SPECIES AUTHENTICATION OF GOAT (Capra hircus) MEAT

USING SPECIES-SPECIFIC PCR PRIMERS FROM

MITOCHONDRIAL CYTOCHROME B GENE1

MARY RANZELLE ASIN PASANG

Bachelor of Science in Agricultural Biotechnology

1

Thesis outline is submitted for the fulfilment of the requirements for graduation with the degree of Bachelor of Science in Agricultural Biotechnology major in Animal Biotechnology, Animal and Dairy Science Cluster, College of Agriculture, University of the Philippines Los Baños, College, Laguna. Prepared under the supervision of Mr. Medino Gedeun N. Yebron Jr.

INTRODUCTION

Goats (Capra hircus) are one of the oldest domesticated livestock (Spencer, 2008) and are

useful to humans as a renewable provider of milk, manure, and fiber when they are living and as

meat and hide when slaughtered (Mahmoud Abdel Aziz, M. A., 2010). They are also used for

driving and packing purposes, and are easier and cheaper to manage compared to other

ruminants thus providing relative income to impoverished people in some poor countries (Hirst,

2008).

Goat and sheep meat is the fourth most consumed meat, following pork, poultry, and beef

(The Pennsylvania State University, 2012).The goat meat is one of the choicest edible

commodities and carries premium value in the market (Agarwal, 2013) due to its unique flavor

and palatability. Although it has distinct taste as compared to other red meats, it is still liable to

frauds. For instance, goat meat (chevon) is being substituted with that of dog meat and cat meat,

and is also used as an adulterant of mutton (sheep meat) as reported by Kang’ehte et al. in 1986.

Despite of these fraudulent practices, the demand for meat products continues to escalate in

almost all regions of the globe, especially in developing countries, as the world population rises

(Delgado, 2003). This high demand for meat invites special attention to the import and export

regulations regarding legitimacy of meat. There are various religious communities worldwide,

who have strict preferences regarding their meat for consumption. Moreover, it is difficult to

differentiate meat source by look or taste especially for processed meat. The public can rely only

on the authenticity statement made on the menus in restaurants and labels in the markets.

The ability to detect less desirable or objectionable species in meat products is important not

only for economic, health, religious and ethical reasons, but also to ensure fair trade and

compliance with legislation (Ballin et al., 2009; Nakyinsige et al., 2012; Spink & Moyer, 2011).

Most analytical methods utilized to date for meat authentication have relied on the detection of

2

species-specific proteins or DNA (Ballin et al., 2009; Leighton Jones, 1991; Meyer & Candrian,

1996). Today, however, DNA is considered to be the most appropriate molecule for species

detection and identification in foods (Singh & Neelam, 2011). Unlike proteins, DNA is relatively

stable at high temperatures, meaning that it can be analysed not only in fresh and frozen food

products, but also in processed, degraded and mixed commodities (Lenstra, 2003). In addition,

while the presence and characteristics of proteins depend on the tissue type being analysed, DNA

exists and is identical in almost all cells, and the diversity afforded by the genetic code permits

the discrimination of even closely-related species (Ballin, 2010; Lockley & Bardsley, 2000).

Therefore, molecular traceability based on DNA analysis is recognized as the most appropriate

means of identifying and authenticating the origin of species of meat samples to detect various

types of fraudulent practices.

Most of literature refers to the use of mitochondrial DNA (mtDNA) rather than nuclear

DNA for the identification of the origin of meat products. This is largely because processed

meats are likely to contain degraded DNA and in this matter, mitochondrial DNA is more

suitable than nuclear DNA due to the high copy number of mtDNA per cell, which thereby

increases the chance of getting good DNA from samples (Hsieh et al., 2003). Furthermore, the

mutation rate on mtDNA is higher than nuclear DNA and this gives a greater chance to

accumulate several point mutations, which allows the differentiation of even closely-related

species (Tamimi & Ashhab, n.d.). Some of the molecular methods wherein mitochondrial DNA

is usually utilized for meat species identification are DNA hybridization, PCR or polymerase

chain reaction based methods such as sequencing of PCR products, RFLP analysis, RAPD–PCR,

PCR-SSCP, and Multiplex PCR (Matsunaga et al., 1998; Lockely & Bardsley, 2000).

3

Mitochondrial cytochrome b (cyt b) has been considered one of the most useful genes for

phylogenetic work, and is probably the best-known mitochondrial gene with respect to structure

and function of its protein product (Esposti et al., 1993). Cyt b gene contains both slowly and

rapidly evolving codon positions, as well as more conservative and more variable regions or

domains overall. Therefore, this gene has been widely used for the identification of various

species (e.g., Satish et al., 2009; Jain et al, 2007; Matsunaga et al, 1998; and Zarringhabaie et al.,

2011) and is essential for the traceability of the origin of meat species. Hence, the aim of this

study is to design a primer from mitochondrial cytochrome b gene using PCR-based methods,

specific only for goat (Capra hircus) which could be used for species identification and

authentication of fresh (raw), cooked, processed and putrefied meat products.

REVIEW OF RELATED LITERATURE

Goat

4

Goats (Capra hircus) are one of the earliest domesticated animals, providing humankind

with milk, meat, hides, and fiber. They include several species of small, cloven-hoofed ruminants

constituting the genus Capra. Similar to other ruminants, including cows and sheep, goats

process plant roughage through a fermentation process within their compartmentalized stomachs,

and they chew regurgitated, partially digested food known as cud. Unlike other ruminants, goats

are agile browsers, preferring to reach upwards for foods such as the leaves, fruit, and bark of

small trees rather than grazing on grasses. When the desired foods are unavailable, however,

goats will consume any plant material accessible. It is this foraging ability and flexibility of diet

that has secured the importance of goats as a food source in the world's subsistence economies

(Kittler, 2003).

