Vol. 173, No. 1JOURNAL OF BACTERIOLOGY, Jan. 1991, p. 301-3070021-9193/91/010301-07$02.00/0Copyright X 1991, American Society for Microbiology

Sequence Domains Required for the Activity of Avirulence GenesavrB and avrC from Pseudomonas syringae pv. glycinea

S. J. TAMAKI,t D. Y. KOBAYASHI,t AND N. T. KEEN*Department ofPlant Pathology, University of California, Riverside, California 92521-0122

Received 7 June 1990/Accepted 12 October 1990

avrB and avrC from Pseudomonas syringae pv. glycinea share significant amino acid homology but interactwith different soybean resistance genes to elicit the hypersensitive defense reaction. Recombinant genesconstructed between avrB and avrC revealed that the central regions were required for avirulence gene activitybut the 5' and 3' termini were interchangeable. Recombinants involving the central regions did not yield anydetectable avirulence gene activity, and no new avirulence phenotypes were observed from any of the chimericgenes. These results suggest that the protein products of avrB and avrC possess catalytic properties that arerequired for the avirulence phenotypes.

Pseudomonas syringae pathovar glycinea (P. syringae) isthe causal agent of bacterial blight of soybeans. Strainswithin the pathovar glycinea are subdivided into physio-logical races defined by the pattern of resistant or sus-ceptible reactions that occur on a set of host cultivarspossessing different resistance genes. Avirulence genes thatare responsible for the race phenotype have been clonedfrom several P. syringae races (9). The expression of aviru-lence genes leads to the induction of a host defense reactioncalled the hypersensitive response (HR) in resistant culti-vars.Pathogen recognition by a plant is due to the interaction of

an avirulence gene with the corresponding resistance gene ina gene-for-gene manner (3). Two independent avirulencegenes, avrB and avrC, isolated from P. syringae race 0 (23),have been molecularly characterized (24). These genes areunique among avirulence genes in that they share consider-able sequence similarity but interact distinctly with differentresistance genes. avrB and avrC interact in a gene-for-genemanner with Rpgl and Rpg3, respectively (7, 18, 23). Inaddition, the phenotypes of the HRs induced by each genecan readily be distinguished. The avrB gene induces a strongHR that is visible within 16 to 20 h postinoculation, whereasavrC induces a much weaker HR with necrosis visible onlyafter 36 to 48 h.

Despite the molecular characterization of these two avir-ulence genes, the mechanism by which they cause resistantsoybean plants to undergo the hypersensitive defense reac-tion is not known. We have utilized the sequence homologybetween avrB and avrC to make reciprocal interchangesalong the lengths of the two genes in attempts to identifyregions responsible for avirulence gene activity. We reporthere that the central regions of avrB and avrC determine therespective phenotypes.

MATERIALS AND METHODS

Bacterial strains, plasmids, media, and growth conditions.The bacterial strains and plasmid constructions used in thisstudy are listed in Table 1. Escherichia coli strains were

* Corresponding author.t Present address: ClearGene Inc., Richmond, CA 94804.t Present address: Department of Plant Pathology, Rutgers Uni-

versity, New Brunswick, NJ 08903.

grown on LB agar at 37°C (17), and P. syringae strains weregrown on King medium B agar (KMB) at 28°C (12). Antibi-otics were supplemented, when appropriate, at the followingconcentrations: ampicillin, 50 ,ug/ml; kanamycin, 50 ,ug/ml;rifampin, 100 jxg/ml; and tetracycline, 12.5 ,g/ml. Antibiot-ics were purchased from Sigma Chemical Co.

Plant growth and leaf infiltration. Soybean plants weregrown and inoculated with bacteria as previously reported(8). P. syringae R4 cells harboring wild-type or recombinantavirulence genes were routinely infiltrated into primarysoybean leaves at 107 or 108 CFU/ml with a Hagborg device(4). Bacteria were also inoculated at a concentration of 105CFU/ml to ensure that plant responses to infection were notcaused by excess bacterial cell numbers.

