021 (*).

5.3.3. Sensitivity of the mutants to antimicrobials of plant origin and other stress

agents....

It is predicted that SMc03167 and perhaps also SMc03169 proteins could be involved in

resistance to toxic compounds since SMc03167 gene encodes a MFS-like system, which probably

excrete toxic compounds and cellular metabolites not yet identified. Moreover, proteins from TetR

family control genes whose products are involved in multidrug resistance, efflux pumps and

enzymes implicated in different catabolic pathways (Ramos et al., 2005). To characterize the

antimicrobial behavior of the mutants and possibly identify any compound transported by this

pump, a variety of chemical compounds at concentrations that may be toxic were examined (Fig.

5.17). The sensitivity in GMS medium of Sm1021, Sm1021-7 and Sm1021-9 strains to the plant

0,100

1,000

10,000

0 20 40 60 80 100

OD

(6

00

nm

)

Time (h)

** * ** *

*** **


28

derived antimicrobial compounds berberine 3000 µg/ml, p-coumaric acid 1500 µg/ml and genistein

3000 µg/ml were compared. Sm1021-7 strain showed similar results to wild-type strain, suggesting

that SMc03167 gene has no role in protection against these plant derived antimicrobials (Fig. 5.17).

When oxidative stress agents such as H2O2 and cumene hydroperoxide were tested no differences

were observed between wild-type strain and Sm1021-7. A similar result was obtained for SDS.

Sm1021-9 strain showed the same sensitivity to plant derived antimicrobials and H2O2 as the wild-

type Sm1021 (Fig. 5.17). The only differences were visible for 10% SDS and 5% cumene

hydroperoxide, where the mutant strain was more sensitive (Fig. 5.17).

Fig. 5.17 - Sensitivity of the wild-type Sm1021, Sm1021-7 and Sm1021-9 strains to antimicrobial agents. Each bar

represents the average of three independent experiences. Error bars indicate SD. A P-value of <0.0217 was considered

significant compared to Sm1021 (*).

Sm1021-9 mutant appears to be more sensitive to the detergent SDS than Sm1021. In the

literature, sensitivity to SDS appears associated with changes in cellular membrane. A change in

the outer membrane can affect the resistance phenotype which results in increased sensitivity to

detergents (Vanderlinde et al., 2010). Thus, S. meliloti SMc03169 gene may be involved in the

expression of other genes encoding proteins whose functions are to keep a proper cell envelope

and maintain homeostasis even in the presence of external injuries.

Sm1021-9 also was sensitive to cumene hydroperoxide. TetR family is described to control

response to various stresses (Ramos et al., 2005) and, according to this, Sm1021-9 also seems to

play a role in at least one oxidative stress agent.

5.3.4. Efflux activity of the mutants in the presence of a toxic compound

To characterize the efflux behavior of the mutants to the toxic compound ethidium bromide,

an agar screening method was performed. Following the procedure described by Couto et al.

(2008) the three strains were challenged with various concentrations of ethidium bromide to

evaluate their efflux capacity. Results have shown that Sm1021, Sm1021-7 and Sm1021-9 strains

do not fluoresce (Fig. 5.18). Contrastingly, Sm1021 tolC mutant (used as control in Fig. 5.18d)

0,0

5,0

10,0

15,0

20,0

25,0

30,0

35,0

40,0

45,0

50,0

SDS 10% H2O2 100mM berberine

3000 µg/ml

p-coumaric

acid 1500

µg/ml

genistein 3000

µg/ml

cumene

hydroperoxide

5%

Ha

lo d

iam

ete

r (m

m)

Sm1021

Sm1021-7

Sm1021-9

H2O2 100mM p-coumaric

acid 1500

µg/ml

***

*


29

which exhibits an envelope defect (Santos et al., 2010) can’t pump this toxic compound out,

causing its accumulation inside cells, which became fluorescent even at concentrations of 0.5

mg/L, whilst the wild-type cells have the ability to excrete the compound. By showing no differences

to the wild-type strain, it is likely that the MFS-type protein SMc03167 is not responsible for the

extrusion of this drug. Moreover, other transporters are encoded by S. meliloti and one of these

transporters probably compensates the loss of this gene activity. SMc03169 gene product also

seems not be involved in transcription of genes directly involved in ethidium bromide extrusion.