Goat Meat

The United States Department of Agriculture describes quality goat meat as firm and finely

grained. The color can vary between females and males, from light pink to bright red. Kids –

defined as less than one year old are often slaughtered at three to five months of age. Their meat

is less flavorful and juicy, but more tender than the meat of older goats (Kittler, 2003).

Goat meat has a taste similar to mutton, with a slightly gamy flavor. It is lower in fat than

either beef or mutton (due to a fat layer exterior to the muscle rather than marbled through it),

and can be drier.

The domestic goat (Capra aegagrushircus) is a member of the family Bovidae and is

closely related to the sheep as both are in the goat-antelope subfamily Caprinae (Hirst, 2008).

For this reason, goat is often being associated with that of sheep. This property and the fact that

goat and sheep meats have similar tastes contribute to fraudulent substitutions and adulterations

5

of sheep meat (mutton) with that of goat meat (chevon). In addition, cat and dog meats are used

as adulterants and/or alternatives for goat meat as reported by Kang’ehte et al. in 1986.

Meat Adulteration

Food authenticity issues in the form of adulteration and improper description have been

around for a long time and probably for as long as food has been offered for sale (Ioannis et al.,

2005). The adulterated food often enters the supply chain and jeopardizes the sentiments as well

as health of the people. The driving force behind any adulteration is the revenue maximization,

either by using a low cost ingredient to (partially or totally) substitute a more expensive one, or

to (partially) remove the valued component in the hope that the adulterated product neither will

be perceived nor detected by the authorities and the consumer (Ioannis & Nikolaos, 2005).

Substantial proportion of population has religious considerations towards the consumption of

meat of a particular animal species. Hence, the meat adulteration has got social, religious,

economic, and public health concerns (Girish et al., 2013).

Molecular Traceability for Meat Species Identification

Identification of the species of origin in meat samples is relevant to consumers for the

possible economic loss from fraudulent adulterations, medical requirements of individuals that

might have specific allergies, and for religious reasons (Asensio et al., 2008a). For some

consumer groups, such as vegetarians, the contamination of food with meat residue is strictly

prohibited. This scenario is similar with that of the Halal food for the Muslim consumers, who

are prohibited from consuming pork (Unajak et al., 2011). Another example is the adulteration of

buffalo meat with that of beef is a common fraudulent practice in India because of the

prohibition on cow slaughter in most states of India (Girish et al., 2013). As for goat meat

6

adulteration, it is commonly substituted for mutton while cat and dog meats are its usual

adulterants (Kang’ehte et al., 1986). Hence, extensive development of identification techniques

had been a great challenge over the past decades and recent studies had proven that molecular

techniques are the most reliable method available for speciation (Edris et al, 2012; Girish et al.,

2013).

Molecular Traceability Using PCR Based Methods

The polymerase chain reaction (PCR) is a scientific technique in molecular biology to

amplify a single or a few copies of a piece of DNA across several orders of magnitude,

generating thousands to millions of copies of a particular DNA sequence. PCR is now a common

and often indispensable technique used in medical and biological research laboratories for a

variety of applications. There are three major steps involved in the PCR technique: denaturation,

annealing, and extension (Joshi & Deshpande, n.d.).Among DNA-based methods, polymerase

chain reaction (PCR) is the most well developed molecular technique up to now and provides a

simple, rapid, highly sensitive and specific tool for detecting constituents of animal origin in

foods (Mafra et al., 2008; Tobe& Linacre, 2008).Some of the PCR-based methods being used for

species identification includes sequencing of DNA amplicons (PCR-sequencing), analysis of

PCR-single strand conformation polymorphism (PCR-SSCP), simultaneous amplification of two

or more fragments with different primer pairs (multiplex PCR), analysis of PCR-restriction

fragment length polymorphism (PCR-RFLP), analysis of random amplified polymorphic DNA

(PCR-RAPD), and real-time fluorescence PCR assays (Fajardo et al., 2010).

The use of specifically designed oligonucleotides under restrictive PCR conditions has made

possible the direct and specific identification of defined DNA fragments and its application to

7

control food authenticity. By means of PCR with species-specific primers, a target sequence can

be amplified very sensitively from a food matrix containing a pool of sequences, avoiding

subsequent sequencing or restriction fragment length polymorphism (RFLP). PCR using species-

specific primers has the preferences of being useful for routine analysis of large numbers of

samples, even when aggressive processing treatments have been applied to the food (Rojas et al.,

2009; Mafra et al., 2008).

Mitochondrial DNA

According to a study made by the Polish Academy of Sciences, Institute of Genetics and

Animal Breeding in Jastrzębiec, Poland, mitochondrial genome is evolutionary the oldest

attribute of living organisms. The human mitochondrial DNA or mtDNA genome is

approximately 16, 569 bases in length and has two general regions: the control region, so called

D-loop; and the coding region containing genes for 13 polypeptides utilized in metabolic

respiration and 24 RNA molecules. It is often chosen as a target in identifying investigations

also due to faster evolution rate than nuclear DNA. As a consequence, the mtDNA contains more

variable positions in sequence that is very useful in identification of closely related species

(Vawter and Brown, 1986). The copy number of the mitochondrial genome exceeds that of the

nuclear genome by a factor up to 10, 000 (Alberts et al., 1990). The most often used targets in

mtDNA for species identification is the variable control region and cytochrome b gene (Barallon,

1989).

Mitochondrial Cytochrome B Gene

The mitochondrial cytochrome b (cyt b) gene is approximately 1141 bp and is widely used

in systematic studies to resolve divergences at many taxonomic levels (Farias et al., 2001). The

8

amino acid sequence of cytochrome b gene is highly conservative, but because of degeneracy of

the genetic code, the genes for cytochrome b differ at least in a few nucleotides even in closely

related species. Previous research (Hsieh et al., 2001; Hsieh et al., 2003) showed that the

fragment size of cytochrome b gene (about 300 bp) is sufficient for discriminating between close

species. Variation within species is less than between species. This enables to work out methods

allowing differentiation between many species in a single test. Since all mitochondrial genes

behave as a haploid locus therefore the problem of heterozygosity can be avoided. Another

advantage of the cytochrome b gene is the possibility of amplifying the certain segment of the

gene from any vertebrate species using only one pair of primers (Kocher et al, 1989).