Bacterial conjugation. E. coli SM10 (chromosomally en-coding the RP4 transfer functions) (20) was used as the donorstrain, and P. syringae R4 (Rif Ampr) was the recipient. E.coli SM10 cells harboring recombinant genes in pRK415were grown overnight on LB plates supplemented withtetracycline. P. syringae R4 cells were grown overnight onKMB plates supplemented with both rifampin and ampicil-lin. The recipient and donor cells were individually sus-pended in water to a final A6. of 1.0. Each donor strain wascombined with an equal volume of the recipient, and a 20-tJdrop of the bacterial suspension was placed onto KMBmedium and allowed to dry. The matings were allowed toproceed for 12 to 16 h at 28°C and loops of bacterial cellswere then streaked onto KMB-rifampin-ampicillin-tetracy-cline medium, which selectively permitted the growth of P.syringae R4 transconjugants. The resulting colonies weresingle colony isolated several times before use in plantinoculations.Recombinant DNA techniques. The standard DNA molec-

ular biology procedures have been described by Maniatis etal. (17). All DNA-modifying enzymes were purchased fromNew England BioLabs or Boehringer Mannheim. Plasmidswere isolated from P. syringae as described by Staskawicz etal. (22). The oligonucleotides (Fig. 1) used for site-specificmutagenesis to introduce the BalI, DraI, and SacI restrictionsites into avrB and avrC were a gift from Howard Goodman(Massachusetts General Hospital, Boston), and the remain-ing three oligonucleotides were purchased from the Biotech-nology Instrumentation Facility (University of California,Riverside). All oligonucleotides were purified on polyacryl-amide-urea gels and desalted with a C'8 Sep-pak column

301

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

302 TAMAKI ET AL.

TABLE 1. Bacterial strains and plasmid constructions

Bacterial strain or Characteristics Reference or sourceplasmid

BacteriaP. syringae pv. 14

glycinea R4E. coliDH5a endA1 hsdRJ7 (rK- mK+)(F- supE44 thi-1 X- recAl 480dlacZAM15 Bethesda Research

A(1acZYA-argF)U169 LaboratoriesMV1193 A(lac-proAB) thi rpsL endA sbcBJ5 hspR4 A(srl-recA)306::TnJO (Tetr) 25

(F':traD36 proAB lacIqZlM15)SM1o supE44 hsdR thi-1 thr-1 IeuB6 lacYl tonA21 recA Mu,+ RP4-2Tc::Mu, Kanr 20

PlasmidspRK415 Broad-host-range cloning plasmid 11pUC119 Cloning vector 25avrB avrB 2,217-bp PstI fragment 23avrC avrC 2,578-bp PstI fragment 23

Constructions madefor this study

CB23 avrB with an introduced Ball site at bp 626CB24 avrC with an introduced Dral site at bp 1374CB25 avrC with an introduced SacI site at bp 1544CB26 avrB with an introduced Hindlll site at bp 676CB27 avrB with an introduced SphI site at bp 828CB28 avrC with an introduced NcoI site at bp 1192CB35 avrB bp 0 through 626 fused to avrC bp 821 through 2,578 at a BalI siteCB36 avrC bp 0 through 820 fused to avrB bp 627 through 2217 at a Ball siteCB37 avrB bp 0 through 1166 fused to avrC bp 1375 through 2578 at a Dral siteCB38 avrC bp 0 through 1374 fused to avrB bp 1167 through 2217 at a DraI siteCB39 avrB bp 0 through 1333 fused to avrC bp 1543 through 2578 at a Sacl siteCB40 avrC bp 0 through 1544 fused to avrB bp 1334 through 2217 at a Sacl siteCB41 avrB bp 0 through 676 fused to avrC bp 888 through 2578 at a HindIII siteCB42 avrC bp 0 through 887 fused to avrB bp 677 through 2217 at a Hindlll siteCB43 avrB bp 0 through 828 fused to avrC bp 1040 through 2578 at an SphI siteCB44 avrC bp 0 through 1039 fused to avrB bp 829 through 2217 at an SphI siteCB45 avrB bp 0 through 981 fused to avrC bp 1193 through 2578 at an NcoI siteCB46 avrC bp 0 through 1192 fused to avrB bp 982 through 2217 at an NcoI siteCB47 avrB with bp 626 through 676 replaced with bp 821 through 887 of avrCCB49 avrB with bp 626 through 1333 replaced with bp 821 through 1544 of avrCCB50 avrC with bp 821 through 1544 replaced with bp 626 through 1333 of avrB

(Waters Corp.). Oligonucleotide site-specific mutagenesiswas used to introduce restriction sites into the homologousregions of the complementary gene. Oligonucleotide site-specific mutagenesis was done by the method of Zoller et al.(26) with the exception that single-stranded DNA templateswere produced by using the appropriate genes cloned inpUC119 (25). The resultant colonies were screened byrapid-boil extraction of plasmid DNA and analysis by agar-ose gel electrophoresis.