0 ml/L 0.5 mg/L 1 mg/L 1.5 mg/L

Fig. 5.18 - Evaluation of efflux activity of wild-type Sm1021 (a), Sm1021-7 (b) and Sm1021-9 (c) strains in the presence of

ethidium bromide. The three strains were swabbed in TY plates containing 0.5 to 1.5 mg/L of ethidium bromide, following

incubation at 30ºC for 24 hours. The fluorescence was detected under UV light. Sm1021 tolC mutant (SmLM030-2) unable

to excrete ethidium bromide (Santos et al., 2010) was used as control (d).

5.3.5. Symbiotic properties of the mutants

To determine whether the activity of the genes under study is required for symbiosis, the

nodulation efficiency of the mutants was compared to the wild-type strain. For that, Sm1021,

Sm1021-7 and Sm1021-9 were inoculated on the root of aseptically grown M. sativa seedlings. The

nodulation process was followed by counting the number of nodules (total and pink) of each plant

on a weekly basis during the 5 weeks. The assay consisted of 16 replica plates with M. sativa

inoculated with wild-type, mutant strains and water. The data collected from the assays was then

analyzed and the total nodules (Fig. 5.19a) and pink nodules (Fig.5.19b) were plotted.

Fig. 5.19 - Weekly evolution of the total number of nodules (a) and number of pink nodules (b). M. sativa were inoculated

with wild-type Sm1021 (), Sm1021-7 (), Sm1021-9 () strains. Each point represents the nodule average of 48 plants.

0

1

2

3

4

5

6

7

0 1 2 3 4 5

Nu

mb

er

of

To

tal

No

du

les

Weeks

0

1

2

3

4

5

6

7

0 1 2 3 4 5

Nu

mb

er

of

Pin

k N

od

ule

s

Weeks

(b)

(a)

(d)

(b)

(c)

(a)

(d)

(b)

(c)

(a)

(d)

(b)

(c)

(a)

(d)

(b)

(c)

(a)


30

From Fig. 5.19a it can be observed that nodule number increases all over the incubation

time for all the strains and most of the nodules became mature (pink nodules) as shown in Fig.

5.19b curves. The comparison of the nodule number after 5 weeks showed an average of 6.5

nodules for Sm1021, 5.2 for Sm1021-7 and 2.4 for Sm1021-9 (Fig. 5.20). The complementation of

the SMc03169 gene mutation has restored the nodulation capacity (data not shown). Although the

differences in means of nodule number between Sm1021 and Sm1021-7 are statistically

significant, the average difference of nodule between the infected plants is probably no significant

biologically. In fact, a similar result was described by Capela et al., (2005) where a SMc03167 null

mutant was as competitive as the wild-type for nodulation. Considering the strong reduction of

nodule number induced by Sm1021-9 mutant, this is an important result since it shows for the first

time the involvement of this putative transcriptional regulator in symbiosis.

Fig. 5.20 - Average of the number of pink and total nodules 5 weeks after inoculation of M. sativa plants with wild-type

Sm1021, Sm1021-7 and Sm1021-9 strains. Error bars indicate SD. A P-value of <0.0079 was considered significant

compared with Sm1021 (*).

The macroscopic analysis of the plants showed that plants inoculated with the Sm1021-9

were reduced in size and not quite as green as plants inoculated with Sm1021 strain. Some roots

were also smaller or less branched, while plants inoculated with Sm1021 and Sm1021-7 strains

has long and branched roots, appearing green and healthy (Fig. 5.21).

Fig. 5.21 - M. sativa inoculated with wild-type Sm1021, Sm1021-7 and Sm1021-9 strains.