Cytochrome b gene has wide representation in nucleotide databases. It is therefore a high

likelihood of finding a sequence entry of unknown sample or at least of a related species. It is

also used in studies of molecular evolution (Kocher et al., 1989, Montgelard et al., 1997, Prusak

et al., 2004) and forensic medicine (Barlett and Dawidson, 1992).

Mitochondrial Cytochrome B Geneas a Tool for Meat Traceability

In 2009, Murugaiah, et al. developed a method utilizing PCR-restriction fragment length

polymorphism (RFLP) in the mitochondrial genes for beef (Bos taurus), pork (Sus scrofa),

buffalo (Bubalus bubalis), quail (Coturnix coturnix), chicken (Gallus gallus), goat (Capra

hircus), rabbit (Oryctolagus cuniculus) species identification and Halal authentication. The

genetic differences within the cytochrome b gene among the meat were successfully confirmed

by PCR-RFLP; thus developing a reliable typing scheme of species which revealed the genetic

differences among the species.

9

Zarringhabaie, et al. reported in 2011 that an accurate analytical technique for sheep, goat,

beef, and buffalo meat identification, based on PCR analysis of the cytochrome b gene of

mitochondrial DNA for enforcement of labelling regulations, is useful and feasible to trace meat

adulteration and differentiate species present in mixed meat. Therefore, it can be suggested as a

useful laboratory tool for species identification, especially for meat traceability and Halal

authentication.

Edris et al. presented a study in 2012 that suggests an accurate analytical technique for

detecting meat adulteration by conventional multiplex PCR analysis of the cyt b gene of animal

mtDNA. This technique was used to detect and trace meat adulteration and to differentiate

species present in meat mixture. The test could also be used and applied by researchers and

quality control laboratories for verification and control of industrial meat products, such as Halal

authentication and raw material origin certification.

Goat-Specific PCR Primers from Mitochondrial Cytochrome B Gene

PCR primers are strands of nucleic acid that serve as starting point for DNA synthesis.

These primers are required for DNA replication because the enzymes that catalyze this process,

DNA polymerases, can only add new nucleotides to an existing strand of DNA (Rossi, 2009).

Designing primers specific for goat species requires numerous considerations to amplify the

target regions from a DNA template. Some of the published available primers specific for goat

species are shown in Table 1.

Table 1.Some of the published goat-specific PCR primers.

Author Forward Reverse PCR product size

10

Matsunaga et al. (1998)

5’-GAC CTC CCA GCT CCA TCA AAC ATC TCA TCT TGA TGA AA-3’

5’-CTC GAC AAA TGT GAG TTA CAG AGG GA-3’

157 bp

Zarringhabaie et al. (2011)

5’-CGC CAT GCT ACT AAT TCT TGT T-3’

5’-TGT CCT CCA ATT CAT GTG AGT GT-3’

330 bp

The significant association of goat meat with that of sheep meat has shown great

contributions to fraudulent practices in the industry thus, having been able to design sheep-

specific primers are also important for this study. Although the two animals are closely related,

they are two different species; goats having 60 chromosomes while sheep having only 54

chromosomes. This difference can already be a useful property to design and create goat-specific

and sheep-specific primers that would distinguish one species from another. Some of the

published sheep-specific primers are shown in Table 2.

Table 2.Some of the published sheep-specific PCR primers.

Author Forward Reverse PCR product size

Matsunaga et al. (1998)

5’-GAC CTC CCA GCT CCA TCA AAC ATC TCA TCT TGA TGA AA-3’

5’-CTA TGA ATG CTG TGG CTA TTG TCG CA-3’

331bp

Zarringhabaie et al. (2011)

5’-TAC CAA CCT CCT TTC AGC AAT T-3’

5’-TGT CCT CCA ATT CAT GTG AGT GT-3’

585bp

Dooley et al. (2004)

5’-GAG TAA TCC TCC TAT TTT GCG ACA-3’

5’-AGG TTT GTG CCA ATA TAT GGA ATT-3’

133 bp

11

METHODOLOGY

Sample Collection

Meat samples of goat species will be collected from a local slaughter house and meat

markets. The samples will be transferred to the laboratory in a chilled condition using an ice

container and will be stored at -20°C until processing.

12

The meat samples will be subjected to various experimental procedures to obtain fresh,

cooked, putrefied and processed meat samples. The tissue will be cleaned of extraneous fat,

connective tissue and blood vessels to obtain fresh meat samples while processed meat samples

will be bought from meat markets.

As for cooked meat samples, meat will be wrapped in aluminium foil and will be cooked at

100°C and 120°C in a dry hot air oven and in moist heat (water bath and autoclave) for 45

minutes to simulate various methods of cooking. For putrefied meat samples, on the other hand,

the meat will be allowed to putrefy in a natural (unpreserved) condition at room temperature for

about 3 months to stimulate the autolysis in meat. In this treatment, 5 samples will be collected

from certain incubation periods and will be stored at -20°C until processing.

100 mg of meat samples from each treatment will be collected for DNA extraction.

DNA Extraction

Mitochondrial DNA, along with genomic DNA will be extracted using the method

described by Lenstra et al. (2001). This extraction protocol will provide a rapid procedure for

DNA extraction by using an alkaline extraction buffer (0.5 M NaOH, 10 mM EDTA).It will

yield single-stranded DNA (6-15 μg DNA/g meat), which can be spotted directly onto a

positively-charged nylon membrane for subsequent hybridization.