Construction of recombinant genes. Construction of therecombinant genes was generally accomplished by digestingpUC119 constructs carrying the avrB and avrC genes withthe appropriate restriction enzymes to remove various 5' or3' portions. The corresponding fragments from the homolo-gous gene were isolated by electroelution from agarose gelsand ligated to the appropriate deleted pUC119 clones, suchthat recombinant genes contained correct reading frames forthe synthesis of chimeric proteins. For example, CB35(Table 1) was constructed by digesting CB23 with BalI andBamHI. The BalI site is unique to the mutagenized avrBgene, and the BamHI restriction site resides at the 3' end ofthe gene in the polylinker sequence. The plasmid vector andthe 5' portion of the avrB gene was then ligated to thecorresponding BalJ-BamHI fragment isolated from the wild-

type avrC gene to construct the recombinant gene. Insituations where a restriction site was not unique, theappropriate DNA fragments were isolated from partial di-gests. The fusion junction of each recombinant gene wasconfirmed by subcloning of an appropriate DNA fragmentinto pUC119 and sequencing as described by Tamaki et al.(24). In addition, each recombinant gene was mapped byusing 10 different restriction enzymes (BalI, BglII, Dral,EcoRI, HindIII, KpnI, NcoI, PstI, Sacl, SphI) to ensure theaccuracy of the constructions (data not shown). The recom-binant genes resided on single PstI fragments and wereindividually cloned into the wide-host-range vector pRK415in both orientations. The resulting plasmids were mobilizedinto P. syringae R4 cells, and the transconjugants wereinoculated into primary leaves of a set of 10 soybeandifferential cultivars.

Bacteria expressing the various recombinant genes werelysed in Laemmli loading buffer and electrophoresed onsodium dodecyl sulfate-polyacrylamide gels to determinewhether proteins of the expected molecular weights wereproduced (16). Western blot analysis was done by themethod of Kobayashi et al. (15) with antibodies made againstpurified avrC protein (24).

J. BACTERIOL.

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

P. SYRINGAE PV. GLYCINEA AVIRULENCE GENES 303

Avirulence Genes andCorresponding Constructs

avrBCB23

avrCCB24

avrCCB25

avrBCB26

avrBCB27

Restrictionsites

Ball

Dral

Sacl

Hind I II

Sphl

avrCCB28 Ncol

Nucleotide Sequence

GCTGGCCTGACGATTGCTGGCCAGACGATT

ATCATTTAGAATCATATCATTTAAAATCAT

GGTATTGAACTACCGCCATGGTATTGAGCTCCCGCCAT

ATATTGTCAGAGCATGTACAACTATATTGTCAAAGCTTGTACAACT

CTCCGAAAGGACGTCCGATACACTCCGAAAGCATGCCCGATACA

Amino AcidSequences

ProPro

GluLys

Glu LeuGlu Leu

Gln Ser MetGin Ser Leu

Arg Thr SerSer Met Pro

CATGGCACGATTTCAAGTACAACTA lie Ser SerCATGGCACGATCCATGGTACAACTA Ile His Gly

FIG. 1. Sequences of the oligonucleotides used to introduce enzyme restriction sequences into avrB and avrC by site-specific mutagenesisare listed below the corresponding wild-type DNA sequences. The nucleotide bases of the codons affected by base substitutions are shownin boldface type, with the respective encoded amino acids listed to the right of the nucleotide sequences. Construct numbers shown on theleft are from Table 1.

