role of insulin-like growth factor binding protein-3 (igfbp-3) in the differentiation of primary...

Download Role of insulin-like growth factor binding protein-3 (IGFBP-3) in the differentiation of primary human adult skeletal myoblasts

Post on 11-Jun-2016

213 views

Category:

Documents

1 download

Embed Size (px)

TRANSCRIPT

  • JOURNAL OF CELLULAR PHYSIOLOGY 195:7079 (2003)

    Role of Insulin-Like Growth Factor Binding Protein-3(IGFBP-3) in the Differentiation of Primary

    Human Adult Skeletal Myoblasts

    EMILY J. FOULSTONE,* PAUL B. SAVAGE, ANNA L. CROWN, JEFF M.P. HOLLY, ANDCLAIRE E.H. STEWART

    Division of Surgery, University of Bristol, Bristol Royal Infirmary, Bristol, England

    Although muscle satellite cells were identified almost 40 years ago, little is knownabout the induction of their proliferation and differentiation in response to physio-logical/pathological stimuli or to growth factors/cytokines. In order to investigatethe role of the insulin-like growth factor (IGF)/IGF binding protein (IGFBP) system inadult humanmyoblast differentiationwe have developed a primary human skeletalmuscle cell model. We show that under low serum media (LSM) differentiatingconditions, the cells secrete IGF binding proteins-2, -3, -4 and -5. Intact IGFBP-5was detected at days 1 and 2 but by day 7 in LSM it was removed by proteolysis.IGFBP-4 levels were also decreased at day 7 in the presence of IGF-I, potentially byproteolysis. In contrast, we observed that IGFBP-3 initially decreased on transfer ofcells into LSMbut then increasedwithmyotube formation. Treatmentwith 20ng/mltumour necrosis factor-alpha (TNFa), which inhibits myoblast differentiation,blocked IGFBP-3 production and secretion whereas 30 ng/ml IGF-I, whichstimulatesmyoblast differentiation, increased IGFBP-3 secretion. The TNFa-induc-ed decrease in IGFBP-3 production and inhibition of differentiation could not berescuedby addition of IGF-I. LongR3IGF-I,which does not bind to the IGFBPs, had asimilar effect on differentiation and IGFBP-3 secretion as IGF-I, both with andwithout TNFa, confirming that increased IGFBP-3 is not purely due to increasedstability conferred by binding to IGF-I. Furthermore reduction of IGFBP-3 secretionusing antisense oligonucleotides led to an inhibition of differentiation. Taken to-gether these data indicate that IGFBP-3 supports myoblast differentiation. J. Cell.Physiol. 195: 7079, 2003. 2003 Wiley-Liss, Inc.

    Muscle degeneration is recognised as a significantcause of patient disability and death underlying manychronic catabolic illnesses (Calman, 1982), but as yet noeffective therapeutic interventions are available totackle this problem. The normal rate of protein turnoveris high (250300 g/day) so any small but persistentchange in catabolism/anabolism could culminate insignificant muscle loss. Muscle myofibres are terminallydifferentiated and incapable of replication, thereforeregeneration is dependent on a small population of re-sident cells generally referred to as satellite cells (Olson,1992; Olson and Rosenthal, 1994). In order to elucidatepotential therapeutic targets for muscle wasting, it isessential to understand how these muscle satellite cellsproliferate and differentiate. A thorough understandingof human myoblast growth and differentiation wouldalso have potential relevance to skeletal muscle stemcell therapies, allowing manipulation of the system fortherapeutic effect.

    Although many studies have been carried out on thegrowth and differentiation of muscle cells, the majorityof in vitro studies use immortalised rat and mousemuscle cell lines. These studies have highlighted thecritical role of the insulin-like growth factors IGF-Iand IGF-II and their binding proteins in the con-trol of proliferation, differentiation and metabolism

    (Florini et al., 1991; Stewart and Rotwein, 1996). Todate, six high affinity IGF binding proteins (IGFBPs)have been identified (Jones and Clemmons, 1995). Theseproteins modulate the activity of the IGFs by extendingtheir half-life and by either potentiating or inhibitingbinding of the IGFs to their receptors (Conover et al.,1990, 1993). Importantly, however, the muscle cell linesused to date differ in which IGF binding proteins theyproduce (James et al., 1993; McCusker and Clemmons,1998; Crown et al., 2000) and are not identical in theirresponses to IGFs (Florini et al., 1991). We havetherefore developed a more physiologically relevant,primary adult human muscle cell model in which toaddress our questions (Crown et al., 2000).

    2003 WILEY-LISS, INC.

    Contract grant sponsor: AICR; Contract grant number: 99-134.

