1

Role of Heparan sulfate in initiation and propagation of

Islet amyloid polypeptide aggregation

Kailash Singh

Degree Project in Biology, Master of Science (2 years), 2011

Examensarbete i biologi 45 hp till materexamen , 2011

Biology Education Center and Department of Medical Cell Biology, Uppsala University

Supervisor: Professor Gunilla T. Westermark

2

Table of Contents

Abbreviation……………………………………………………………………………………………………………………………………….4

Summary…………………………………………………………………………………………………………………………………………….5

Introduction…………………………………………………………………………………………l6-10

1.1. Islets of Langerhans ...................................................................................................................... 6

1.2. IAPP ............................................................................................................................................. 6

1.3. Biological Function of IAPP ........................................................................................................ 7

1.4. Amyloid and Amyloidosis ............................................................................................................ 7

1.4.1. Amyloid ..................................................................................................................................... 7

1.4.2. Amyloidosis ........................................................................................................................... 7

1.5. Diabetes and IAPP ........................................................................................................................ 7

1.5.1. Diabetes ..................................................................................................................................... 7

1.5.2. Role of IAPP in Type 2 Diabetes .......................................................................................... 8

1.6. Amyloid Aggregation Hypothesis ................................................................................................ 8

1.7. Heparan Sulfate (HS) ................................................................................................................... 8

1.8. Biosynthesis of HS ....................................................................................................................... 8

1.9. Different families of Proteoglycans (PGs) ................................................................................... 9

1.10. Our hypothesis ............................................................................................................................ 9

1.11. Aims ......................................................................................................................................... 10

2. Materials and methods............................................................................................................... 11-15

2.1. Cell lines ..................................................................................................................................... 11

2.2. Animal strains............................................................................................................................. 11

2.3. Isolation of secretory granules from endocrine cells .................................................................. 11

2.3.1. Islet isolation ....................................................................................................................... 11

2.3.2. Metabolic labeling and homogenization of islet cells ......................................................... 12

2.3.3. Slot Blot analysis of insulin content..................................................................................... 12

2.3.4. Electron microscopy (EM) ................................................................................................... 12

2.4. HS isolation and characterization ............................................................................................... 12

2.4.1. DEAE .................................................................................................................................... 12

2.4.2. Chondroitinase ABC digestion ............................................................................................ 13

2.4.3. Alkaline treatment ............................................................................................................... 13

3

2.4.4. Nitrous acid (HNO2) treatment ............................................................................................ 13

2.4.5. HS chain length analysis. .................................................................................................... 13

2.5. HS isolation from B-TC-6 cells cultured in normal (11 mM) or high glucose (22 mM) ........... 13

2.5.1. Metabolic labeling of B-TC-6 ............................................................................................. 13

2.5.2 Nitrocellulose-filter trapping assay ...................................................................................... 14

2.6. Proteoglycan gene expression .................................................................................................... 14

2.6.1. Design of primers ................................................................................................................ 14

2.6.2. RNA isolation and cDNA synthesis .................................................................................... 14

2.6.3. PCR analysis ........................................................................................................................ 14

2.6.4. DNA separation on agrose gel ............................................................................................. 14

2.7. Inhibition of islet amyloid formation in vivo ............................................................................. 14

2.7. 1. Islet transplantation ................................................................................................................ 14

2.7.2 Implantation of osmotic pump.................................................................................................. 14

2.8. Fluorescence Resonance Energy Transfer (FRET) assay ........................................................... 15

2.8.1. Cell transfection ...................................................................................................................... 15

2.8.2. Production of recombinant peptides .................................................................................... 15

3. Results..........................................................................................................................................16-26

3.2. Analysis of cellular and secreted HS from B-TC-6 cultured at 11 mM and 22 mM glucose ..... 16

3.3. Interaction of isolated HS and HSPGs with hIAPP and rIAPP .................................................. 17

3.4. Proteglycans gene expression ..................................................................................................... 17

3.5. Islet transplantation .................................................................................................................... 17

3.7. Transfection of CHO and pgsD-677 cell line for FRET analysis ............................................... 17

3.8. Figures of results………………………………………………………………………………………………………………..19-26

4. Discussion....................................................................................................................................27-28

5. Acknowledgement ............................................................................................................................. 29

6. References ........................................................................................................................................ 30

7. Appendix ........................................................................................................................................... 34

4

Abbreviations

ATCC: American Type Culture Collection

B-TC-6: Beta-TC-6

BSA: Bovine serum albumin

CHO: Chinese hamster ovary

cpm: Counts per minute

CS: Chondroitin sulfate

DEAE: Diethylaminoethyl

ECL: Enhance Chemiluminescence

ECM: Extra cellular matrix

EM: Electron microscope

EXT: Exotosin enzymes

FBS: Fetal bovine serum

FRET: fluorescence resonance energy transfer

GAGs: Glycosaminoglycans

GlcA: Glucuronic acid

GlcNAc: N-acetylated

GlcNS: N-sulfated

GPC: Glypican

HG: High glucose

HGM: High glucose cell medium

hIAPP: Human IAPP

HPLC: High performance liquid chromatography

HRP: horseradishperoxidase

HS: Heparan sulfate

HS2ST: 2-O-sulfotransferase

HS3ST: 3-O-sulfotransferase

HS6ST: 6-O-sulfotransferase

HSPGs: Heparan sulfate proteoglycans

IAPP: Islet amyloid polypeptide

IdoA: Iduronic acid

Mt pellet: Mitochondrial pellet

NDST: N-deacetylase/N-sulfotransferase

NG: Normal glucose

NGM: Normal glucose cell medium

PBS: Phosphate buffered saline

PC: Prohormone convertase

PCR: Poly chain reaction

PGs : Proteoglycans

pgsD-677: Mutant of CHO

PI: Propidium iodide

rIAPP: Rat IAPP

RT: Room temperature

SDC: Syndecan

SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis

SG pellet: Secretory granules pellet

SGs: Secretory granules

SRG: Serglycin

T1DM: Type 1 diabetes mellitus

T2DM: Type 2 diabetes mellitus

TBS: Tricine buffered saline

5

Summary

Introduction: Islet amyloid poly peptide (IAPP) is a β-cell hormone produced and secreted

together with insulin in response to glucose. Under normal condition, IAPP participates in the

regulation of blood glucose homeostasis. Under certain circumstances such as type 2 diabetes

IAPP can misfold and form cell toxic amyloid. A lot is known about islet amyloid toxicity but

the islet amyloid initiation process still remains to be solved. Amyloid and proteoglycans have

been shown to co-localize and with this work I have studied if proteoglycans has any role in

IAPP amyloidogenesis.

Material and Methods: Pancreatic β-cells and isolated islets were metabolically labeled with 35S and secretory granules were isolated by homogenization and gradient centrifugation.

Proteoglycans were isolated from granules with ion exchange chromatography and chain length

and compositions were determined. Pancreatic β-cells were cultured in normal glucose (11 mM)

and high glucose (22 mM) and metabolically labeled with 35S. From these cells cellular and

secreted HS and HSPG were isolated and their binding to human IAPP, rat IAPP and insulin was

characterized using a nitrocellulose binding assay. mRNA was isolated from human and mouse

islets and β-cells, and used for analysis of glypican and syndecan expression. Islets were isolated

from human IAPP expressing mice and transplanted under the kidney capsule of nu/nu NMRI

diabetic mice. Six weeks after islet transplantation one group of mice was infused with heparin

sulfate fragments and the control group received infusions of vehicle. The degree of amyloid in

transplanted islets was determined after Congo red staining.

Results: We have shown that HS is present on the membrane of secretory granules. The

expression profiles of glypicans and syndecans has been determined and it was shown that

human islets express glypicans 1, 2, 3, 4 and 6 and syndecans 1 and 3, mouse islets express

syndecans 1 and 3, MIN6 cells express syndecans 1 and 3 and B-TC-6 cells express syndecans 1,

2 and 3. HS secreted from cells cultured at 22 mM glucose have shorter chain length than HS

secreted from cells cultured in 11 mM glucose. Interactions of human IAPP and rat IAPP have

been affirmed with isolated HS. Congo positive materials could be detected in some transplanted

islets in the non-HS-fragment infused group, but this study must be repeated on more mice.

Conclusions: It is known that the initial islet amyloid is formed in the secretory granules of the

beta cells in patients with type 2 diabetes. The characterization of HS in the secretory granule

containing fraction and the detected change of HS-chains induced by increased glucose support a

role for HS in IAPP amyloidogenesis.

6

1. Introduction

1.1. Islets of Langerhans

Islet of Langerhans was described by the German physician Paul Langerhans in the 1860-ies. Almost 1 million islets can be found in the pancreas and they constitute 1-2 % of the organ, in an adult individual. The size of the islets range from few cells up to 500 µm and they are evenly distributed throughout the pancreas (Ferner H, 1952; Lifson N, et al.1985). Five different endocrine cell types compose the islet and they are β-cells that secret insulin (reviewed in Brissoa M, et al. 2005) and islet amyloid poly peptide (IAPP) (Lukinius A et al. 1989), α-cell that secret glucagon (reviewed in in Brissoa M, et al. 2005 ), δ-cells that secret somatostatin (reviewed in in Brissoa M, et al. 2005), PP-cells that secret pancreatic polypeptide and ε-cells that secret ghrelin (Wierup N, et al. 2002; Brissoa M, et al. 2005).