100mg of the meat samples will be weighed and placed in a 1.5mL Eppendorf tube. 0.2mL

of the extraction buffer, which will include a mixture of 0.5 M NaOH and 10 mM EDTA, will be

added into the tube. This will then be mixed using vortex mixer and will be incubated at 100°C

for 7 minutes in a hot water bath. The tube will be spun using a centrifuge (room temperature)

for 2 minutes at 12,000 rpm and the supernatant will be transferred into a new 1.5mL Eppendorf

13

tube, avoiding floating fat. The latter step will be repeated where in the transferred supernatant

will be spun in a centrifuge for 2 minutes at 12,000 rpm and the supernatant will be transferred

into a new 1.5mL Eppendorf tube, avoiding floating fat. The second extracted supernatant will

contain the isolated genomic DNA from the meat samples and will be stored at -20°C until

processing.

Moreover, approximate quantification of the DNA isolate will be determined using

spectrophotometry.

Neutralization Protocol

The alkaline extracted DNA samples will be neutralized by adding one volume of 1M Tris-

HCl, pH 7.75, into the isolated DNA. This neutralized DNA samples will then be stored at -20°C

until processing.

PCR Amplification

In 2012, Naidu et al. developed novel primers for complete mitochondrial cytochrome b

gene sequencing of mammals. These novel oligonucleotide primers will be used for PCR

amplification of the cytochrome b gene: the forward primer will be 5’-

CCHCCATAAATAGGNGAAGG-3’; and the reverse primer will be 5’-

WAGAAYTTCAGCTTTGGG-3’. PCR amplification will be conducted in 50 ml of 10 mM

Tris-HCl, (pH 8.3) containing 50 mM KCl, 1.5 mM MgCl2, 200 mM dNTP mix, primer mix (4-

60 pmol each), 250 ng template DNA and 1.25 unit Taq DNA polymerase (Perkin-Elmer).

Oligonucleotide primers from mitochondrial cytochrome b gene will be amplified and will have

a product size of about 1,424 bp. Thirty-five cycles of amplification will be run using G-Storm

Premium PCR Thermal Cycler as follows: denaturation at 94°C for 30 seconds, annealing at

14

60°C for 30 seconds, and extension at 72°C for 30 seconds. Following amplification, 7 ml PCR

solution will be electrophoresed on 2% agarose gel for 30 minutes at 100 V in TAE buffer (40

mM Tris-acetate, 1 mM EDTA, pH 8.0) and will be stained with ethidium bromide (0.5 mg

mlÿ1) and will be destained for 30 minutes.

Molecular Cloning

PCR products will be cloned using the pGEM®-T Easy Vector System and the Rapid DNA

Ligation System. This will involve a DNA ligation step in which the PCR product, pGEM-T

vector, ligase buffer and T4 DNA ligase enzyme will be incubated. Reactions using this buffer

may be incubated for 1 hour at room temperature. The incubation period may be extended to

increase the number of colonies after transformation. Generally, an overnight incubation at 4°C

will produce the maximum number of transformants. Competent cells will be transformed with

the pGEM-T vectors using standard transformation protocols and colonies carrying the clones

are identified by blue and white screening using X-GAL/IPTG LB agar plates.

Plasmid Isolation

In 1979, Birnboim and Doly described an alkaline lysis method of plasmid isolation which

will be used to isolate plasmid DNA or other cell components such as proteins by breaking the

cells open. In this procedure, bacteria containing the desired plasmid will be harvested from

culture medium. Suspension of bacteria will be prepared in isotonic solution which will be

subsequently subjected to lysis by an alkaline solution containing a detergent sodium dodecyl

15

sulphate (SDS) and NaOH. While detergent will serve to lyse cells and denature proteins,

alkaline condition will denature genomic DNA, plasmid DNA as well as proteins. This mixture

in subsequent step will be neutralized by potassium acetate (pH 5.2). Neutralization will result in

renaturation of plasmid and genomic DNA. Since plasmid DNA is covalently closed, it will

reanneal properly and will remain in solution in soluble form while genomic DNA will reanneal

randomly, which will result in the formation of precipitate. Precipitate will then be separated by

high speed centrifugation. Plasmid from the supernatant will be recovered by precipitation using

isopropanol or ethanol.

Sequencing

PCR products will be cycle sequenced using the PCR primers in a cycle sequencing reaction

that will be done by the 1st BASE DNA Sequencing Services of Asia Gel Corporation in

Malaysia.

Sequence Analysis

After sequencing, the obtained sequences will be confirmed and aligned manually to

identify species, using the online BLAST search engine of the National Center for Biotechnology

Information (NCBI) and Vector NTI. Sequences where a similarity of the query is found will be

displayed according to the degree of sequence match. The cleaning of the sequences will be done

to ensure its purity, following DNA sequence alignment for primer designing.

Figure 1 shows the alignment of the available sequences of goat and sheep species from

NCBI (see page 18).

Designing of PCR Primer Specific for Goat Species

16

For primer designing, the mitochondrial Cytb gene sequences (accession numbers) of goat

species will be taken from GenBank: Capra hircus (AB110597.1). The sequences will then be

aligned using BLAST, Vector NTI and NCBI online multiple alignment tools (www.ebi.ac.uk).

Primers will be designed by evaluating various parameters to create ideal species-specific

primers, which include: primer length (optimum: 18-22bp); product size (optimum for

traceability: 150bp); GC content (at least 50 % GC); annealing and melting temperature (Tm) of

the forward and reverse primers (at most 5°C difference); 3’-end stability; primer amplification

or extension capability; primer specificity and homology or complementary primer sequence;

and absence of repeats, dimerization, hairpin loops, duplex, palindrome, and other primer

secondary structure conformations. Vector NTI as well as various online software applications

such as Primer3Plus, GenScript Primer Design and Primer-Blast, will be used in this parameter

evaluation.

In addition, some of the published goat-specific and sheep-specific primers will also be used

to serve as basis of designing.