0

2

4

6

8

10

Sm1021 Sm1021-7 Sm1021-9

Nu

mb

er

of

No

du

les

Strains

Pink

Total

Sm1021 Sm1021-7 Sm1021-9

**

***


31

To confirm that nodules were colonized with bacteria, colony forming units (CFUs) were

determined for some white and pink nodules from the three strains under study. Results showed

that immature white nodules were mostly uncolonized (data not shown). Pink nodules induced from

all the strains were colonized with CFU ranging from 4x104 to 1x105 (data not shown). This result

suggests that deletion of SMc03169 gene has a strong effect on the number of nodules, but once

they are formed they are equally colonized.


32

6. Conclusions

In this work we have evaluated the role of SMc03167 and SMc03169 genes on S. meliloti

stress responses and their involvement in the symbiotic process between the bacteria and the

legume M. sativa. SMc03167, together with SMc03168 and TolC proteins, were predicted to be a

tripartite efflux system. SMc03167 protein contains 13 transmembrane typical of many MFS

transporters involved in the resistance to various antibiotics and toxic compounds. Protein

SMc03168 contains a conserved domain also present in HlyD protein, that makes the connection

between the cytoplasmic MFS protein and the outer membrane porin. SMc03169, which is

transcribed in the opposite direction of SMc03167 and SMc03168, encodes a TetR transcription

factor. This family of transcription factors plays a role in the regulation of genes that control the

response to various stress conditions and possibly are involved in other regulatory pathways.

Previous studies indicate that the proteins under study present an altered expression under some

stress conditions such as osmotic stress and low pH (Cosme et al., 2008; Hellweg et al., 2009;

Rüberg et al., 2003), but none of these genes was characterized in what relates to these stresses.

Furthermore, it was shown by Santos et al. (2010) that SMc03167, SMc03168 and SMc03169

genes had an increased expression when envelope perturbations occurred; such is the case of the

lack of TolC porin from the outer membrane.

When compared to the wild-type strain, SMc03167 showed a similar growth rate in rich and

minimal media as well as the same resistance profile to toxic concentrations of different

antimicrobial compounds. Furthermore, SMc03167 mutant was as competitive as the wild-type

strain for nodulation. SMc03167/SMc03168 is one among the 13 S. meliloti transporters assigned

to the MFS or RND families. One hypothesis for SMc03167/SMc03168 being unaffected by the

antimicrobial compounds tested is the presence in the S. meliloti genome of genes encoding other

transporters that compensate the lack of SMc03167/SMc03168 by extruding these toxic

compounds. If more than one transporter system is involved in the transport of a common

compound, then the absence of one of these transporters will not affect the transport of the

compound. A more likely hypothesis is SMc03167/SMc03168 proteins being involved in the

transport of a not yet identified substrate which can be not a drug but a product of the S. meliloti

metabolism.

Recently, smeAB, another multidrug efflux pumps of S. meliloti, was demonstrated to be

implicated in antimicrobial resistance (Eda et al., 2011). The deletion of smeAB genes resulted in

increased susceptibility to a range of antibiotics, dyes, detergents and plant-derived compounds.

Moreover, competitive nodulation experiments revealed that a smeAB mutant was defective in

competing against the wild-type strain for nodulation, suggesting that these genes may play an

important role in nodulation by mediating resistance toward antimicrobial compounds produced by

the host plant.


33

Deletion of SMc03169 gene caused a sensitive growth at low pH in minimal medium that

was recovered to wild-type level by introducing the missing gene in trans. Since cell mechanisms to

face low pH are a mixture of several distinct reactions ordered in time, we suggest that the lower

pH tolerance in the mutant may be caused by defects on transcriptional control of other genes or

pathways involved in stress responses, mediated by SMc03169 transcription factor. Although a few

genes had been reported to respond at low pH, Reeve et al. (1998) observed that phrR gene is

also a transcriptional regulator with a DNA-binding HTH motif which is induced by low pH or certain

stresses. Akiba et al. (2010) identified praR as a homolog of the phrR gene in Azorhizobium

caulinodans. A praR deletion mutant was not significantly different from the wild-type in the free-

living state, but its nodules showed lower nitrogen fixation activity.