1.2. IAPP

IAPP is produced by β-cells, and this second β-cells hormone is stored and co-secreted with insulin in response to glucose (Westermark P, et al. 1986, 1987). IAPP is produced as an 89 amino acid residues long pre-proIAPP molecule (Sanke T, et al. 1988; Betzholst C, et al.1989) from which a 22 residue long signal peptide is cleaved of when the peptide enter ER. The remaining proIAPP (67 aa) is transported through the ER and golgi network and undergo posttranslational processing in the secretory granules (SGs). At this cellular compartment is the C-terminal flanking peptide cleaved of from proIAPP by the prohormone convertase (PC) 1/3 after residues Lys50-Arg51 (Fig. 1), while the N-terminal flanking peptide is cleaved of by PC2 after residues Lys10-Arg11. Also, PC2 has the ability to process proIAPP at the C-terminal cleavage site in the absence of PC1/3 (Marzban L, et al. 2004) (Wang J, et al. 2001). Carboxypeptidase E (CPE) removes remaining di-basic residues at the C-terminus (Marzban L, et al. 2005; Milgram SL, et al. 1997). Proinsulin is processed into insulin by the same convertases as proIAPP (Figure1). Proinsulin is initially cleaved by the PC1/3 at the B-chain/C-peptide dibasic junction Arg31-Arg32 to form proinsulin processing intermediate des-31, 32proinsulin (Smeekens SP, et al. 1992; Zhu X, et al. 2002). The C-peptide/a-chain junction of proinsulin is cleaved by the PC2 after basic residues Lys64-Arg65. CPE removes the basic residues from the cleavage site (Docherty K, et al. 1983). IAPP is stored in the halo region of the secretory granule along with C-peptide while insulin together with Zn forms the dense core (Westermark P, et al. 1996).

Figure 1. Schematic drawing that describe the processing of proIAPP and proinsulin into biological active hormones.

7

1.3. Biological Function of IAPP

Over the years IAPP has been ascribed many important physiological functions, such as regulator of secretion from α-, β-, and δ- cells, satiety regulator, gastric emptying and a role in calcium homeostasis (reviewed in Westermark P, et al. 2011).

1.4. Amyloid and Amyloidosis

1.4.1. Amyloid

The term amyloid was taken from the Greek word amylon (starch) by Rudolph Virchow for describing the amorphous material present in some autopsy tissues (Virchow 1854). Already in 1859, it was discovered that amyloid consisted of protein, but the name was not changed. To be defined amyloid the following characteristics must be fulfilled: an extracellular or intracellular deposit that bind the dye Congo red and reveal green birefringence when viewed under polarized light. At high resolution, amyloid is detected as long sender un-branched fibrils with a diameter of 6-10 nm (Westermark et al amyloid 2010).

1.4.2. Amyloidosis

Amyloidosis is a heterogeneous group of diseases characterized by extracellular or intracellular deposits of insoluble protein aggregates. More than 25 proteins have been found to form amyloid in human (Westermark, et al. 2010), and each protein is linked to a specific amyloid disease. Amyloid diseases are categorized into two subgroups; Systemic amyloid disease and Localized amyloid disease. Examples of localized amyloidosis are Alzheimer’s disease (AD), type 2 diabetes (T2D) and amyloid in medullar carcinoma of the thyroid (MCT). Systemic amyloid diseases are often lethal diseases with massive amyloid deposits. In the systemic variants are circulating plasma proteins the amyloid precursor protein and in localized diseases are the amyloid precursor proteins expressed in the organ where the amyloid deposits. Amyloid formation is a toxic process and short aggregates have been suggested to incorporate into the cell membrane and create ion-leaking pores. Also amyloid fibrils can form between cells and interfere with the normal cell signalling (Mirzabekov TA et al. 1996; reviewed in Westermark P, et al.2011).

1.5. Diabetes and IAPP

1.5.1. Diabetes

The most common types of diabetes are type 1 diabetes (T1D) and T2D. T1D is an autoimmune disease where insulin producing β-cells are destroyed by an immunological reaction, eventually leading to a ceased insulin production. This form of diabetes usually debuts at a young age and require lifetime treatment (Gillespie KM, 2006). T2D is characterized by peripheral insulin resistance in combination with impaired insulin production and a reduction of insulin producing β-cells. This disease has a strong relation to genetic predisposition, life style, age, obesity, lack of exercise and environmental factors (De Fronzo RA, et al. 1992; Ross SA, et al. 2004). Prevalence data suggest that approximately 150-200 million people are affected by diabetes worldwide, but the number will increase and approximately 400 million people will suffer from diabetes by the year 2030 (Diamond J, 2003; Wild S, et al. 2004). In the long term, individuals with diabetes develop serious complications such as, neuropathy, nephropathy, cardio vascular diseases and retinopathy. A tight regulation of blood glucose can prevent or delay the development of complications and, therefore it is important prevent fluctuations in blood glucose. T1D is treated with exogenous insulin treatment (The Diabetes Control and Complications Trial Research Group, 1993) while T2D is initially treated with diet and changes in life style with an increase in physical exercises that can improve the peripheral insulin resistance and thereby reduce insulin demand (Knower WC, et al. 2002). When the

8

disease progress must the hyperglycaemic condition be treated with drugs that stimulate insulin secretion and improve insulin sensitive and finally with exogenous insulin (DeFronzo, et al. 1991; Lupi R, et al. 2002; Tack CJ, et al. 2006).

1.5.2. Role of IAPP in Type 2 Diabetes

Islet amyloid depositions have been found at autopsy in 60-95% of individuals with T2D (Westermark P, et al. 1973; Clark A, et al. 1995; Butler AE, et al. 2003). The amyloidogenic region of IAPP has been pinpointed to amino acid resides 20-29 of the IAPP. Rodents such as mouse and rat do not develop islet amyloid, and the reason for this is the presence of three proline residues in the amyloidogenic region 20-29. The amino acid residue proline is well known beta-sheet breakers (Betsholtz C, et al. 1989; Westermark P, et al. 1990). There is a mutation at position 20 in IAPP that has been linked to an increase risk for T2D in Asian population (Sakagashira S, et al. 1996). The mutation at position 20 in IAPP substitute serine with glycine (S20G) and this give rise to a more fibrillogenic IAPP compare to wild-type IAPP. So far, it is not clear how IAPP starts to aggregate, but the initial amyloid is formed intracellular and some of this early amyloid consists of proIAPP (Westermark P, et al.1995; Paulsson JF 2006). Amyloid fibrils is formed through the formation of smaller aggregates, often referred to as oligomers or protofibrils ( Glabe CG, et al. 2008). The small aggregates can incorporate into the cell membranes and form ion-leaking pores ( Mirzabekov TA et al. 1996) or physically disrupt the cell membrane (Engels MF, et al. 2006). In a study on the amyloidogeneity of proIAPP, IAPP, NIAPP (IAPPwith the N-terminal flaking peptide) and IAPPC (IAPP with the C-terminal flanking peptide) it was showed that the 4 peptides exert the same toxic activity. (Paulsson JF, et al.2008). It is important to remember that amyloid deposited between beta cells interfere with cell signaling and communication.

1.6. Amyloid Aggregation Hypothesis

There are several hypotheses on amyloid aggregation. One hypothesis is from the Westermark group where I have been working and suggests that proIAPP start to form amyloid within a single β-cell and this cause cell death. If the amyloid is not cleared from the islet it can now act as a seed for IAPP secreted from surrounding β-cells. When the amyloid mass grows it will interfere with the normal architecture of the islet. Recently, Jin Ping Li’s group, at Uppsala University has demonstrated that Aβ requires the presence of heparan sulfate (HS) on the cell surface to pursue its cell toxicity (Elina Sandwall, et al. 2010). Also, the same group has shown that HS co-localization with transthyretin (TTR) amyloid (Fredrik Noborn, et al. 2011). HS has also been detected in the IAPP amyloid (Young ID, et al. 1992).

1.7. Heparan Sulfate (HS)

HS is a ubiquitous molecule, present on the surface of all mammalian cells or in the extracellular matrix. These HS chains are highly anionic due to sulfatation, like heparin (Jorpes et al, 1948). HS binds to a wide variety of proteins (Figure 2), affecting their function and participation in cell signaling.

1.8. Biosynthesis of HS

The heterogeneous and complex structure of HS is generated through an organized enzymatic biosynthesis process. HS is composed of glucosamine residues, it can be N-acetylated (GlcNAc), N-sulfated (GlcNS) or in few cases N-unsubstituted and glucuronic acid (GlcA) or iduronic acid (IdoA) (Lindahl et al. 1991). Different enzymes play a role in biosynthesis of the HS structure (Fig.2); EXT1 and EXT2 adds alternating GlcNAc and GlcA residues, HS is sulfated by NDST(N-deacetylase/N-sulfotransferase) enzymes that convert GlcNAc into GlcNS. GlcA is converted to IdoA by C5-epimerase. 2-O-, 3-O- and 6-O- sulfatation are catalysed by 2-O-, 3-O-

9

and 6-O-sulfotransferase (HS2ST, HS3ST and HS6ST). Three isoforms of HS6ST and six isoforms of HS3ST have been found so far (figure 2) (reviewed in Joseph R. Bishop, et al. 2007).

Figure 2. Schematic image on the biosynthesis of HS and also indicated are different protein binding sites. (Figure has been taken from Joseph R. Bishop, et al. 2007)

1.9. Different families of Proteoglycans (PGs)

PG’s can be divided on the basis of their cellular location intracellular or to cell surface or extracellular matrix (ECM). So far serglycin is the only PGs found intracellular (reviewed in Humphries DE, et al. 1992). Syndecans and glypicans are the cell membrane bound PG’s. The syndecan family has four members and they have a transmembrane core protein that consists of an ectodomain with attached GAG chains, transmembrane region and a short cytoplasmic tail (Figure 3). Glypicans attached to a cell membrane through a glycosylphosphatidyl-inositol (GPI) and this family have six members. Glypican has been characterized by their cystein rich globular ectodomains with two to four HS chain attached (Merton Bernfield, et al. 1999). Perlecan is known as secreted PGs and present extracellular (Murdoch AD, et al. 1993)

Figure 3. Cartoon on cell surface PGs. Figure has been adopted from Merton Bernfield, et al. 1999.

1.10. Our hypothesis

To clarify if HS participate in IAPP amyloidosis we came up with a following hypothesis:

10

(A). Monomers of IAPP secreted from secretory granules (SGs) of β-cells, at secretion they interact with anionic HSPGs present on SGs membrane. (B) Bound IAPP form amyloid fibrils and the elongation of these fibril leads to rupture of the lipid bilayer resulting pores in the cell membrane. (C) Pores allow ion influx which activates the apoptosis cascade that result in cell death.