    *Correspondence to: Emily J. Foulstone, Division of Surgery,University of Bristol, Bristol Royal Infirmary, Bristol, BS2 8HW,England. E-mail: foulstone@bristol.ac.uk

    Received 6 August 2002; Accepted 5 November 2002

    DOI: 10.1002/jcp.10227

  • One major difference between these cultures and thesecondary cell lines that have been studied to date is thatthe adult human muscle cell cultures produce andsecrete large amounts of IGFBP-3 (Crown et al., 2000).Although IGFBP-3 is the major IGFBP found in serum,it is also produced locally in many tissues (Kim et al.,1997). Its activity is modulated not only by its rate ofsynthesis but also by post-translational modificationsand by proteolysis (Collett-Solberg and Cohen, 1996).Recently IGFBP-3 has been shown to have effects oncell growth and apoptosis that are independent of IGFaction (Gill et al., 1997; Fowler et al., 2000; Hollowoodet al., 2000) and high levels of IGFBP-3 decrease theproliferation of chondrocytes (Spagnoli et al., 2001). Inaddition, IGFBP-3 has also been implicated in porcinemuscle cell differentiation (Johnson et al., 1999).Interestingly, IGFBP-5, which we have shown inhibitsdifferentiation and acts as a potent survival factor formurine C2 myoblasts (James et al., 1996; Meadowset al., 2000; Foulstone et al., 2001) is closer to IGFBP-3in sequence than any other IGFBP suggesting poten-tial for overlapping/related actions. Data derived fromother cell models would therefore suggest a potentialand important role for IGFBP-3 in skeletal musclehomeostasis with manipulation of IGFBP-3 possiblyacting as an important tool in influencing skeletalmuscle maintenance and repair in vivo. We thereforesought to investigate what role IGFBP-3 may play inprimary skeletal muscle differentiation, proliferationand survival.

    In addition to the IGFs, other growth factors andcytokines can influence muscle growth and mainte-nance (Hawke and Garry, 2001). Production of theinflammatory cytokine tumour necrosis factor a (TNFa)occurs as an important pathophysiological responseduring many critical illnesses and TNFa has beenimplicated in the aetiology of muscle wasting (Matthysand Billiau, 1997). We have shown that TNFa blocks C2myoblast differentiation and decreases IGFBP-5 secre-tion while at the same time increasing proliferation andinducing cell death (Meadows et al., 2000; Foulstoneet al., 2001). We therefore investigated whether TNFahad similar effects in the primary human skeletalmuscle cells with regard to differentiation, death andimpact on the IGFBPs. In light of their importancein differentiation, growth and survival in many cellsystems, including muscle, we also investigated the roleof the IGFs, alone or in combination with TNFa, ondifferentiation and IGFBP-3 secretion in the primarycells. These studies identify the IGFBPs secreted byhuman primary myoblasts during differentiation, theimpact of physiologically important growth factor/cytokine family members on their regulation and im-plicate IGFBP-3 as a potent and positive differentiationfactor.

    MATERIALS AND METHODSMaterials

    Unless otherwise stated all chemicals were fromSigma (Poole, UK). Hams F-10 media was from BioWhittaker (Wokingham, UK) and heat inactivatedfoetal bovine serum (hiFBS) was from GIBCO (Paisley,UK). TNFa was purchased from Bachem (St. HelensMerseyside, UK). Recombinant human IGF-I and Long-

    R3IGF-I were from GroPep (Adelaide, Australia).Recombinant human non-glycosylated IGFBP-3 wasfrom Dr. C. Moot (Brogrowth, CA). Trypsin and gelatinwere from Difco (Oxford, UK). IGFBP-3 anti-sense(CATGACGCCTGCAACCGGGG) and sense (CCCC-GGTTGCAGGCGTCATG) oligonucleotides were pur-chased from Sigma Genosys. Anti-human IGFBP-5antibody was from IBT-Immunological and BiochemicalTestsystems, GmbH (Reutlingen, Germany).

    Subjects

    The study was approved by the Local Research EthicsCommittee and all patients gave written, informedconsent. Perioperative muscle biopsies were taken fromthe anterior abdominal wall of patients undergoingelective surgery. Biopsies were collected from 41 sub-jects, 24 male and 17 female. Average age was 56 years,(range 3685 years); BMI 26.71, (range 16.540.5).

    Cell culture

    Cells were isolated following a modified method ofBlau and Webster (1981) (Crown et al., 2000). Briefly,biopsies were dissected into 1 mm3 pieces and digestedin TE (0.05% trypsin, 0.02% EDTA in phosphatebuffered saline (PBS)) for 15 min with gentle mixing.The supernatant was removed and added to hiFBS toneutralize the trypsin before centrifugation at 1,000 rpmfor 5 min. The resultant cell pellet was resuspendedin growth medium (Hams F-10 supplemented with20% hiFBS, 50 IU/ml penicillin, 5 mg/ml streptomycinand2.5mg/mlamphotericin B).The processwasrepeateda further two times and the cell suspensions pooled andplated onto T75 flasks coated with 0.2% gelatin. Cellswere grown in a humidified 5% CO2 atmosphere at378C and passaged when 8090% confluent. Cells wereinduced to differentiate when approximately 80% con-fluent by washing twice in PBS and placing into lowserum media (LSM) (minimum essential medium(MEM) supplemented with 2% hiFBS, 1% L-glutamine,50 IU/ml penicillin, 5 mg/ml streptomycin and 2.5 mg/mlamphotericin B). Experimental cells were dosed attransfer into LSM as described in the text and all ex-periments were terminated after 7 days unless other-wise stated. By day 7, cultures had reached maximumdifferentiation as assessed by measuring increasingcreatine kinase (CK) activity. Experiments were per-formed on cells between passages 2 and 6. The culturesare not homogenous populations of myoblasts b

Recommended

View more >