RESULTS

Site-specific mutagenesis. Six restriction enzyme sitesalong the length of the coding regions were chosen fromeither avrB or avrC by subdividing the genes into seven

domains (Fig. 1 and 2). Since none of these restriction siteswas conserved in both genes, each restriction site was

introduced into the homologous region of the correspondinggene by oligonucleotide site-specific mutagenesis (Fig. 1).The nucleotide base substitution(s) used to introduce eitherthe BalI (CB23) or Sacl (CB25) recognition sites occurred inthe third base position of the codons and did not change theencoded amino acids (Table 1, Fig. 1). Introduction of theremaining restriction sites resulted in one or more aminoacid substitutions in the wild-type proteins. The SphI se-

quence introduced into avrB (CB27) caused the most dra-matic change, altering the three consecutive amino acids argthr ser to ser met pro. Recoveries of the desired site-specificmutants ranged from 30 to 50% of the colonies screened,with the exception of the NcoI mutant. Mutagenesis of avrCto incorporate the NcoI site (CB28) required the alteration offive contiguous bases (Fig. 1) and reduced the recovery ofmutants to 2 out of 80 colonies screened.The P. syringae R4 transconjugants harboring all of the

mutated avirulence genes interacted with the same cultivarspecificities and HR phenotypes as the respective wild-typegenes (data not shown). The mutant genes were accordinglyused to construct recombinant genes between avrB and avrCin attempts to define the regions that conferred the respec-tive avirulence specificities.Modulated interaction of recombinant genes. The soybean

cultivars 'Acme', 'Centennial', 'Harosoy', and 'Norchiefwere inoculated with P. syringae R4 harboring the recombi-nant genes. The cultivar 'Acme' possesses the resistancegene Rpg3, which interacts with avrC, whereas 'Harosoy'possesses the resistance gene Rpgl, which interacts withavrB. 'Norchief possesses both resistance genes, and 'Cen-tennial' lacks both of them (Fig. 2). Concentrations of P.syringae cells at 2 x 107 or 2 x 108 CFU/ml were inoculated

to obtain reproducible visible HR phenotypes. Infiltration ofa lower concentration of 2 x 106 CFU/ml did not consis-tently trigger visible signs of the HR in incompatible leaves;however, water-soaked lesions, which were evident in allcompatible interactions, did not form during a 2-week ob-servation period on leaves inoculated with 2 x 106 CFU ofincompatible bacteria per ml.

Figures 2 and 3 summarize the phenotypes of the interac-tions between P. syringae R4 transconjugants harboring thevarious recombinant genes and the four differential cultivars.Sequences required for the host-specific avirulence activityof each gene resided between the HindIII-Dral sites of avrBand the BalI-SacI sites of avrC (Fig. 2 and 3). Recombinantgenes constructed with exchanges internal to the Hindllland DraI sites did not exhibit any activity (Fig. 2). Thecentral regions are moderately conserved between the twogenes and constitute approximately 50% of the coding re-gions. The polypeptides encoded between the Dral and SacIsites are highly conserved between the two avirulenceproteins, with over 70% amino acid similarity. Despite thishomology, the DraI-SacI region has a distinct influence onavirulence activity. Thus, avrC activity requires the pres-ence of the avrC sequence in the DraI-SacI region, whereasavrB activity is expressed with these sequences from eithergene (Fig. 2, CB37 and CB38). The respective avirulencegene specificities were therefore conferred by the internalregions, a conclusion that was confirmed by constructs CB49and CB50, with interchanged flanking regions (Fig. 2 and 3).The wild-type avrB gene encodes 17 amino acids between

the BalI and Hindlll sites, whereas avrC encodes 23 aminoacids. If the six-residue difference is disregarded, then theamino acid identity in this region is 72% (24). However, theBall-HindIll region has significant effects on the biologicalactivity of the proteins. CB35 contains the 5' portion of avrBfused to the 3' portion of avrC at the BalI site and expressesavrC gene activity. Exchanging an additional 5' avrC se-quence up to the HindIII site with the avrB sequence resultsin a loss of activity (CB41). The reciprocal construction,

VOL. 173, 1991

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

304 TAMAKI ET AL.

Plant Reactions

Acme Centennial Harosoy Norchief

Race 4 wildtype C C C C

ral Sad TM

avrB

avrC

CB35

CB41

I I I I IATG BSl Hkxilh SphI (Ncol)