1.11. Aims

To test our hypothesis we: A. Investigated if proteoglycans (PGs) are present on the membrane of secretory granules. B. Characterized the surface PGs in human and murine islets. C. Investigated if HS structure is influenced by glucose concentration. D. Established an assay for analysis of cell surface proteoglycans role in mediation of

amyloid toxicity. E. Studied if HS –fragments can inhibit IAPP-amyloid formation in vivo.

11

2. Materials and methods

2.1. Cell lines

The following cell lines were used: Beta-TC-6 (B-TC-6): This murine β-cell line secret insulin, glucagon and somatostatin (Poitout V, et al. 1995), and was obtained from American Type Culture Collection (ATCC) (Manassas, VA, USA). MIN6 cells: This murine β-cell line has retained its glucose-stimulated insulin secretion, and contains more secretory granules compared to other β-cell lines (H. Ishihara, et al. 1993). This cell line was kindly provided by Anders Tengholm, BMC, Uppsala University, Sweden. At-T-20 is a murine neuroendocrine cell line that originates from pituitary, and was obtained from ATCC. CHO is a Chinese hamster ovary cell line that expresses cell surface associated HS (Lindholt, et al. 1992). PgsD-677 is a mutant clone from CHO with defect biosynthesis of HS. Instead, pgsD-677express chondroitin sulfate (CS) on the cell surface (Lindholt, et al. 1992). CHO and pgsD-677 were kindly provided by Jin Ping Li, IMBIM, Uppsala University, Sweden.

2.2. Animal strains

Five different mouse strains were used. hIAPP-Tg mice express human islet amyloid polypeptide (hIAPP), and islet amyloid is formed in old male mice fed a diet high in fat or in isolated islets cultured at high glucose. Heps-ko mice are depleted of heparanase that cleave HS into shorter fragments and animals from this strain have long cell-surface HS. Hep-Tg mice over-express heparanase and mice from this strain have short cell surface HS. C57BL/6 is an outbreed mouse strain. Hep-Tg, Heps-ko and C57BL/6 were provided by Jin Ping Li NMRI nude mice (nu/nu) were purchased from BK-lab, Stockholm, Sweden. Chemicals and other reagents are purchased from Sigma, Stockholm, Sweden if not otherwise stated. Cells are cultured in RPMI-1640 medium containing 100IU/ml penicillin, 100µg/ml streptomycin, 10 % fetal bovine serum (FBS) and 50µM β-mercaptoethanol (Sigma).

2.3. Isolation of secretory granules from endocrine cells

2.3.1. Islet isolation

Collagenase digestion was used for islet isolation from hIAPP-Tg, Heps-Ko and Hep-Tg strains. The animal was sedated with an IP injection of pentobarbital and the abdominal cavity was cut opened and the liver was tilted to expose the bile duct. Three mg collagenase in 3 ml Hank’s buffer was injected through the bile duct into the pancreas, the mouse was killed and the pancreas was excised and further incubated for 12.5 minutes, at 37˚ C. Digested tissue was washed three times in Hank’s buffer and spun down at 200g for 2 minutes, at 10˚C (AllegraTM X-2R centrifuge, Beckman CoulterTM, USA). The pellet that remained after the third centrifugation was mixed with 30 ml Hank’s buffer and filtered through a net. Filtered material was collected by centrifugation and the pellet was dissolved in 15 ml histopaque (HisopaQueR – 1077, Sigma). Thereafter, was 10 ml serum free RPMI 1640 added on top of the islet-histopaque slurry and the material was centrifuged at 900g, 22 minutes, 10˚C. The acceleration and deceleration was set to 3 and 0, respectively. Islets were recovered from the region between the two solutions and transferred to a petri dish.

12

2.3.2. Metabolic labeling and homogenization of islet cells

Isolated islets were cultured in medium containing Na-35SO4 100 µCi/ml for 72 hours, homogenized in 0.6 ml of 0.25 M sucrose with 6 µg bovine serum albumin (BSA) pH 6.3, by a Dounce homogenizer. Isolation of secretory granules was performed according to the protocol given by Zanini (A. Zanini, et al. 1972). Briefly, the homogenate was spun down at 1500 RPM for 10 minutes in an Eppendorf centrifuge (Eppendorf, USA). The supernatant was saved while the remaining pellet was re-homogenize in 0.3 ml of 0.25 M sucrose with 3µg BSA, pH 6.3, spun down as above. The supernatant and pellet were separated and this pellet is referred to as ¨cellular pellet¨. The 2 supernatants were pooled and DNA was digested with Pancreatic DNaseI (10 µg/ml) for an hour on wet ice. After digestion was the material applied on 0.4 ml of 0.3 M sucrose with 4 µg BSA, pH 6.3, and centrifuged at 1500g for 5 minutes. The formed pellet was named “Mitochondrial Pellet” (Mt pellet) and this step was performed to remove mitochondria. The remaining supernatant was re-centrifuged at 14600 g for 12 minutes and the formed pellet was named “secretory granule pellet (SG pellet)”. The Mt pellet and SG pellets were dissolved in 0.3 ml MOPS with protease inhibitors and applied on top of sucrose gradients (15%, 30%, 45% and 60% sucrose) as depicted in (appendix Figure.1) and centrifuged 114 500g in a SW 50.1 rotor, for 45 minutes, at 10˚C (Beckman, XL-80 Ultracentrifuge, USA).

2.3.3. Slot Blot analysis of insulin content

After ultracentrifugation was the sucrose gradient divided into 8 fractions (500 µl/fraction). From each fraction was a 10 µl aliquot recovered and mixed with 0.1 M Tris-HCl pH 6.8 with 24% glycerol, 8% SDS, 0.2 M DTT, boiled for 10 minutes and applied to a nitrocellulose membrane pre-equilibrated with 0.1 M NaHCO3 buffer, pH 8.9. Unoccupied binding sites of the membrane was blocked with 5% milk (Semper, Sweden) in 50 mM Tris pH 7.3 and 150 mM NaCl (TBS). Granular insulin content was detected with an anti-insulin guinea pig antibody (Dako, Stockholm, Sweden), diluted 1:5000 in TBS and incubated overnight, at 4 C. The membrane was washed three times in TBS and the reactivity was detected with HRP-conjugated secondary antibody (Dako) diluted 1:2000 in TBS for 2 hours followed by incubation in Enhance Chemiluminescence (ECL plus) solution (GE Health Care). The signal was detected with a Kodak image station (Kodak 4000 nm Image station, USA).

2.3.4. Electron microscopy (EM)

Factions shown to contain insulin by slot blot were morphologically analyzed by TEM. A small aliquot from each fraction was fixed in 2.5% glutaraldehyde overnight, rinsed in 0.1 M sodium-caccodylate buffer for 15 minutes and post-fixed in 1% OsO4 for 15 minutes. After rinsing in 0.1 M sodium-caccodylate buffer was the sample dehydrated in 70%, 95% and absolute alcohol (15 minutes each), incubated in propylene oxide (5 minutes), propylene oxide and pure resin mixed (1:1) (30 minutes) and thereafter in pure resin, overnight at RT. Next day was the samples transferred to 60 C and kept there for 48 hours. Thin sections were cut and placed on cupper grids, stained with 2 % uranyl acetate and Reynolds lead citrate. The material was analyzed with a Hitachi electron microscope (Hitachi H-7100, Japan).

2.4. HS isolation and characterization Insulin positive fractions were pooled and sonicated (Soniprep MSE 150, UK) to disrupt the granules and thereafter, used for HS isolation.

2.4.1. DEAE

Diethylaminoethyl (DEAE) is an ion exchange chromatography medium, with positively charged groups that bind negatively charged molecules such as PGs.

13

One ml of DEAE Sephacel (GE health care) was packed into a column and equilibrated with buffer A (50 mM NaAc, pH 7). The sample was added to the column and unbound material was washed out with buffer B (50 mM NaAc, pH 4.5, 0.1 M NaCl) until no radioactivity could be detected in the elute. The bound sample was recovered through elution with buffer C (50 mM NaAc, pH 4.5, 3 M NaCl). The sample was desalted by separation on PD-10 columns (GE health care) and lyophilized. Lyophilized PGs were re-dissolved in distilled water and the radioactivity was measured by a scintillation counter.

2.4.2. Chondroitinase ABC digestion

Isolated PG was treated with chondroitinase ABC for 18 hour, at 37 °C. This enzymatic digestion that removes CS was followed by an incubation with benzonase, RT, for 2 hours. Benzonase digest DNA and the reaction was stopped by boiling. Digested PGs was purified on DEAE column (0.5 ml) pre-equilibrated with 50 mM tris-HCl pH 7.4, 0.1 M NaCl (buffer D). The column was washed with buffer C, until no radioactivity was detected in the lute. Bound substances were eluted with 50 mM Tris-HCl, pH 7.4, 3 M NaCl, (buffer E). Eluted sample was desalted on a PD-10 column, lyophilized and re-dissolved in distilled water.

2.4.3. Alkaline treatment

One part of the chondroitinase digested PG was treated with 0.5 M NaOH (final concentration), on ice, overnight with agitation. Next day was the pH neutralized with HCl.

2.4.4. Nitrous acid (HNO2) treatment

Nitrous acid treatment is performed to determine the purity of isolated HS and HNO2 with pH 1.5 cleaves N-sulfated HS. Saturated Barium nitrite (Ba(NO2)2) in 0.25 M sulfuric acid was added to dried heparan sulfate proteoglycans (HSPGs) (5000 cpm) and the mixture was incubated for 10 minutes, at RT. The reaction was stopped after addition of 30 µl sodium carbonate, and the pH was adjusted to around 7.

2.4.5. HS chain length analysis.

Samples with 5000/cpm from chondroitinase digested PGs, nitrous acid treated PGs and alkaline treated PGs were separated on Superose 12 column with HPLC. Fractions were collected and cpms were determined. Secretory granules and SGs HS were also isolated from At-T-20 cells, MIN6 and B-TC-6 cells and analyzed with the procedures described in section “2.3 and 2.4”.