Although there were no differences in the behavior of SMc03169 mutant in the presence of

must antimicrobial agents and toxic compounds studied, this mutant was highly sensitive to SDS

agent. Alterations in the outer membrane are described in literature as a cause to increased

sensitivity to detergents. LPS is the major constituent of the bacterial outer envelope and plays a

crucial, but poorly understood, role in the symbiotic process. Little is known about the attributes of

LPS required to initiate an effective symbiosis by S. meliloti but R. etli appears to alter their LPS

molecules during development into nitrogen-fixing bacteriods (Noel & Duelli, 2000). Changes in the

bacterial cell envelope are thought to be also involved in the differentiation of S. meliloti into the

bacteroid state within the host cell (Reuhs et al., 1999). A S. meliloti lpsB mutant, with changes in

its carbohydrate core of the lipopolysaccharides, showed sensitivity to components of the plant’s

innate immune system, detergents and, although it was capable of forming infection threads in a

manner similar to a wild-type strain, the nodules had developed abnormalities (Campbell et al.,

2002). In addition, Ferguson et al. (2002) found that a S. meliloti bacA mutant had also an

increased sensitivity to detergents, hydrophobic dyes, ethanol and acid pH, supporting the idea that

BacA function affects the bacterial cell envelope. They hypothesized that the inability of this mutant

to survive within the host could be due to an enhanced sensitivity to one or more of the stresses

encountered in the host cell.

We do not know if what causes SDS sensitivity of SMc03169 mutant is correlated with the

poor nodulation capacity but perhaps this gene can affect regulatory pathways and cause a LPS

alteration, compromising the integrity of the bacterial outer envelope during the differentiation into

bacteroids state and/or independently affecting the cascade of signalling that activates the nodule

formation. In fact, plants inoculated with a SMc03169 mutant have much less nodules compared

with the wild-type, suggesting a possible involvement of this protein in the symbiotic process,

although no function was described or suggested, making difficult to grasp its role in this process.

References about the mechanism of pH homeostasis in S. meliloti are rare but some of them

refer changes on cell envelope. There are no previous reports if the specific changes in the lipid

moiety of the LPS can also affect the acid resistance, but changes in phospholipid fatty acids have

been found to affect acid resistance in E. coli (Chang & Cronan, 1999). Probably, the low-level

resistance of the SMc03169 mutant to acid pH may be caused by the cell envelope alterations

which affect the efflux and uptake of specifics important agents for biological processes. typA, a S.


34

meliloti gene functionally equivalent of E. coli bipA gene which controls bacterial survival under a

variety of stress conditions, was described to be required for survival at low pH and in the presence

of SDS. Furthermore, this gene contributed to the full efficiency of symbiosis with M. truncatula and

with other host plant lines such as several cultivars of M. sativa (Kiss et al., 2004).

Altogether, the results presented in this work point out several findings concerning the role of

SMc03169 protein in the symbiotic process between S. meliloti and M. sativa and in adaptation to

low pH. Further studies have to be performed to understand in more detail the role of this ORF in

the establishment of symbiosis and in cell physiology during the free-living and various stages of

symbiotic development. To understand the pH effect on growth and the reduced symbiotic

efficiency of the SMc03169 mutant strain it may be necessary a transcriptomic approach, where

global gene expression for wild-type and SMc03169 mutant during these two conditions can be

measured.


35

7. References

Akiba N., Aono T., Toyazaki H., Sato S., Oyaizu H. (2010). phrR-like gene praR of Azorhizobium

caulinodans ORS571 is essential for symbiosis with Sesbania rostrata and is involved in expression of reb genes. Appl. Environ. Microbiol., 76(11):3475-3485.

Barnett M.J., Fisher R.F., Jones T., Komp C., Abola A.P., Barloy-Hubler F., Bowser L., Capela D., Galibert F., Gouzy J. et al. (2001). Nucleotide sequence and predicted functions of the entire Sinorhizobium

meliloti pSymA megaplasmid. Proc. Natl. Acad. Sci. USA, 98(17):9883-9888.