1 75 Goat (1) ATGACCAACATCCGAAAGACCCACCCATTAATAAAAATTGTAAACAACGCATTTATTGACCTCCCAACCCCATCA Sheep (1) ATGATCAACATCCGAAAAACCCACCCACTAATAAAAATTGTAAACAACGCATTCATTGATCTCCCAGCTCCATCAConsensus (1) ATGANCAACATCCGAAANACCCACCCANTAATAAAAATTGTAAACAACGCATTNATTGANCTCCCANCNCCATCA 76 150 Goat (76) AACATCTCATCATGATGAAACTTTGGATCCCTCCTAGGAATTTGCCTAATCTTACAAATCCTGACAGGCCTATTC Sheep (76) AATATTTCATCATGATGAAACTTTGGCTCTCTCCTAGGCATTTGCTTAATTTTACAGATTCTAACAGGCCTATTCConsensus (76) AANATNTCATCATGATGAAACTTTGGNTCNCTCCTAGGNATTTGCNTAATNTTACANATNCTNACAGGCCTATTC 151 225 Goat (151) CTAGCAATACACTATACATCCGACACAATAACAGCATTTTCCTCTGTAACTCACATTTGTCGAGATGTAAATTAT Sheep (151) CTAGCAATACACTATACACCTGACACAACAACAGCATTCTCCTCTGTAACCCACATTTGCCGAGACGTAAACTATConsensus (151) CTAGCAATACACTATACANCNGACACAANAACAGCATTNTCCTCTGTAACNCACATTTGNCGAGANGTAAANTAT 226 300 Goat (226) GGCTGAATCATCCGATACATACACGCAAACGGAGCATCAATATTCTTTATCTGCCTATTCATACATATCGGACGA Sheep (226) GGCTGAATTATCCGATATATACACGCAAACGGGGCATCAATATTTTTTATCTGCCTATTTATGCATGTAGGACGAConsensus (226) GGCTGAATNATCCGATANATACACGCAAACGGNGCATCAATATTNTTTATCTGCCTATTNATNCATNTNGGACGA 301 375

17

Goat (301) GGTCTATATTATGGATCATATACCTTTCTAGAAACATGAAACATTGGAGTAATCCTCCTGCTCGCGACAATGGCC Sheep (301) GGCCTATACTATGGATCATATACCTTCCTAGAAACATGAAACATCGGAGTAATCCTCCTATTTGCGACAATAGCCConsensus (301) GGNCTATANTATGGATCATATACCTTNCTAGAAACATGAAACATNGGAGTAATCCTCCTNNTNGCGACAATNGCC 376 450 Goat (376) ACAGCATTCATAGGCTATGTTTTACCATGAGGACAAATATCATTTTGAGGGGCAACAGTCATCACTAATCTTCTT Sheep (376) ACAGCATTCATAGGCTATGTTTTACCATGAGGACAAATATCATTCTGAGGAGCAACAGTTATTACCAACCTCCTTConsensus (376) ACAGCATTCATAGGCTATGTTTTACCATGAGGACAAATATCATTNTGAGGNGCAACAGTNATNACNAANCTNCTT 451 525 Goat (451) TCAGCAATCCCATATATTGGCACAAACCTAGTCGAATGAATCTGAGGGGGATTCTCAGTAGACAAAGCCACTCTC Sheep (451) TCAGCAATTCCATATATTGGCACAAACCTAGTCGAATGAATCTGGGGAGGATTCTCAGTAGACAAAGCTACCCTCConsensus (451) TCAGCAATNCCATATATTGGCACAAACCTAGTCGAATGAATCTGNGGNGGATTCTCAGTAGACAAAGCNACNCTC 526 600 Goat (526) ACCCGATTCTTCGCCTTCCACTTTATCCTCCCATTCATCATCACAGCCCTTGCCATAGTCCACCTGCTTTTCCTC Sheep (526) ACCCGATTTTTCGCCTTTCACTTTATTTTCCCATTCATCATCGCAGCCCTCGCCATAGTTCACCTACTCTTCCTCConsensus (526) ACCCGATTNTTCGCCTTNCACTTTATNNTCCCATTCATCATCNCAGCCCTNGCCATAGTNCACCTNCTNTTCCTC 601 675 Goat (601) CACGAAACAGGATCGAACAACCCCACAGGAATTCCATCAGACACAGATAAAATCCCATTTCACCCTTACTACACC Sheep (601) CACGAAACAGGATCCAACAACCCCACAGGAATTCCATCGGACACAGATAAAATTCCCTTCCACCCTTATTACACCConsensus (601) CACGAAACAGGATCNAACAACCCCACAGGAATTCCATCNGACACAGATAAAATNCCNTTNCACCCTTANTACACC 676 750 Goat (676) ATTAAAGATATCTTAGGCGCCATGCTACTAATTCTTGTTCTAATACTACTAGTACTATTCACACCCGACCTACTC Sheep (676) ATTAAAGACATCCTAGGTGCTATCCTACTAATCCTCATCCTCATGCTACTAGTACTATTCACGCCTGACTTACTCConsensus (676) ATTAAAGANATCNTAGGNGCNATNCTACTAATNCTNNTNCTNATNCTACTAGTACTATTCACNCCNGACNTACTC 751 825 Goat (751) GGAGACCCAGACAACTATATCCCAGCAAATCCACTCAATACACCCCCTCACATTAAACCTGAGTGGTATTTCCTA Sheep (751) GGAGACCCAGACAACTACACCCCAGCAAACCCACTTAACACTCCCCCTCACATCAAACCTGAATGATACTTCCTAConsensus (751) GGAGACCCAGACAACTANANCCCAGCAAANCCACTNAANACNCCCCCTCACATNAAACCTGANTGNTANTTCCTA 826 900 Goat (826) TTTGCATACGCAATCCTACGATCAATTCCCAACAAACTAGGAGGAGTCCTAGCCCTAGTCCTCTCAATCCTAATC Sheep (826) TTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCConsensus (826) TTTGCNTACGCAATCNTACGATCAATNCCNAANAAACTAGGAGGAGTCCTNGCCCTANTCCTCTCAATCCTANTC 901 975 Goat (901) TTAGTACTTGTACCCTTCCTCCACACATCTAAACAACGAAGCATAATATTCCGCCCAATCAGCCAATGCATATTC Sheep (901) CTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGGAGCATAATATTCCGACCAATCAGTCAATGTATATTCConsensus (901) NTAGTANTTNTACCCNTCCTCCANACATCNAANCAACGNAGCATAATATTCCGNCCAATCAGNCAATGNATATTC 976 1050 Goat (976) TGAATCCTGGTAGCAGATCTATTAACACTCACATGAATTGGAGGACAGCCAGTCGAACATCCCTACATTATTATT Sheep (976) TGAATCCTAGTAGCCGACCTATTAACACTCACATGAATTGGAGGCCAGCCAGTTGAACACCCCTACATCATTATTConsensus (976) TGAATCCTNGTAGCNGANCTATTAACACTCACATGAATTGGAGGNCAGCCAGTNGAACANCCCTACATNATTATT 1051 1125 Goat (1051) GGACAACTAGCATCTATCATATATTTCCTCATCATTCTAGTAATAATACCAGCAGCTAGCACCATTGAAAACAAC Sheep (1051) GGACAACTAGCATCTATTATATATTTCCTTATCATTCTAGTCATAATACCAGTAGCTAGCATCATCGAAAACAACConsensus (1051) GGACAACTAGCATCTATNATATATTTCCTNATCATTCTAGTNATAATACCAGNAGCTAGCANCATNGAAAACAAC 1126 1140 Goat (1126) CTTCTAAAATGAAGA Sheep (1126) CTCCTAAAATGAAGAConsensus (1126) CTNCTAAAATGAAGA