2.5. HS isolation from B-TC-6 cells cultured in normal (11 mM) or high glucose (22 mM)

2.5.1. Metabolic labeling of B-TC-6

B-TC-6 cells were seeded in 75 mm2 culture flasks and grown in 11 mM glucose or 22 mM glucose. When cells reached 80% confluence were they metabolically labeled with Na-35SO4 (100 µCi/ml) for 48 hours, at 37˚C. Medium from cells cultured at 11 mM or 22 mM glucose were collected separately in 50 ml falcon tubes, centrifuged at 900 RPM, 10 minutes at RT. The supernatant was transferred to new falcon tube and mixed with an equal volume of 2X lysis buffer (8 M urea, 2% Triton X-100, 0.2M NaCl and 100mM Tris-HCl, pH 7.4). Lysis buffer (2ml) was also added to the culture flasks and attached cells were scraped off with a rubber policeman and transferred to falcon tubes. Cells in lysis buffer was kept on ice on a rocking platform for one hour, and thereafter, pelleted by centrifugation 17500g, 20 minutes at 4˚C. The supernatant expected to contain cellular PGs was transferred to new falcon tubes. Thereafter, was HS isolated and characterized from the four samples containing secreted or cellular PGs using the procedures described in section “2.4”.

14

2.5.2 Nitrocellulose-filter trapping assay

Small molecules such as glycosamino glycans (GAGs) can pass through the nitrocellulose membrane while larger molecules are trapped on the membrane. This procedure can be used for studies of protein-GAG interaction (Johan Kreuger, et al. 2003). Human IAPP (1 µg and 10 µg), rat IAPP (10 µg) and insulin (10 µg) were solubilized in phosphate buffer (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4 and 1.4 mM KH2PO4, (PBS)) with 0.1% bovine serum albumin (BSA), pH 7.4 and to each sample was HS (3000 cpm) or HSPGs (3000 cpm) isolated from cells cultured at 11 mM or 22 mM glucose added. The final volume was 200 µl and incubation took place at RT, for 2 hours. Each sample was applied to an individual nitrocellulose membrane equilibrated with PBS, pH 7.4. The membranes were washed three times with PBS, dried and transferred to scintillation tubes containing 2 M NaCl. After 30 minutes incubation during which the HS or HSPGs protein complexes are expected to be released from the nitrocellulose filter were ten ml scintillation cocktail added and total cpm was measured.

2.6. Proteoglycan gene expression

2.6.1. Design of primers

We used JustBio to design primers (www.justbio.com) for human and mouse syndecan (SDC 1-4) and glypican (GPC 1-6) families.

2.6.2. RNA isolation and cDNA synthesis

Total RNA was purified from islets isolated from C57 mice and cultured for 24 hours, 7 days and 14 days at 11 mM or 22 mM glucose, human islets cultured for 24 hours at 5.6 mM glucose and from B-TC-6 and MIN-6 cultured at 11 mM glucose. RNeasy Mini kit (Qiagen) was used for isolation and cDNA was synthesized from 5 µg of total RNA using First Stand cDNA synthesis Kit (Fermentas Life sciences, Gothenburg, Sweden). The procedures were performed following the instructions given by the manufacturer. Temperature incubations were performed in a Gene Amp PCR System 9700 (Applied biosystem, Sweden).

2.6.3. PCR analysis

PCR reactions were done according to information given in appendix table 2 and 3 and performed in a Gene Amp PCR system 9700.

2.6.4. DNA separation on agrose gel

PCR products were separated on 1.8% agrose gel prepared in TAE (0.04M Tris-acetate, pH 8.0 and 1mM EDTA) and DNA was visualized with SYBR gold dye (SYBR GOLD, Invitrogen) diluted in TAE (1: 104). Photos were taken by KODAK image station.

2.7. Inhibition of islet amyloid formation in vivo

2.7. 1. Islet transplantation

Islets were isolated from hIAPP mice and cultured in RPMI 1640 for 24 hours prior to transplantation. A graft consisting of 300 islets was implanted under the kidney capsule of alloxan treated nu/nu mice. After surgery was the blood glucose level monitored daily for 4 weeks in tail blood using a glucose meter (Lifescan, USA).

2.7.2 Implantation of osmotic pump

Four weeks after transplantation were 5 mice implanted subcutaneously on the back with an osmotic pump (Alzet) that delivered short HS fragment in PBS (50 µg/day). At the same time five mice received osmotic pump that delivered PBS. These animals were followed for 4 weeks and then sacrificed by an intra-peritoneal injection of Avertin. In connection to this was blood

15

collected from the orbital plexus and stored at -18 ˚C, until used. From each mouse we recovered both kidneys, a slice of spleen, heart, part of the duodenum and pancreas for histological analysis. Removed organs were fixed in 10% neutral buffered formalin and embedded in paraffin. Sections (6 µm) taken from the islet implant were placed on plus slides, and stained for amyloid with Congo red. Sections from the other organs were stanined with hematoxylin and eosin and used for morphological analysis.

2.8. Fluorescence Resonance Energy Transfer (FRET) assay

2.8.1. Cell transfection

CHO and pgsD-677 cells were cultured in RPMI-1640, in a 24 well plate. At 80% confluence cells were transfected with pRcCMVi.FRET-KEAF or pRcCMVi.DEVD12 vectors, using TurboFect TM in vitro Transfection Reagent kit (Fermentas Life sciences). After 24 hours, a G-418 antibiotic (0.4mg/ml) was added to the cells to facilitate formation of stabile expressing clones. Both pRcCMVi.FRET-KEAF and pRcCMVi.DEVD12 contain green fluorescent protein (GFP) and transfected cells can be selected based on the GFP-signal. The cells were studied in a Nikon Eclipse TE2000-U microscope with a Nikon confocal unit with argon 488 nm and HeNe 633 nm laser (Nikon Kawasaki, Japan). The photos were taken with an EZ-C1 camera and software version 3.90 for Nikon confocal microscopy.

2.8.2. Production of recombinant peptides

DNA corresponding to human proIAPP (ProIAPP), or hIAPP had earlier been inserted behind GST in the pGEX 2Z vector and transfected to Y1090 bacteria. To enable protein synthesis was Y1090 with vector cultured in Luria broth with ampicillin (100µg/ml), with shaking (270 RPM), (Infors HT, Basel, Switzerland), at 37°C until OD A600 reached 0.8. Protein synthesis was induced by the addition of 1 ml 0.5 M isopropyl β-D-1 thiogalactopyranoside (IPTG) and lasted for 3 hours, at 25˚C. For protein isolation was bacteria centrifuged at 6300g, 20 minutes at 10˚C in a Sorvall centrifuge (Sorvall Heraeus, UK). The supernatant was discarded and pellet containing the GST-ProIAPP or GST-IAPP was re-suspended in TEDG buffer (50 mM Tris-HCl pH 7.4, 1.5 mM EDTA, 10% glycerol, 400 mM NaCl) and sonicated three times for 20 seconds. Lysed bacteria were centrifuged at 100 000g in a SW 40 Ti rotor, for 30 minutes, at 4˚C (Beckman XL-80 Ultracentrifuge, USA). The supernatant was transferred to Glutathione Sepharose-4B beads (GE health care) equilibrated with TEDG buffer and incubated end over end for 2 hours, at 4 ˚C. The GST tagged protein is expected to bind to the beads and this facilitates purification of the protein. Beads with peptide were spun down at 3000g for one minute and supernatant was decanted. The beads were washed three times in NET N-buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 5 mM EDTA and 0.5% NONIDET-P40), followed by three washes with PBS. The beads were spun down between washes by centrifugation at 3000g for 30 sec and supernatants were decanted. The recombinant peptides were cleaved of from the GST tag by incubation in thrombin protease 20 U/mg (GE health care). The degree of expression and purity of recombinant synthesized proteins were evaluated by tricine-sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) electrophoresis.

16

3. Results

3.1. Presence of PGs on SGs membrane The procedure necessary for granule isolation was not present in the group and had to be established. I performed a literature search and found the procedure described by Zanini (A. Zanini, et al. 1972). This procedure was applied for isolation of β-cell granules, and I used At-T-20 and B-TC-6 cells for the initial work. Isolation started with a homogenization step to destroy the cells and the efficiency of cell destruction was verified by staining a small aliquot of homogenized cells with propidium iodine (PI). PI binds to DNA and the absence of cell nuclei indicates sufficient cell destruction (figure 5, A and B).We used insulin as a marker for β-cell granules recovered from the sucrose gradient and insulin containing fractions were pooled and used for HS isolation. In figure 6 is the result from the slot blots shown and the number of insulin containing fractions varies between isolations. When I was confident with the isolation procedures I continued with purification of granules from heps-Ko and heps-Tg islets. The method used for islet isolation follows a standard protocol established at the department. This protocol allows isolation of islets from 4 animals, and an average of 1000 islets was isolated each time. The first isolated islets were metabolically labeled with 35S for 24 hours, and the results from insulin detection in the fractions from heps-Ko and heps-Tg SGs pellets and Mt-pellets are shown in figure 6. The insulin reactivity with fractions from heps-Tg SGs fractions appears to be much stronger. The reason for this discrepancy is unknown, but these fractions can contain more insulin or the strong reaction could depend on a more optimal granule isolation. Small aliquots from insulin positive fractions (figure 6, blue line) were taken for analysis with TEM analysis, and some of these fractions contained granular formation with the expected size. Insulin positive fractions were pooled but the 35S content was low and not sufficient for HS isolation. The low 35S labeling was most likely caused by the short incubation time, and for the next experiment was the metabolic labeling time increased from 24 to 72 hours. This resulted in an increased labeling and the original biochemical analysis and characterization of HS started on these isolated islets, but the yield was still low and it was not possible to perform a complete characterization of HS content. To receive a better yield of radioactive material we returned to the B-TC-6 cells. After granule isolation, fractions were shown to be positive for insulin (figure 6, red line) analyzed with EM and some formations with dense core and sizes of secretory granules could be detected (figure 7 B). Insulin positive fractions were pooled and chain length of PGs was analyzed on a Superose-12 column. Separation revel two peaks that corresponded to HS and free sulfate, respectively. The amount of radiolabelled PGs was still low and we changed to MIN6 cells that are known to contain more granules than B-TC-6 cells. MIN6 cells were metabolically labeled and granules were isolated. Insulin positive fractions were pooled and used for HS isolation (figure 6, green line). Separation of the material on a Superose-12 column after alkaline treatment (Fig.8 A, blue line) and CS digestion (figure 8A, red line) show that there is not much CS present on the granules of MIN6 cells. In addition, both chromatographs show that there are two peaks corresponding to HS with different chain length. Treatment of HS with HNO2 at low pH results in cleavages of the chain at N-sulfated glucosamine residues. Treatment of the HS fraction isolated from MIN6 cells resulted in a complete degradation of the chain. This is shown in figure 8 B and suggests that the HS fraction is pure and contains no other GAGs The cellular and secreted HS isolated from MIN6 cells were also analyzed on Superose-12 column and both separation profiles show the same two peak pattern as HS isolated from SG fraction (figure 8 C and D).