Barnett M.J., Toman C.J., Fisher R.F., Long S.R. (2004). A dual-genome Symbiosis Chip for coordinate study of signal exchange and development in a prokaryote-host interaction. Proc. Natl. Acad. Sci. USA, 101(47):16636-16641.

Batut J., Mergaert P., Masson-Boivin C. (2011). Peptide signaling in the rhizobium-legume symbiosis. Curr.

Opin. Microbiol., 14(2):181-187.

Becker A., Barnett M.J., Capela D., Dondrup M., Kamp P.B., Krol E., Linke B., Rüberg S., Runte K., Schroeder B.K., et al. (2009) A portal for rhizobial genomes: RhizoGATE integrates a S. meliloti genome annotation update with postgenome data. J. Biotechnol., 140(1-2):45-50.

Beringer J.E. (1974). R factor transfer in Rhizobium leguminosarum. J. Gen. Microbiol., 84(1):188-198.

Bullock W.C., Fernandez J.M., Short J.M. (1987). XL1-Blue: a high efficient plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. Biotechniques, 5(4):376-379.

Campbell G.R., Reuhs B.L., Walker G.C. (2002). Chronic intracellular infection of alfalfa nodules by Sinorhizobium meliloti requires correct lipopolysaccharide core. Proc. Natl. Acad. Sci. USA, 99(6): 3938-3943.

Capela D., Barloy-Hubler F., Gouzy J., Bothe G., Ampe F., Batut J., Boistard P., Becker A., Boutry M., Cadieu E. et al. (2001). Analysis of the chromosome sequence of the legume symbiont Sinorhizobium

meliloti. Proc. Natl. Acad. Sci. USA, 98(17):9877-9882.

Capela D., Carrere S., Batut J. (2005). Transcriptome-based identification of the Sinorhizobium meliloti NodD1 regulon. Appl. Environ. Microbiol., 71(8):4910-4913.

Capela D., Filipe C., Bobik C., Batut J., Bruand C. (2006). Sinorhizobium meliloti differentiation during symbiosis with alfalfa: a transcriptomic dissection. Mol. Plant Microbe Interact., 19(4):363-372.

Chang Y.Y., Cronan J.E. (1999). Membrane cyclopropane fatty acid content is a major factor in acid resistance of Escherichia coli. Mol. Microbiol., 33(2):249-259.

Cosme A.M., Becker A., Santos M.R., Sharypova L.A., Santos M.P., Moreira L.M. (2008). The outer membrane protein TolC from Sinorhizobium meliloti affects protein secretion, polysaccharide biosynthesis, antimicrobial resistance and symbiosis. Mol. Plant Microbe Interact., 21(7):947-957.

Costa M.S., Santos H., Galinski E.A. (1998). An overview of the role and diversity of compatible solutes in Bacteria and Archaea. Adv. Biochem. Eng. Biotechnol., 61:117-153.

Costa S.S., Ntokou E., Martins A., Viveiros M., Pournaras S., Couto I., Amaral L. (2010). Identification of the plasmid-encoded qacA efflux pump gene in meticillin-resistant Staphylococcus aureus (MRSA) strain HPV107, a representative of the MRSA Iberian clone. Int. J. Antimicrob. Agents, 36(6):557-561.

Couto I., Costa S.S., Viveiros M., Martins M., Amaral L. (2008). Efflux-mediated response of Staphylococcus aureus exposed to ethidium bromide. J. Antimicrob. Chemother., 62(3):504-513.

Davies B.W., Walker G.C. (2007a). Disruption of sitA compromises Sinorhizobium meliloti for manganese uptake required for protection against oxidative stress. J Bacteriol., 189(5):2101-2109.

Davies B.W., Walker G.C. (2007b). Identification of novel Sinorhizobium meliloti mutants compromised for oxidative stress protection and symbiosis. J. Bacteriol., 189(5):2110-2113.