Figure 1. The alignment of the available sequences of goat and sheep from NCBI, via Vector NTI.

REFERENCES

AGARWAL, S. K. April 2013. Vision 2050.Central Institute for Research on Goats, Makhdoom, Farah, Mathura (UP) India.

ALBERTS, B., BRAY, D., LEWIS, J., RAFF, M., ROBERTS K. & WATSON, J. D. 1983.Molecularbiologie der Zelle. VCH Verlagsgesellchaft: Weinheim.

ALI, E., RAHMAN, M., ABD HAMID, S. B., MUSTAFA, S., BHASSU, S. & HASHIM, U. 2014. Canine-Specific PCR Assay Targeting Cytochrome b Gene for the Detection of

18

Dog Meat Adulteration in Commercial Frankfurters.Food Anal.Methods (2014) 7:234–241.

ANONYMOUS.(n.d.). Food quality and safety: Traceability and transparency “from fork to farm”, risks and quality assurance (Identification of meat species and meat products by molecular methods). Polish Academy of Sciences, Institute of Genetics and Animal Breeding, Jastrzębiec, Poland.

ANONYMOUS. June 18, 1945. Milk Goats. LIFE Vol. 18,(25)p58. Retrieved from <http://books.google.com.ph/books?id=dUgEAAAAMBAJ&lpg=PA57&dq=goat+tastes+like+lamb&pg=PA57&hl=en#v=onepage&q=goat%20tastes%20like%20lamb&f=false>.

ASENSIO, L., GON LE, I., GRACÍA, T. & MARTÍN, R. (2008a).Determination of food authenticity by enzymelinkedimmunosorbent assay (ELISA). Food Control, 19: 1-8.

BALLIN, N. Z. (2010).Authentication of meat and meat products.Meat Science, 86,577e587.

BALLIN, N. Z., VOGENSEN, F. K., & KARLSSON, A. H. (2009). Species determination can - we detect and quantify meat adulteration? Meat Science, 83, 165e174.

BARALLON, R. 1998. Species determination by analysis of the cytochrome b gene, in: P.J. Lincolm, J. Thomson (EDS.). Forensic DNA Profiling Protocols, Humana Press, Totowa, New Jersey, 251-160.

BARLETT, S. E. & DAWIDSON, W. S. 1992.FINS (Forensically Informative Nucleotide Sequencing): A Procedure for Identifying the Animal Origin of Biological Specimens.BioTechniques. 12, 408-411.

BIRNBOIM, H. C. & DOLY, J. August 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA.Nucleic Acids Research Volunme 7 Number 6.

CAINE´, L., LIMA, G., PONTES, L., ABRANTES, D., PEREIRA, M. & PINHEIRO, M.F. 2006. Species identification by cytochrome b gene: Casework samples. International Congress Series 1288 (2006) 145– 147.

CAWTHORN, D. M., STEINMAN, H. A. & HOFFMAN, L. C. January 15, 2013. A high incidence of species substitution and mislabelling detected in meat products sold in South Africa. Food Control 32 (2013) 440e449.

DELGADO, C. L. (2003). Rising consumption of meat and milk in developing countries has created a new food revolution. Journal of Nutrition, 133, 3907Se3910S.

DOOLEY, J. J., Paine, K. E., Garrett, S. D. & Brown, H. M. 2004.Detection of meat species using TaqMan real-time PCR assays. Meat Science 68 (2004) 431–438

19

DÝRMUNDSSON, O. R. 2006. Sustainability of sheep and goat production in North European countries – From the Arctic to the Alps. Small Ruminant Res 62(3):151–157.

EDRIS, S., MUTWAKIL, M.H.Z., ABUZINADAH, O.A., MOHAMMED, H.E., RAMADAN, A., GADALLA, N.O., SHOKRY, A.M., HASSAN, S.M., SHOAIB, R.M., DOMYATI, F.M. & BAHIELDIN, A. 2012. Conventional multiplex polymerase chain reaction (PCR) versus real-time PCR for species-specific meat authentication] Life Sci J 2012;9(4):5831-5837.

ESPOSTI, M.D., DE VRIES, S., CRIMI, M., GHELLI, A., PATARNELLO, T., & MEYER, A. July 1993. "Mitochondrial cytochrome b: evolution and structure of the protein". Biochim.Biophys.Acta 1143 (3): 243–71.