3.2. Analysis of cellular and secreted HS from B-TC-6 cultured at 11 mM and 22 mM

glucose

B-TC-6 cells cultured at 11 mM and 22 mM glucose were metabolically labeled with 35S for 48 hours. HS was isolated from the attached cells and from the medium. The obtained labeling of these cells was sufficient for some preliminary analysis. The results are presented in figure 9 A-D. Elution of secreted

17

HS isolated from cells cultured in 11mM glucose starts before when compare to cells cultured in 22mM glucose (figure 9 A, red arrow), also there is a shift in peaks (figure 9 A, black arrow). Figure 9B is the result of cellular HS isolated from 11mM and 22mM glucose cells, this suggests that there is also a shift in chain length (orange arrow). In the appendix figure 2 (A-D) showing the results of different steps of HS isolation form cells cultured in 11mM and 22mM glucose. In these results blue line corresponding to PGs digested by chondroitin sulfate, red line correspond to PGs after alkaline treated and green line correspond to HS after HNO2 pH 1.5 treatments. The shifts were monitored in red line and green line when compared to blue line that suggested us that isolated radioactive material is containing only HS.

3.3. Interaction of isolated HS and HSPGs with hIAPP and rIAPP

Interaction between HSPGs isolated from cells or medium from B-TC-6 cells cultured at 11 mM glucose with hIAPP or rIAPP was investigated using the nitrocellulose binding assay. The result suggests that both cellular and secreted HSPGs interact with hIAPP and rIAPP but not with insulin. Binding with rIAPP is slightly less when compare to hIAPP. In this experiment was DMSO used as a negative control and no binding occurred (figure 10). Interaction of IAPP with isolated cellular and secreted HS from B-TC-6 cultured in 11mM and 22mM glucose were also studied (figure 9 C&D). IAPP interacts with HS, however, the degree of interaction varies depend on the source of HS. Secreted HS isolated from B-TC-6 cells cultured at 11 mM glucose interacts more with IAPP when compare to cells cultured at 22 mM glucose.

3.4. Proteglycans gene expression

To determine the presence of different cell surface PGs we extracted total RNA from human islets, C57 black mice islets and whole pancreas, B-TC-6 and MIN6 cell. The quality of isolated RNA was very good. In a pilot study, no PCR-product appeared after 40 cycles, thus the protocol was adjusted and the PCR was performed for 25 cycles and from this reaction was 5 µl solution used as template for the second PCR that was run for 40 cycles. The PCR products were separated on 1.8% agrose gel. The results on human islet are shown in figure 11, and suggest that GPC-1, 2, 3, 4 and 6 and SDC-1 and 3 are present. Mouse whole pancreas contains GPC-1, 2 and 4 and SDC-2 and 4 (figure 12 A). The quality of RNA isolated from mouse islets was not that good. Despite this, we could detect SDC-1 and 3 in this sample (figure 12 B). MIN6 cells express SDC-1 and 3 and B-TC-6 cells express SDC-1, 2 and 3 (figure 13 A and B).

3.5. Islet transplantation

Islets from hIAPP mice were isolated and cultured for 24 hours in tissue culture media to digest exocrine tissue. Next day morning was the quality of the islets checked and when found healthy they were implanted under the kidney capsule of nu/nu mice. The experimental plan was that the recipients should be diabetic, but the alloxan treatment did not work properly. Implants were given to both diabetic and non-diabetic recipients. Islet implants did not reverse diabetes in all diabetic mice. However, moderate diabetic mice were recovered after transplantation. Five mice died during operation and diabetes induction. Islet implants were sections and stained for amyloid with Congo red. Amyloid could be detected in implants from 2 out of 5 control mice and no amyloid was detected in mice that received short HS fragments (figure 14)

3.7. Transfection of CHO and pgsD-677 cell line for FRET analysis

To analyze if HS is necessary for the IAPP- cell membrane interaction and the subsequent induction of apoptosis, CHO and pgsD-677 were transected with a vector that contain a caspase-3 reporter. Four new cell lines were established CHO-DEVD, CHO-KEAF, pgsD-677-DEVD and pgsD-KEAF. Cells from these new cell lines were stained with DAPI and the analyzed with a confocal microscope. All transfected cells revealed a strong cytoplasmic fluorescence at excitation wavelength 488 nm (figure 15A-D). The degree of fluorescence intensity varies

18

between cells. However, this will not create any problems since the apoptosis assay uses changes in ratio between the signals detected at 535nm/480. I have performed some initial evaluations of the assay, and started to compare the signal from cultures containing different cell numbers. On day one was 10 000 cells/well (n=8, from each line) seeded into a 96 wells plate. Absorbance was measured after 1, 2 and 3 days of culture (figure 15). As expected it is shown that the signal does not depend on the cell number (day 1). The increase in FRET ratio detected day-2 and 3 for CHO-DEVD and pgsD-677-DEVD cells could depend on apoptosis induced in cells in crowded wells (figure.15 E). To compare the influence of assay buffer was cells cultured in KRHG (blue bars), KRHG with 1%FBS (red bars) and HBSS (green bars) and the fluorescent signal was measured at the time points 1, 2, 3,4 5, 6, 7 and 8 hours (figure 15F-I).

19

3.8. Figures of the results

Figure 5. Propidium Iodide (PI) Staining: B-TC-6 and MIN6 cells were stained with PI (100 µg/ml) to determine the degree of cellar destruction after homogenization. Before homogenization B-TC-6 (A) and MIN6 cells (C). After homogenization B-TC-6 cells (B) and MIN6 cells (D). The absence of cell nuclei indicates successful destruction.

A B

C D

20

Figure 6. Insulin reactivity in the fractions recovered after ultracentrifugation: Isolated secretory granules (SG) and mitochondria fraction (Mt) isolated from a heps-Ko and heps-Tg mice, B-TC-6 and MIN6 cells were separated on sucrose gradient and 8 fractions were collected from top to bottom (500 µl/fraction) and the presence of insulin was analyzed. Reactivity was visualized with HRP and enhances chemiluminescence system using Kodak image station.

21

Figure 7. Chain length analysis of HS isolated from granules of B-TC-6 cells was performed on Superose-12. Two peaks are seen and the first correspond to HS and the second correspond to free S. Electron Microscopical analysis of an insulin positive fraction. This fraction shows aggregates with sizes that correspond to single or fused secretory granules (Black arrow).

B

A

22

Figure 8. Gel chromatography of HS derived from cellular, secreted and granule isolates of MIN6: MIN6 cells were metabolically labeled with 35S for 48 hours followed by isolation of HS from SGs were isolated. HS was also isolated from the remaining cellular fraction depleted of granules and the culture medium that contain secreted HS. Separation was performed on a Superose-12 column. (A) Chain length analysis of GAGs isolated from SGs’ GAGs (blue line) and chondroitinase treated GAGs (red line). (B) HS isolated from SGs was treated with HNO2 at pH 1.5 (green line). In (C) is the elution profile of HS isolated from MIN6 cells depleted granules and in (D) is the elution profile on HS isolated from the cell culture medium (represent secreted HS) presented.

23

Figure 9. Chain length analysis was performed on HS from the cellular and secreted fractions of B-TC-6

cultured at 11 mM and 22 mM glucose and interactions between HS and hIAPP was studied. B-TC-6 cells were cultured at 11 mM and 22 mM glucose prior to HS isolation. (A) Alkaline treated HS (5000 cpm) were isolated from culture media and separated on a Superose 12 column. Black arrow indicate that the HS isolated from media of cell cultured at 11 mM glucose (NGM) elute prior to HS isolated from media of cells cultured at 22 mM glucose (HGM).(B) Metabolically labeled HS (5000 cpm) were isolated from B-TC-6 cells cultured in 11 mM glucose (NG, blue line) and 22 mM glucose (HG, red line) were analyzed after separation on Superose-12. Orange arrow indicates the shift in elution profile between NG and HG. In (C-D) is the interaction between hIAPP and the isolated HS shown. HIAPP binds most efficiently to HS isolated from the medium of B-TC- 6 cells cultured in 11 mM glucose

24

Figure 10. HSPGs isolated from B-TC-6 bind hIAPP and rIAPP. Metabolically labeled HSPGs (300 cpm) isolated from B-TC-6 cells and medium of the cells cultured at 11 mM glucose were incubated with 10 µg hIAPP, rIAPP or insulin in PBS, pH 7.4, 0.1% BSA for two hours. (A) HIAPP reveal the highest affinity for HS and in (B) cellular HSPG. Data are presented as mean of three individual assays.

Figure 11. Gene expression of proteoglycans in human islets: Glypicans 1, 2, 3, 4 and 6 and syndecans 1 and 3 are present in human islets. PCR products were separated on 1.8% agrose gel by electrophoresis; bands were visualized by SYBR gold dye in Kodak image station.

25

Figure12. Gene expression of different proteoglycans in mouse pancreas and isolated islets: ( A) Glypicans 1, 2, 3 and 4 and syndecans 4 pancreas and (B) syndecans 1 and 3 are present in mouse pancreas and isolated islets, respectively. PCR products were separated on 1.8% agrose gel by electrophoresis; bands were visualized by SYBR gold dye in Kodak image station.