36

Deininger K.N., Horikawa A., Kitko R.D., Tatsumi R., Rosner J.L., Wachi M., Slonczewski J.L. (2011). A requirement of TolC and MDR efflux pumps for acid adaptation and GadAB induction in Escherichia coli. PLoS

One, 6(4):e18960.

Delepelaire P. (2004). Type I secretion in gram-negative bacteria. Biochim. Biophys. Acta, 1694(1-3):149-161.

Dillewijn P., Sanjuán J., Olivares J., Soto M.J. (2009). The tep1 gene of Sinorhizobium meliloti coding for a putative transmembrane efflux protein and N-acetyl glucosamine affect nod gene expression and nodulation of alfalfa plants. BMC Microbiol., 9:17.

Djordjevic M.A., Chen H.C., Natera S., Van Noorden G., Menzel C., Taylor S., Renard C., Geiger O., Weiller G.F. et al. (2003). A global analysis of protein expression profiles in Sinorhizobium meliloti: discovery of new genes for nodule occupancy and stress adaptation. Mol. Plant Microbe Interact., 16(6):508-524.

Domínguez-Ferreras A., Muñoz S., Olivares J., Soto M.J., Sanjuán J. (2009). Role of potassium uptake systems in Sinorhizobium meliloti osmoadaptation and symbiotic performance. J. Bacteriol., 191(7):2133-2143.

Downie J. A. (2010). The roles of extracellular proteins, polysaccharides and signals in the interactions of rhizobia with legume roots. FEMS Microbiol. Rev., 34(2):150-170.

Eda S., Mitsui H., Minamisawa K. (2011). Involvement of the smeAB multidrug efflux pump in resistance to plant antimicrobials and contribution to nodulation competitiveness in Sinorhizobium meliloti. Appl. Environ.

Microbiol., 77(9):2855-2862.

Fernandez-Aunión C., Hamouda T.B., Iglesias-Guerra F., Argandoña M., Reina-Bueno M., Nieto J.J., Aouani M.E., Vargas C. (2010). Biosynthesis of compatible solutes in rhizobial strains isolated from Phaseolus vulgaris nodules in Tunisian fields. BMC Microbiol., 10:192.

Finan T.M., Weidner S., Chain P., Becker A., Wong K., Cowie A., Buhrmester J., Vorhölter F.J., Golding B., Pühler A. (2001). The complete sequence of the Sinorhizobium meliloti pSymB megaplasmid. Proc. Natl.

Acad. Sci. USA, 98(17):9889-9894.

Galibert F., Finan T.M., Long S.R., Pühler A., Abola P., Ampe F., Barloy-Hubler F., Barnett M.J., Becker A., Boistard P. et al. (2001). The composite genome of the legume symbiont Sinorhizobium meliloti. Science, 293(5530):668-672.

Gibson K.E., Kobayashi H., Walker G.C. (2008). Molecular determinants of a symbiotic chronic infection. Annu. Rev. Genet., 42:413-441.

Hellweg C., Pühler A., Weidner S. (2009). The time course of the transcriptomic response of Sinorhizobium

meliloti 1021 following a shift to acidic pH. BMC Microbiol., 9:37.

Horiyama T., Yamaguchi A., Nishino K. (2010). TolC dependency of multidrug efflux systems in Salmonella

enteric serovar Typhimurium. J. Antimicrob. Chemother., 65(7):1372-1376.

Jamet A., Kiss E., Batut J., Puppo A., Hérouart D. (2005). The katA catalase gene is regulated by OxyR in both free-living and symbiotic Sinorhizobium meliloti. J. Bacteriol., 187(1):376-81.

Jamet A., Sigaud S., Sype G.V., Puppo A., Hérouart D. (2003). Expression of the bacterial catalase genes during Sinorhizobium meliloti-Medicago sativa symbiosis and their crucial role during the infection process. Mol. Plant Microbe Interact., 16(3):217-225.

Kang H, Gross D.C. (2005). Characterization of a resistance-nodulation-cell division transporter system associated with the syr-syp genomic island of Pseudomonas syringae pv. syringae. Appl. Environ. Microbiol., 71(9):5056-5065.