FAJARDO, V., GONZA´LEZ, I., MARI´A ROJAS, M., GARCIA, T. & MARTIN, R. 2010.A review of current PCR-based methodologies for the authentication of meats from game animal species.Trends in Food Science & Technology 21 (2010) 408e421.

FARIAS, I. P., ORTI, G., SAMPAIO, I., SCHNEIDER, H. & MEYER, A. February 26, 2001. The Cytochrome b Gene as a Phylogenetic Marker: The Limits of Resolution for Analyzing Relationships Among Cichlid Fishes. J MolEvol (2001) 53:89–103. DOI: 10.1007/s002390010197.

FOOD AND AGRICULTURE. 2010. 2008 Production Yearbook.

FOOD AND AGRICULTURE (FAOStat – 2011). FAO Production, FAO Organization. Rome.

GIRISH, P. S., HAUNSHI, S., VAITHIYANATHAN, S., RAJITHA, R. & RAMAKRISHNA, C. February 2013. A rapid method for authentication of Buffalo (Bubalusbubalis) meat by Alkaline Lysis method of DNA extraction and species specific polymerase chain reaction. J Food Sci Technol. Feb 2013; 50(1): 141–146.

GUPTA, S. K. & SINGH, L. 2012. “Molecular insight into suspected food crime cases: a study to determine the legitimacy of meat by DNA typing”. Short Report/Biological and Biomedical Reports (ISSN: 2162-4186), 2(3), 171-174.

HIRST, KRIS K. August 18, 2008. "The History of the Domestication of Goats". Retrieved from <http://archaeology.about.com/od/domestications/qt/goats.htm>

HSIEH, H. M., CHIANG, H. L., TSAI, L. C., LAI, S. Y., HUANG, N. E., LINACRE A. & LEE J. C. I. 2001. Cytochrome b gene for species identification of the conservation animals.Forensic Science International. 122, 7-18.

HSIEH, H. M., HUANG, L. H., TSAI, L. C., KUO, Y. C., MENG, H. H., LINACRE A. & LEE J. C. 2003. Species identification of rhinoceros horns using the cytochrome b. Forensic Science International. 136, 1-11.

20

IOANNIS, S. A. & NIKOLAOS, E. T. (2005) Implementation of quality control methods in conjunction with chemometrics toward authentication of dairy products.Crit Rev Food SciNutr 45:231–249.

IOANNIS, S. A., TSITSIKA, E. V. & PANAGIOTAKI, P. (2005) Implementation of quality control methods (physic-chemical, microbiological and sensory) in conjunction with multivariate analysis towards fish authenticity.Int J Food SciTechnol 40:237–263.

JAIN, S., BRAHMBHAT, M. N., RANK, D. N., JOSHI, C. G. & SOLANKI, J. V. 2007. “Use of cytochrome b gene variability in detecting meat species by multiplex PCR assay”. Indian J. Anim. Sci., 77(9): 880-881.

JAQUET, P., ABDULAI, A. & RIEDER, P. 2000. Empirische Analyse des Nahrungsmittelverbrauchs in der Schweiz: Eindreistufiges LA/AIDS Modell. ETH Zurich, Zurich.

JORDE, L. B., BAMSHAD, M. & ROGERS, A. R. (1998).Using mitochondrial and nuclear DNA markers to reconstruct human evolution.BioEssays. 20:126-136.

JOSHI, M. & DESHPANDE, J. D.n.d.POLYMERASE CHAIN REACTION: METHODS, PRINCIPLES AND APPLICATION.International Journal of Biomedical Research 1 [5] [2010]81‐97.

KANG’EHTE, E. K., GATHUMA, J. M. & LINDQVIST, K. J. 1986. Identification of species of origin of fresh, cooked and canned meat and meat products using antisera to thermostable muscle antigens by Ouchterlony’s double diffusion test. J. Sci. Food Agric., 37:157-164.

KITTLER, P. G. 2003. "Goat."Encyclopedia of Food and Culture. Encyclopedia.com. Retrieved from <http://www.encyclopedia.com>.

KOCHER, T. D., THOMAS, W. K., MEYER, A., EDWARDS, S. V., PAABO, S., VILLABLANCA, F. X. & WILSON, A. C. 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primes. Proceedings of the National Academy of Sciences USA. 86, 6196-6200.

LAU, C. H., TAN, S. G., BARKER, J. S. F. & YUSOFF, K. (1994). Cytochrome b sequence variations in Southeast Asian, Sri Lankan and Australian water buffaloes. GenBank, GI 871412.

LEIGHTON JONES, J. (1991). DNA probes: applications in the food industry. Trends in Food Science & Technology, 2, 28e32.

LENSTRA,J. A., BUNTJER, J. B. & JANSSEN, F. W. April 2001. On the origin of meat - DNA techniques for species identification in meat products. Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Yalelaan 1,3584 CL Utrecht, The Netherlands.

21

LENSTRA, J. A. (2003). DNA methods for identifying plant and animal species in food.In M. Lees (Ed.), Food authenticity and traceability (pp. 34e36). Florida: CRC Press.

LOCKLEY, A. K. & BARDSLEY, R. G. (2000).DNA-based methods for food authentication.Trends in Food Science & Technology, 11, 67e77.

MAFRA, I., FERREIRA, I. M. P. L. V. O. & OLIVEIRA, M. B. P. P. (2008).Food authentication by PCR-based methods.European Food Research and Technology, 227(3), 649e665.

MAHMOUD ABDEL AZIZ, M. A. October 2010. "Present status of the world goat populations and their productivity". Lohmann Information, Vol. 45 (2)p43.

MATSUNAGA, T., CHIKUNI, K., TANABE, R., MUROYA, S., SHIBATA, K., YAMADA, J., & SHINMURA, Y. July 2, 1998. “A quick and simple method for the identification of meat species and meat products by PCR assay”. Meat Science 51 (1999) 143-148.