Figure 13. Gene expression of different proteoglycans in MIN6 and B-TC-6 cells: In (A) Syndecans 1 and 3 are present in MIN6 cells and (B) Syndecans 1, 2 and 3 are present in B-TC-6 cells. PCR products were separated on 1.8% agrose gel by applying electrophoresis; bands were visualized by SYBR gold dye in Kodak image station.

Figure14. Transplanted islets with amyloid recovered from a control animal. HIAPP islets have been implanted under the kidney capsule of nu/nu mouse. The implant from this control animal contains large amounts of amyloid (black arrows).A is Congo red stained section and B the same section viewed in cross-polarized light.

26

Figure 15. Detection of pFRET-KEAF and pFRET-DEVD expression in CHO and pgsD-677 cells. Confocal images of pFRET-DEVD expression in CHO cells (A) and pgsD-677 cells (C), pFRET-KEAF expression in CHO cells (B) and pgsD-677 (D). Fluorescence data (535nm/480nm) are presented as mean values (n=8). (F-I). Analysis were performed with different incubation buffers KRHG (blue bars), KRHG with 1%FBS (red bars) and HBSS (green bars) and performed over time (0-8 hours). Scale bar 25 µm.

27

4. Discussion

PGs are ubiquitous molecules present on the surface of all cells and they participate in a wide range of cellular mechanisms. PGs have been found associated with all different types of amyloid deposits (Ancsin, 2003) and Jorpes isolated heparin from a horse liver filled with amyloid (Jorpes E., 1935). Proteoglycans have been detected in islet amyloid (Castillo GM, et al.1998, 2000) and in in vitro studies on amyloidogenesis has HS been shown to promote IAPP fibrillation (Castillo GM, et al. 1998). Also, interaction between GAGs and proIAPP has been shown to facilitate aggregation and amyloid formation (Kirily Park, et al.2001). Amyloid was for long considered to be extracellular deposits, but it was recently shown that IAPP aggregation at least starts intracellularly. More precise is the initial amyloid detected in the halo region of the secretory granules (Paulsson JF, et al. 2006). Since no publication on PGs in secretory granules of β-cells could be found, we decided to characterize the expression pattern of PGs and if possible determine if they could be detected within the SGs. A publication on HS in At-T-20 cell was found (Giuliana Giannattasio and Antonia Zanini, 1976) and the described procedure used for HS isolation was adjusted and used for isolation of HS from β-cells. To establish the isolation and characterization processes we used B-TC-6 cells and then our work continued on isolated islets. We used mice from strains that overexpressed heparanase or were deficient for heparanase. We did not expect the HS profile from these mice to be completely normal. Instead we expected that HS from the heparanase deficient animals should be easier to isolate and characterize. We had to abandon the isolated islets since it was difficult to gain sufficient radioactive sulphur (S-35) labeling of the carbohydrate chains, and instead we continued with cells from the B-TC-6 line. We started with this line since it was available at the laboratory and we could verify that the isolation and characterization procedures worked well and it was possible to isolate granule fractions that contained insulin. This was shown by dot blot analysis with antibodies reactive against insulin. However, the EM studies on insulin-containing fractions indicted a low number of granules. Therefore we changed to MIN6, a cell line that is known to contain more secretory granules than B-TC-6 cells. Granule isolation from MIN6 cells resulted in 4 insulin positive fractions and TEM analysis of these fractions revealed granule like formations. To ensure the origin of these formations we will perform immuno-EM with insulin specific antibodies. However, the results until now suggest that the MIN6 cell line should be the choice when the work is continued.

During the development of type 2 diabetes the β-cells are exposed to high glucose during an extended time period. The detected differences in HS chain length secreted from B-TC-6 cells cultured at 11 mM and 22 mm glucose are interesting and indicate that HS synthesis or processing can be influenced by glucose. An up-regulation of heparanase has been shown to occur in high glucose treated endothelial cell (Juying Han et al. 2007). As a continuation of this work we have cultured mouse and human islets at 11 and 22 mM glucose during 1, 7 and 14 days. From these islets mRNA has isolated and cDNA synthesized and this will be used for quantification of enzymes important for HSPG production.

A major drawback with the performed work was the low yield of labeled HS and HSPG and only minor amounts of HS remained for further studies after characterization. It was therefore difficult to repeat and modify some of the experiments, but the received results are interesting and suggest that the work can be repeated and extended using the MIN6 cells.

We intend to investigate if HS plays any role for IAPP cytotoxicity. For this we will use the cell lines CHO and pgsD-677 for transfection with a caspase 3 activity reporter. The caspase 3 reporter consists of 2 different fluorophores liked together with the caspase 3 specific

28

sequence DEVD. When the fluorophores are linked together by DEVD, energy is transferred from one fluorophore to the other, but if caspase 3 is activated it can cleave DEVD and the fluorophores separate (Paulsson JF, et al. 2008). This separation is detected as loss of FRET. A control vector is used and it contains the non-caspase 3 sequence KEVD, and will not be processed by caspase 3. The work has been initiated and the conditions for the assay have been determined. The advantage with this system is that it will not be restricted to studies on IAPP and IAPP fibrillogenesis but can be used for studies on all types of amyloid proteins.

It might seem a bit strange to use HS-fragments as a prevention therapy for IAPP-amyloid since HS most likely promotes the IAPP fibril formation (Ancsin, 2003: Castillo GM, et al. 1998, 2000). However, we think that IAPP amyloid formed intracellularly results in β-cell death and if the amyloid remains extracellularly it will function as seed and the formed amyloid will derive from IAPP secreted from the surrounding beta cells. If the propagation of amyloid is blocked, deposited amyloid can be removed by macrophages and extracellular IAPP toxicity is prevented. We have shown that short HS-fragments prevent islet amyloid formation in cultured islets and wanted to test if this inhibitory effect remains in vivo. The islet transplantation study was a pilot study with five subjects in each group. The original plan was to perform more transplantation, but the nu/nu mice responded not very well to the alloxan injections and some animals had to be excluded from the study prior to transplantation. The number of studied animals is low and must be extended before any conclusions can be drawn. However, detection of amyloid in 2 of the non-treated mice but the absent of amyloid in HS-fragment treated mice is exciting. Evaluation of the histology of the other organs from HS-fragment infused mice showed that this treatment did not cause any morphological changes or internal bleeding.

In conclusion data collected from the biochemical and molecular biology analysis suggests that HS is present on the membranes of the secretory granules. It is therefore possible that HS participates in the initiation of IAPP fibrillation at this location. Glucose concentration influences the chain length of HS and this can give rise to HS with a higher binding capacity for IAPP.

29

5. Acknowledgement

Almost two years ago, I vividly remember my first day in the Medical Cell Biology Department when Gunilla Westermark kindly introduced me to the lab and its amiable people. In an experience as joyous as the first day, she gently leaded me into the field of IAPP and later on to my co- guide; Jinping Li. Jinping Li who values the qualities of calmness and composure, never let me feel apprehensive of the HS field.

A great source of inspiration is Per Westermark who discovered IAPP. He was also tremendously helpful during discussions at the Journal Club.

During all my days in the lab, Marie has been a buffering agent of sorts. She has helped me with lab skills, writing skills and has been there to give me her never failing reassurance to keep persevering.

IBG has played an integral role in raising me to an internationally recognized position, a platform that has allowed me to establish a reputation over many communities of Uppsala. For this I bear immense gratitude towards Eva Damm, Elisabeth Långström, Lars- Göran Josefsson, Katariina Kiviniemi Birgersson and all my teachers. Embracing the mixed cultural ways of our lab was a pleasure but it was sometimes in the very merry banter that the Indians- Nikhil, Payal, Santosh, Rangrajan and Swati conjured up on a regular basis that made days away from my homeland more bearable. During the days of aggravated stress Daniel Espes, Roshan and Swati critically read different parts of this report. Also, I am grateful to Rutger for his tutorials with Photoshop which held me in good stead all through the period of compilation. Being apart for a greater part of my time in Uppsala this soft hearted lady- my wife, Seema, finally joined me nine months ago. She cooked and cared for me, her warm food on the several early mornings and late nights kept me nourished and going. Ever so patiently, she waited day after day to hear me announce that I had finally discovered the HS on secretory granules! When the endemic attack of the very well known housing situation came upon us, Brigitta and Frans let us into their lives and home. Their cosy basement has been highly conducive to my writing. I came to Uppsala with the aspiration of securing a PhD position and this was made possible by the intelligent navigation provided to me by Gunilla, Lisbeth and Monica. With the new venture that I have already embarked upon, Stellan and Lina have arranged to extend enough time to complete my report- allowing me to balance the lab work and writing simultaneously. I thank my parents for instilling in me the courage to dream and my brothers and sisters for providing me with the kind of support that was never receding. And lastly, away from India, I never really felt too far because of the fortunate presence of the Indian family that I now have in Uppsala, to who I am unanimously and lovingly known as “Bhaiya”.

30

6. References

Akesson B,Panagiotidis G,Westermark P,Lundquist I (2003) Islet amyloid polypeptide inhibits glucagon release and exerts a dual action on insulin release from isolated islets .Regul Pept 111:55-60.

Ancsin, 2003 Amyloidogenesis: historical and modern observations point to heparan sulfate proteoglycans as a major culprit. Amyloid, 10:67-79.

Anguiano M, Nowak RJ, Lansbury PT, Jr. Protofibrillar islet amyloid polypeptide permeabilizes synthetic vesicles by a pore-like mechanism that may be relevant to type II diabetes. Biochemistry 2002; 41 (38): 11338.

A. Zanini and G. Giannattasio (1972) Isolation of Prolactin Granules from Rat Anterior Pituitary Glands. Endocrinology 92:349-357.

Bernfield M, Götte M, Park PW, Reizes O, Fitzgerald ML, Lincecum J, Zako M (1999) Functions of cell surface heparin sulphate proteoglycans. Annu. Rev. Biochem. 68: 729-777.

Betsholtz C, Svensson V, Rorsman F, Engström U, Westermak G, Wilander E, Johnson KH, Westermark P (1989) IAPP: cDNA cloning and identification of an amyloidogenic region associated with species-specific occurrence of age-related diabetes mellitus. Exp Cell Res 183:484-93.