Katzen F., Becker A., Ielmini M.V., Oddo C.G., Ielpi, L. (1999). New mobilizable vectors suitable for gene replacement in gram-negative and their use in mapping of the 3’ end of the Xanthomonas campestris pv. campestris gum operon. Appl. Environ. Microbiol., 65(1):278-282.

Kiefer F., Arnold K., Künzli M., Bordoli L., Schwede T. (2009). The SWISS-MODEL Repository and associated resources. Nucleic Acids Res., 37(Database issue):D387-D392.


37

Kiss E., Huguet T., Poinsot V., Batut J. (2004). The typA gene is required for stress adaptation as well as for symbiosis of Sinorhizobium meliloti 1021 with certain Medicago truncatula lines. Mol. Plant Microbe Interact.,

17(3):235-244.

Kopp J., Schwede T. (2004). The SWISS-MODEL Repository of annotated three-dimensional protein structure homology models. Nucleic Acids Res., 32(Database issue): D230-D234.

Leigh J.A., Signer E.R., Walker G.C. (1985). Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc. Nat. Acad. Sci. USA, 82(18):6231-6235.

Lindström K., Murwira M., Willems A., Altie N. (2010). The biodiversity of beneficial microbe-host mutualism: the case of rhizobia. Res. Microbiol., 161(6):453-463.

Lomovskaya O., Lewis K. (1992). Emr, an Escherichia coli locus for multidrug resistance. Proc. Nat. Acad.

Sci. USA, 89(19):8938-8942.

Misra R., Bavro V.N. (2009). Assembly and transport mechanism of tripartite drug efflux systems. Biochim.

Biophys. Acta, 1794(5):817-825.

Noel K.D., Duelli D.M. (2000). Prokaryotic Nitrogen Fixation: A Model System for Analysis of a Biological Process. E.W. Triplett, Horizon UK.

Nogales J., Campos R., BenAbdelkhalek H., Olivares J., Lluch C., Sanjuan J. (2002). Rhizobium tropici genes involved in free-living salt tolerance are required for the establishment of efficient nitrogen-fixing symbiosis with Phaseolus vulgaris. Mol. Plant Microbe Interact., 15(3):225-232.

Oldroyd G.E., Murray J.D., Poole P.S., Downie J.A. (2011). The Rules of Engagement in the Legume-Rhizobial Symbiosis. Annu. Rev. Genet., 45:119-144.

Peck M.C., Fisher R.F., Long S.R. (2006). Diverse flavonoids stimulate NodD1 binding to nod gene promoters in Sinorhizobium meliloti. J. Bacteriol., 188(15):5417-5427.

Prell J., Poole P. (2006). Metabolic changes of rhizobia in legume nodules. Trends Microbiol., 14(4):161-168.

Ramos J.L., Martínez-Bueno M., Molina-Henares A.J., Terán W., Watanabe K., Zhang X., Gallegos M.T., Brennan R., Tobes R. (2005). The TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev .,

69(2):326-356.

Reeve W.G., Bräu L., Castelli J., Garau G., Sohlenkamp C., Geiger O., Dilworth M.J., Glenn A.R., Howieson J.G., Tiwari R.P. (2006). The Sinorhizobium medicae WSM419 lpiA gene is transcriptionally activated by FsrR and required to enhance survival in lethal acid conditions. Microbiology, 152(Pt 10):3049-3059.

Reeve W.G., Tiwari R.P., Kale N.B., Dilworth M.J., Glenn A.R. (2002). ActP controls copper homeostasis in Rhizobium leguminosarum bv. viciae and Sinorhizobium meliloti preventing low pH-induced copper toxicity. Mol. Microbiol., 43(4):981-991.

Reeve W.G., Tiwari R.P., Wong C.M., Dilworth M.J, Glennt A.R. (1998). The transcriptional regulator gene phrR in Sinorhizobiurn meliloti WSM419 is regulated by low pH and other stresses. Microbiology, 144(Pt 12):3335-3342.