MEYER, R. & CANDRIAN, U. (1996).PCR-based DNA analysis for the identification and characterization of food components.Lebensmittel-Wissenschaft und Technologie, 29, 1e9.

MONTGELARD, C., CATZEFLIS, F. M. & DOUZERY, E. 1997. Phylogenetic relationships of artiodactyls and cetaceans as deduced from comparison of cytochrome b and 12S RNA mitochondrial sequences. Molecular Biology and Evolution. 14, 555-559.

MURUGAIAH, C., NOOR, Z. M., MASTAKIM, M., BILUNG, L. M., SELAMAT, J. & RADU, S. (2009). Meat species identification and Halal authentication analysis using mitochondrial DNA. Meat Sci. 83: 57−61.

NAIDU, A., FITAK, R., MUNGUIA-VEGA, A. & CULVER, M. 2012.Novel primers for complete mitochondrial cytochrome b gene sequencing mammals.Molecular Ecology Resources. (12)p191-196.

NAKYINSIGE, K., CHE MAN, Y. B. & SAZILI, A. Q. (2012). Halal authenticity issues in meat and meat products. Meat Science, 91, 207e214.

PARK, Y. H., UZZAMA, M. D. R., PARK, J. W., KIM, S. W., LEE, J. H. & KIM, K. S. 2013. Detection of Meat Origin (Species) Using Polymerase Chain Reaction. Korean J. Food Sci. An. Vol. 33, No. 6, pp. 696~700(2013).

PASKA, T. 2011. Goat: The World's Favorite Meat. Retrieved from <http://simplegoodandtasty.com/2011/04/06/goat-the-worlds-favorite-meat>

22

PRUSAK, B., GRZYBOWSKI, G. & ZIĘBA, G. 2004. Taxonomic position of Bison bison (Linnaeus, 1758) and Bison bonasus (Linnaeus, 1758) based on analysis of cytb gene. Animal Science Papers and Reports. 22, (1), 27-35.

RANJHAN, S. K. 2013. Latest Concepts in Rearing Buffaloes for Meat Production. Buffalo Bulletin 2013 Vol.32 (Special Issue 1): 319-328.

REA, S., CHIKUNI, K., BRANCIARI, R., SANGAMAYYA R. S., RANUCCI AND, D. & AVELLINI, P. 2001. Use of duplex polymerase chain reaction (duplex-PCR) technique to identify bovine and water buffalo milk used in making mozzarella cheese. J. Dairy Res., 68: 689-698.

ROJAS, M., GONZA´LEZ, I., FAJARDO, V., MARTI´N, I., HERNA´NDEZ, P. E. & GARCI´A, T. (2009). Authentication of meats from quail (Coturnixcoturnix), pheasant (Phasianuscolchicus), partridge (Alectorisspp), and guinea fowl (Numidameleagris) using polymerase chain reaction targeting specific sequences from the mitochondrial 12S rRNA gene. Food Control, 20(10), 896e902.

ROSSI, MARIE LOUISE. 2009. “Distinguishing the pathways of primer removal during Eukaryotic Okazaki fragment maturation”. Contributor Author. 2009-02-23T17:05:09Z.

SAMBROOK, J., FRITSCH, E. F. & MANIATIS, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd Edition. Cold Spring Harbour Laboratory Press, New York.

SATISH, A. K., MINAKSHP, Y. S. & PRASAD, G. December 2009. Cytochrome- b GENE Based PCR for Identification and Differentiation of Cooked Meat of Sheep, Goat, Cattle, Pig and Poultry. Haryana Vet. 48, pp 53-57.

SINGH, V. P. & NEELAM, S. (2011). Meat species specifications to ensure the quality of meat: a review. International Journal of Meat Science, 1, 15e26.

SMITH, M.F., & PATTON, J.L. July 1990. “Variation in mitochondrial cytochrome b sequence in natural populations of South American akodontine rodents (Muridae: Sigmodontinea)”. Mol. Biol. Evol. 8(1): 85-103.

SPENCER, R. December 2008. Overview of the United States Meat Goat Industry.Alabama Cooperative Extension System (Alabama A&M and Auburn Universities) UNP-104.

SPINK, J. & MOYER, D. C. (2011).Defining the public health threat of food fraud.Journal of Food Science, 76, 157e163.

TAMIMI, A. A. & ASHHAB Y. (n.d.).Identification of Meat Species and Meat Products by a Multiplex PCR Method.Biotechnology Research Center, Palestine Polytechnic University, Hebron, Palestine.

23

TANABE, S., HASE, M., YANO, T., SATO, M., FUJIMURA, T., & AKIYAMA, H. November 8, 2007. “A Real Time Quantitative PCR Detection Method for Pork, Chicken, Beef, Mutton, and Horseflesh in Foods”.Biosci.Biotechnol.Biochem. 71(12): 3131-3135.

THE PENNSYLVANIA STATE UNIVERSITY. 2012. Agricultural Alternatives: Meat Goat Production. Retrieved from <http://extension.psu.edu/business/ag-alternatives/livestock/sheep-and-goats/meat-goat-production>

TOBE, S. S. & LINACRE, A. M. T. (2008).A multiplex assay to identify 18 European mammal species from mixtures using the mitochondrial cytochrome b gene.Electrophoresis, 29(2), 340e347.

UNAJAK, S., MEESAWAT, P., ANYAMANEERATCH, K., ANUWAREEPONG, D., SRIKULNATH, K. & CHOOWONGKOMON, K. (2011).Identification of species (meat and blood samples) using nested-PCR analysis of mitochondrial DNA. African J Biotech, 10(29): 5670-5676.

VAWTER, L. & BROWN, W.M. 1986. Nuclear and mitochondrial DNA comparisons reveal extreme rate variation in the molecular clock. Science. 234, 194-196.

ZARRINGHABAIE, G. E., PIRANY, N., & JAVANMARD, A. (July 2011). “Molecular traceability of the species origin of meats using multiplex PCR”. African Journal of Biotechnology Vol. 10(73): 15461-16465.

24