Brissoa M, Fowler MJ, Nicholosn WE, et al. (2005) Assessment of human pancreatic islet architecture and composition by laser scanning confocal microscopy. J Histochem Cytochem 53:1087-1097).

Butler AE, janson J, Butler PC et al. (2003) Beta-cell deficit and increased beta-cell apoptosis in humans with T2D. Diabetes 52:102-10.

Castillo GM, Cummings JA, Yang W, et al. (1998) Sulfate content and specific glycosaminoglycan backbone of perlecan are critical for perlecan's enhancement of islet amyloid polypeptide (amylin) fibril formation. Diabetes 47 (4): 612.

Castillo GM, Lukito W, Peskind E, et al. (2000) Laminin inhibition of beta-amyloid protein (Abeta) fibrillogenesis and identification of an Abeta binding site localized to the globular domain repeats on the laminin a chain. Journal of neuroscience research 62 (3): 451.

Clark A, Poulton J et al. (1995) Pancreatic pathology in non-insulin dependent diabetes (NIDDM). Diabetes Res Clin Prac 28 suppl:S39-47.

Degano P,Silvestre RA,Salas M,Perio E,Marco J (1993) Amylin inhibits glucose-induced insulin secretion in a dose-dependent manner.Study in the perfused rat pancreas.Regul Pept 43:91-6.

DeFronzo RA, Barazilai N, Simonson DC (1991) Mechanism of metformin action in obese and lean noninsulin-dependent diabetic subjects. J Clin Endo Metab 73:1294-301.

De Fronzo RA,Bonadonna RC,Ferrannini E(1992) Phathogenesis of NIDDM.A balanced overview.Diabetes Care 15:318-68.

Diamond J (2003) The double puzzle of diabetes.Nature 423:599-602.The Diabetes Control and Complications Trail Research Group (1993) The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med 329, 977-86.

Docherty K,Hutton JC,(1983) Carboxypeptidase activity in the insulin secretory granule.FEBS Lett 162:137-41.

Elina Sandwall, Paul O’ Callagghan, Xiao Zang, Ulf Lindahl, Lars Lannfelt, Jin-Ping Li (2010) Heparan sulfate mediates amyloid beta internalization and cytotoxicity. Glycobiology 20: 533-541.

Engel MF, Yigittop H, Antoinette Killian J, et al. (2006) Islet amyloid polypeptide inserts into phospholipid monolayers as monomer. J Mol Biol 356:783-789.

Ferner H (1952) Das Inselsystem des Pankreas. Thieme, Stuttgart.

Fredrik Noborn, Paul O'Callaghan ,Erik Hermansson , Xiao Zhang, John B. Ancsin, Ana M. Damas, Ingrid Dacklin, Jenny Presto, Jan Johansson, Maria J. Saraiva, Erik Lundgren, Robert Kisilevsky, Per Westermark, Jin-Ping Li (2011). PNAS 108, 14: 5584-5589.

31

Furuta M,Carroll R,Martin S,Swift SS,Ravazzola M,Orci L,Steiner DF,(1998) Incomplete processing of proinsulin to insulin accompanied by elevation of Des-31,32 proinsulin intermediates in islets of mice lacking active PC2.J Biol Chem 273:3431-7.

Gebre-Medhin S,Mulder H,Pekny M,Westermark G,Tornell J,Westermark P,Sundler F,Ahren B,Betsholtz C (1998) Increased insulin secretion and glucose tolerance in mice lacking islet amyloid polypeptide (amylin).Biochem Biophys Res Commum 250:271-7.

Gillespie KM,(2006) Type 1 diabetes:pathogenesis and prevention.Cmaj 175:165-70.

Giuliana Giannattasio and Antonia Zanini (1976) presence of sulfated PGs in prolactin secretory granules isolated from the rat pituitary gland. 439:349-357.

Glabe CG. Structural classification of toxic amyloid oligomers. The Journal of biological chemistry 2008; 283 (44): 29639.

G M Castillo, J A Cummings, W Yang, M E Judge, M J Sheardown, K Rimvall, J B Hansen and A D Snow (1998). Sulfate content and specific glycosaminoglycan backbone of perlecan are critical for perlecan's enhancement of islet amyloid polypeptide (amylin) fibril formation. Diabetes 47;4:612-20.

H. Sch¨agger and G. von Jagow, (1987). “Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separationof proteins in the range from 1 to 100 kDa,” Analytical Biochemistry. 166: 2, pp. 368–379.

Han J, Woytowich AE, Mandal AK, Hiebert LM (2007). Heparanase upregulation in high glucose-treated endothelial cells is prevented by insulin and heparin. Exp Biol Med. 232(7):927-34.

Hellerstrom C, Kaj G, Dock A-M, et. Al. (2002) Diabetes-forskningen framstegen framtiden. Vetenskapsradet, Stockholm.

Humphries DE, Nicodemus CF, Schiller V, Stevens RL (1992) The human serglycin gene. Nucleotide sequence and methylation pattern in human promyelocytic leukemia HL-60 cells and T-lymphoblast Molt-4 cells. JBC 13558-63.

Ishihara H, Asano T, Tsukuda K, Katagiri H, Inukai K, Anai M, Kikuchi M, Yazaki Y, Miyazaki JI, Oka Y. (1993) Pancreatic beta cell line MIN6 exhibits characteristics of glucose metabolism and glucose-stimulated insulin secretion similar to those of normal islets. Diabetologia, 36(11):1139-45.

Jorpes E. The chemistry of heparin. The Biochemical journal 1935; 29 (8): 1817

Jorpes JE, Gardell S. 1948. J. Biol. Chem. 176:267-75.

Joseph R. Bishop, Manuela Schuksz, Jeffery D. Esko (2007) Heparan sulphate proteoglycans fine-tune mammalian physiology. Nature 446: 1030-1037.

K potter, k park (2007). Heparin induces amyloid formation in cultured human islets. Clinical & investigative Medicine, 30:4.

Kirily Park and C. Bruce Verchere (2001). Identification of a Heparin Binding Domain in the N-terminal Cleavage Site of Pro-islet Amyloid Polypeptide IMPLICATIONS FOR ISLET AMYLOID FORMATION. JBC 276: 16611-16.

Knower WC,Barrett-Connor E,Fowler SE,Hamman RF,Lachin JM,Walker EA,Nathan DM (2002) Reduction in the incidence of type 2 diabetes with lifestyle intervention or metformin.N Engl J Med 346:393-403.

Kreuger J, Lindahl U, Jemth P (2003) Nitrocellulose filter binding to assess binding of glycosaminoglycans to proteins. Methods Enzymol 363:327–339.

Lidholt K, Weinke JL, Kiser CS, Lugemwa FN, Bame KJ, Cheifetz S, Massague J, Lindahl U, Esko JD. (1992). A single mutation affects both Nacetylglucosaminyltransferase and glucuronosyltransferase activities in a Chinese hamster ovary cell mutant defective in heparan sulfate biosynthesis. Proc Natl Acad Sci USA. 89:2267–2271.

32

Lifson N, Lassa CV, Dixit PK (1985) Relation between blood flow and morphology in islet organ of rat pancreas. Am J Phsiol 249:E43-48).

Lindahl, U., and L. Kjellen (1991).Heparin or heparan sulfate-what is the difference? Thromb Haemost 66(1):44-8.

Lukinius A, Wilander E, Westermark GT, Engstrom U, Westermark P (1989) Co-localisation of islet amyloid polypeptide and insulin in the B cell secretory granules of the human pancreatic islets. Diabetologia 32:240-4.

Lupi R, Del Guerra, Marchetti P, et al. (2002) Lipotoxicity in human pancreatic islets and the protective effect of metformin. Diabetes 52 Suppl 1:S134-7.

Marzban L, Soukhatcheva G,Verchere CB (2005) Role of carboxypeptidase E in processing of pro-islet amyloid polypeptide in beta-cells.Endocrinology 146:1808-17.

Marzban L,Trigo-Gonzalez G,Zhu X,Rhodes CJ,Halban PA,Steiner DF,Verchere CB (2004)Role of beta-cell prohormone convertase(PC)1/3 in processing of pro-islet amyloid polypeptide.Diabetes 53:141-8.

Milgram SL,kho ST,Martin GV,Mains RE,Eipper BA (1997) Localization of integral membrane peptidylglycine alpha-amidating monooxygenase in neuroendocrine cells.J Cell Sci 110 (Pt 6):695-706.

Mirzabekov TA, Lin MC, Kagan BL. Pore formation by the cytotoxic islet amyloid peptide amylin. The Journal

of biological chemistry 1996; 271 (4): 1988.

Murdoch AD, Iozzo RV (1993) Perlecan: the multidomain heparan sulphate proteoglycan of basement membrane and extracellular matrix. Virchows Arch A Pathol Anat Histopath; 423(4):237-42.

Paulsson JF, Andersson A, Westermark P, Westermark GT (2006) Intracellular amyloid-like deposits contain unprocessed pro-islet amyloid polypeptide (proIAPP) in beta cells of transgenic mice overexpressing the gene for human IAPP and transplanted human islets. Diabetologia , 49(6):1237-46.

Paulsson JF, Schultz SW, Köhler M, Leibiger I, Berggren PO, Westermark GT (2008) Real-time monitoring of apoptosis by caspase-3-like protease induced FRET reduction triggered by amyloid aggregation. Exp Diabetes Res. 2008:865850.

Poitout V, et al. (1995) Morphological and functional characterization of beta TC-6 cells--an insulin-secreting cell line derived from transgenic mice. Diabetes 44: 306-313.

Ross SA,Gulve EA,Wang M,(2004) Chemistry and biochemistry of type 2 diabetes.Chem Rev 104:1255-82.

Sanke T, Bell GI, Sample C, Rubenstein AH, Steiner DF (1988) An islet amyloid polypeptide is derived from an 89-amino acid precursor by proteolytic processing. J Biol Chem 263:17243-6).