Reuhs B.L., Stephens S.B., Geller D.P., Kim J.S., Glenn J., Przytycki J., Ojanen-Reuhs T. (1999). Epitope identification for a panel of anti-Sinorhizobium meliloti monoclonal antibodies and application to the analysis of K antigens and lipopolysaccharides from bacteroids. Appl. Environ. Microbiol., 65(11):5186–5191.

Reyes F., Roldan M.D., Klipp W., Castillo F., Moreno-Vivian C. (1996). Isolation of periplasmic nitrate reductase genes from Rhodobacter sphaeroides DSM 158: structural and functional differences among prokaryotic nitrate reductases. Mol. Microbiol., 19(6):1307-1318.

Rickert A.A., Soria M.A., Correa O.S. (2000). The adaptive acid response in Mesorhizobium sp.. World J.

Microbiol. Biotechnol., 16(5):475-480.

Rolfe B.G., Gresshoff P.M., Shine J., Vincent J.M. (1980). Interaction Between a Non-Nodulating and an Ineffective Mutant of Rhizobium trifolli Resulting in Effective (Nitrogen-Fixing) Nodulation. Appl. Environ.

Microbiol., 39(2):449-452.


38

Rüberg S., Tian Z.X., Krol E., Linke B., Meyer F., Wang Y., Puhler A., Weidner S., Becker A. (2003). Construction and validation of a Sinorhizobium meliloti whole genome DNA microarray: Genome-wide profiling of osmoadaptive gene expression. J. Biotechnol., 106(2-3):255-268.

Saeki K. (2011). Rhizobial measures to evade host defense strategies and endogenous threats to persistent symbiotic nitrogen fixation: a focus on two legume-rhizobium model systems. Cell Mol. Life Sci., 68(8):1327-1339.

Saier M.H. Jr. (2000). A functional-phylogenetic classification system for transmembrane solute transporters. Microbiol. Mol. Biol. Rev., 64(2):354-411.

Sambrook J., Fritsch E.F., Maniatis T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor

Lab. Press, Plainview NY.

Sambrook & Russell. (2001). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab. Press 3rd ed., Plainview NY.

Santos M.R., Cosme A.M., Becker J.D., Medeiros J.M., Mata M.F., Moreira L.M. (2010). Absence of functional TolC protein causes increased stress response gene expression in Sinorhizobium meliloti. BMC

Microbiol., 10:180.

Simon R., Priefer U., Pühler, A. (1983). A broad-host-range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Biotechnology, 1(9):784-791.

Tiwari R.P., Reeve W.G., Dilworth M.J., Glenn A.R. (1996a). Acid tolerance in Rhizobium meliloti strain WSM419 involves a two-component sensor-regulator system. Microbiology, 142(Pt 7):1693-1704.

Tiwari R.P., Reeve W.G., Dilworth M.J., Glenn A.R. (1996b). An essential role for actA in acid tolerance of Rhizobium meliloti. Microbiology, 142(Pt 3):601-610.

Tu, J. C. (1981). Effect of salinity on Rhizobium-root hair interaction, nodulation and growth of soybean. Can.

J. Plant Sci., 61(2):231-239.

Vanderlinde E.M., Harrison J.J., Muszyński A., Carlson R.W., Turner R.J., Yost C.K. (2010). Identification of a novel ABC transporter required for desiccation tolerance, and biofilm formation in Rhizobium

leguminosarum bv. viciae 3841. FEMS Microbiol. Ecol., 71(3):327-340.

York G.M., Walker G.C. (1997). The Rhizobium meliloti exoK gene and prsD/prsE/exsH genes are components of independent degradative pathways which contribute to production of low-molecular-weight succinoglycan. Mol. Microbiol., 25(1):117-134.

Zahran H.H. (1999). Rhizobium-Legume symbiosis and nitrogen fixation under severe conditions and in an arid climate. Microbiol. Mol. Biol. Rev., 63(4):968-989.

role of a tripartite efflux pump in the symbiosis between...

Documents