Silvestre RA,Perio E,Degano P,Miralles P,Marco J (1990) Inhibitory effect of rat amylin on the insulin responses to glucose and arginine in the perfused rat pancreas.Regul Pept 31:23-31.

Smeekens SP,Montag AG,Thomas G,Albiges-Rizo C,Carroll R,Being M,Phillips LA,Martin S,Ohagi S,Gardner P,et al.(1992) Proinsulin processing by the subtilisin-related proprotein convertase furin,PC2,and PC3.Proc Natl Acad Sci U S A 89:8822-6.

Suman Jha, Sharadrao M. Patil, Jason Gibson, Craig E. Nelson, Nathan N. Alder and Andrei T. Alexandrescu (2011). Mechanism of Amylin Fibrillization Enhancement by Heparin. JBC 22894-904.

Susan Potter-Perigo, Rebecca L. Hull, Christina Tsoi, Kathleen R. Braun, Sofianos, Andrikopoulos, Jeanette Teague, C. Bruce Verchere, Steven E. Kahn, and Thomas N. Wight (2003). Proteoglycans synthesized and secreted by pancreatic islet β-cells and amylin. Archives of Biochemistry and Biophysics 413: 182-190.

Tack CJ, Smits P (2006) Thiazolidinedione derivateves in T2D mellitus. Neth J Med 64:166-74.

Takahashi I, Noguchi N, Nata K, Yamada S, Kaneiwa T, Mizumoto S, Ikeda T, Sugihara K, Asano M, Yoshikawa T, Yamauchi A, Shervani NJ, Uruno A, Kato I, Unno M, Sugahara K, Takasawa S, Okamoto H, Sugawara A (2009). Important role of heparan sulfate in postnatal islet growth and insulin secretion. Biochem Biophys Res Commun. 22;383(1):113-8.

33

Wang F,Adrian TE,Westermark GT,Ding X,Gasslander T,Permert J,(1999) Islet amyloid polypeptide tonally inhibits beta-,alpha-,and delta-cell secretion in isolated rat pancreatic islets.Am J Physiol 276:E19-24.

Wang J,Xu J,Finnerty J,Furuta M,Steiner DF,Verchere CB (2001)The prohormone convertase enzyme 2 (PC2) is essential for processing pro-islet amyloid polypeptide at the NH2-terminal cleavage site.Diabetes 50:534-9.

Westermark P, Andersson A, Westermark GT (2005) Is aggregated IAPP a cause of beta cell failure in transplanted human pancreatic islets? Curr Diab Rep 5:184-188.

Westermark P, Arne Andersson, Gunilla T. Westermark (2011) Islet Amyloid Polypeptide, Islet Amyloid and Diabetes Mellitus.. Physiol Rev 91: 795-826.

Westermark P, Eizirik DL, Pipeleers DG, Hellerström C, Andersson A (1995) Rapid deposition of amyloid in human islets transplanted into nude mice. Diabetologia 38(5): 543-9.

Westermark P, Grimelius L (1973) the pancreatic islet cells in insular Amyloidosis in human diabetic and non-diabetic adults. Acta Patol Microbiol Scand (A) 81:291-300.

Westermark P, Li ZC, Westermark GT, Leckstrom A, Steiner DF (1996) Effects of beta cell granule components on human islet amyloid polypeptide fibril formation. FEBS Lett 379:203-6.

Westermark P, Wilender E, Westermark GT, Johnson KH (1987) Islet Amyloid Polypeptide like immunoreactivity in the islet B cells of type 2 (non insulin-dependent) diabetic and non-diabetic individuals. Diabetologia 30:887-92.

Wierup N, Svensson H, Mulder H, Sundler F (2002) The ghrelin cell: A novel developmentally regulated cell in Islet cell in human pancreas. Regul Pept 107:63-69.

Wild S,Roglic G,Green A,Sicree R,King H (2004) Global prevalence of diabetes:estimates for the year (2000) and projections for 2030.Diabetes Care 27:1047-53.

Young ID, Ailles L, Narindrasorasak S, Tan R, Kisilevsky R (2003). Localization of the basement membrane heparan sulfate proteoglycan in islet amyloid deposits in type II diabetes mellitus. Arch Pathol Lab Med. 116(9): 951-4.

Zhu X,Orci L,Carroll R,Norrbom C,Ravazzola M,Steiner DF (2002) Severe block in processing of proinsulin to insulin accompanied by elevation of des-64,65 proinsulin intermediates in islets of mice lacking prohormone convertase 1/3.Pro Natl Acad Sci U S A 99:10299-304.

34

7. Appendix Table 1: List of primers

Gene Primer (5’-3’)

Nucleotide Tm in C Band length BP

H GPC1 forward TGCTGCCTGATGACTACCTG 59.4 282 reverse TGAGCACATTTCGGCAATAG 55.3

H GPC2 forward TGAGACAGAGCAGAGGCTGA 59.4 146 reverse GCTGGGCTACTGAGAGCATC 61.4

H GPC3 forward CTGGATGAGGAAGGGTTTGA 57.3 285

reverse CAGTCAGTGCACCAGGAAGA 59.4

H GPC4 forward TTCGAGTGATGACCAGCAAG 57.3 188

reverse AGCACTGTCGGCTTTCTCAT 57.3

H GPC5 forward TATCCGGTCGTTGGAAGAAC 57.3 232

reverse GGTGGTCTTCATTCCATGCT 57.3

H GPC6 forward TGCACCACAGAAATGGAAGA 55.3 299

reverse GCCCAAAAGTCATTGAGCAT 55.3 H SDC1 forward ACCACTCATCAGGCCTCAAC 59.4 263

reverse GTATTCTCCCCCGAGGTTTC 59.4 H SDC2 forward CCAGCCGAAGAGGATACAAA 57.3 186

reverse GCGTTCTCCAAGGTCATAGC 59.4 H SDC3 forward GATGACTCCTTTCCCGATGA 57.3 197

reverse TCAGAGGGGAGCTCTTCAAA 57.3 H SDC4 forward CCACCGAACCCAAGAAACTA 57.3 259

reverse GGTTTCTTGCCCAGGTCATA 57.3 M GPC1 forward ACAACCCTGAGGTGGAAGTG 59.4 283

reverse GCAGCTGAGGTCTTCTGTCC 61.4 M GPC2 forward GCTTCTGCCTCAATGTAGCC 59.4 131

reverse AGCAGCCAGTTCAAAGGAAA 55.3 M GPC3 forward TGTGCCCAAGGGTAAAGTTC 57.3 223

reverse GGTGGTGATCTCGTTGTCCT 59.4 M GPC4 forward ATTTCAAAACCGTGGTCAGC 55.3 289 reverse GAGTTCACCAGGCGAAACAT 57.3 M GPC5 forward GAGGAACCGATCCTGTGGTA 59.4 264

reverse CTCGATGGACTTGCTTCACA 57.3 M GPC6 forward TGTGAGGACCACGTTTGTGT 57.3 284

reverse CCAGGTAGTCCTCGCTGAAG 61.4 M SDC1 forward CTCAGAGCCTTTTGGACAGG 59.4 106

reverse ATCCGGTACAGCATGAAAGC 57.3

M SDC2 forward CCCAAAGTGGAAACCATGAC 57.3 230 reverse GCAAAGAGAAAGCCGATCAC 57.3

M SDC3 forward ATACTGGAGCGGAAGGAGGT 59.4 101 reverse TTCATGCGGTAGATGAGCAG 57.3

M SDC4 forward AACCACATCCCTGAGAATGC 57.3 230 reverse AGGAAAACGGCAAAGAGGAT 55.3

Table2: Contents of PCR reactions

35

Ingredients Volume

DNA template 5 µl

10X PCR buffer 2.5 µl

10 mM dNTPs 2 µl

Forward Primer 1 µl

Reverse Primer 1 µl

ddH2O 13.5 µl

Final Volume 30 µl

Table3: Protocol of PCR assay

Program Denaturation Annealing Extension

Initial preheating 94 °C for 5 minutes

5 °C below from Tm of

primers for 45 sec.

PCR cycles (25) 94 °C for 45 sec 72 °C for 45 sec

Final extension 72 °C for 7 min

Hold Hold at 4 °C forever

Figure 1: Schematic diagram of the sucrose gradient system for isolation of secretory granules: the sucrose gradients (each fraction was 850 µl) were prepared in a Beckman centrifuge tube (13X51 mm) (Beckman, USA). On top we applied secretory granule (SG pellet) and mitochondrial pellet mixed with MOPS buffer. After centrifugation reactivity against insulin antibody was analyzed by slot-blot analysis then insulin antibody positive fractions were further used for glycosaminoglycans (GAGs) and electron microscopy (EM) analysis.

36

Figure2. Chain length analysis of HSPGs, HS and HNO2, pH 1.5 treated HSPGs derived from B-TC-6 cells

cultured in high glucose and normal glucose: The chain length analysis of HSPGs and HS isolated from B-TC-6 cells cultured in high glucose (HG) and from cells medium (HGM) and cells cultured in normal glucose (NG) and from cells medium (NGM) were analyzed by gel chromatography on Superose 12 column for chain length assessment. (A) Chain length analysis of HSPGs (NG B-TC-6, blue line), HS (NG ALK B-TC-6, red line) and HSPGs treated with HNO2, pH 1.5 (NG HNO2 B-TC-6, green line) isolated from cells cultured in normal glucose. (B) Chain length analysis of HGPGs (NGM B-TC-6, blue line), HS (NGM ALK B-TC-6, red line) and HSPGs treated with HNO2, pH 1.5 (NGM HNO2 B-TC-6, green line) isolated from the medium of the cells cultured in normal glucose. (C) Chain length analysis of HGPGs (HG B-TC-6, blue line), HS (HG ALK B-TC-6, red line) and HSPGs treated with HNO2, pH 1.5 (HG HNO2 B-TC-6, green line) isolated from cells cultured in high glucose. (D) Chain length analysis of HGPGs (HGM B-TC-6, blue line), HS (HGM ALK B-TC-6, red line) and HSPGs treated with HNO2, pH 1.5 (HGM HNO2 B-TC-6, green line) isolated from the medium of the cells cultured in high glucose.