ATG Bal II I

ATG Hi1ll

I I I(Drl) (Sad) TM

TAM

TMLIzI-1-..ATG Sfe TAM

C C

I C

I C

C C

C I

C I

C C

Ncol TM

li

ATG Sad TMI I I

A7 fiji TeAI

I _~A7G H"dll

ATG Sphl

_zzzzATG Nfcd

TM

ATG

C C

C C

C C

C C

C C

C C

C C

C C

C C

.zI I C

C C

C C

I I

I I

1*

C

1*

C

C C

C C

C I

ATG Bal IHMdlilI I-

CB47 1ATG Ba I

CB50

C C

I C

C C

C I

I I

FIG. 2. Recombinant genes constructed from avrB and avrC. The recombinant genes were individually mobilized into R4 of P. syringaepv. glycinea, and the resulting transconjugants were inoculated into leaves of the four noted soybean differential cultivars. As noted, P.syringae R4 is compatible with all four cultivars, and a deviation from this pattern indicates the specific avirulence activity of the recombinantgenes. Abbreviations: C, compatible interaction (susceptible to disease); I, incompatible interaction (HR); I*, modified HR as described inthe text. The fusion junctions used to construct the recombinant genes are indicated by various restriction sites. Restriction enzymes shownin parenthesis were introduced into the wild-type genes by site-specific mutagenesis. Symbols: ED, avrB sequences; , avrC sequences.

CB42, had a unique, modified avirulence activity, whereasCB36 expressed wild-type avrB activity. P. syringae R4-CB42 elicited a strong necrotic HR on leaves of 'Harosoy'and 'Norchief which was visible 16 to 20 h after inoculation,typical of R4-avrB transconjugants. The necrotic margin ofthe HR remained well defined for 3 days after inoculation;however, marginal water soaking became evident after 5

days, eventually culminating in a fully compatible reaction.Bacteria isolated from water-soaked regions of these leaveswere found to be Tetr, indicating that the resulting compat-ible interaction was not caused by a subpopulation of bac-teria that had lost the plasmid harboring the CB42 gene.CB47 was constructed to examine whether the BalI-HindIIIfragment of avrC was responsible for the modified activity of

CB43 ATG

CB45

CB37

CB39

CB36

CB42

CB44

CB46

CB38

CB40

P.

i MEMO

1-

ATG

iBill

TAA

Sad TAA

J. BACTERIOL.

( ) hwwlll)(S.m NcdI I

I I I I

TAAI

Dral TAAI

m -1Sad TAA

I I

CB49ATG

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

P. SYRINGAE PV. GLYCINEA AVIRULENCE GENES 305

ATG (BaA)(H I 11 ) (SpM) Ncol Dral Sacd TAAI

avrB

avrC

ATG BaA HindilIl SphI (Ncd) (Dral) (Sad) TM

-I''''- I I - I I23.0% 52.2% 44.8% 41.20/6% 32.2% 70.9% 55.5%

avrB gene activity 161/322

242/353avrC gene activity

FIG. 3. Schematic representation of the avrB (=) and avrC ( ) proteins. The upper two bars represent the protein sequences, andvertical lines within the bars denote gaps incorporated to maximize the alignment. Each line connecting the bars represents an identical aminoacid. The proteins were divided into seven domains delineated by the restriction enzyme sites shown and the translational start and stopcodons in the DNA sequences. The percent amino acid homology for each of these domains is shown below the bars. The two bars at thebottom denote required protein regions that are essential for the respective specific avirulence phenotypes. The numbers of amino acids thatcompose these regions and the total numbers of amino acids in the respective wild-type proteins are listed at the right of each bar.

CB42. However, P. syringae R4-CB47 elicited the HR on thesame cultivars and with the same intensity as that of P.syringae R4 cells carrying the wild-type avrB gene.

P. syringae R4 transconjugants harboring each of therecombinant genes were inoculated into the leaves of 10differential soybean cultivars to determine whether newavirulence gene specificities had been created. All recombi-nant genes either lacked avirulence activity or expressedactivity identical to either the wild-type avrB or avrC genes.The sole exception was CB42, which, as noted above,exhibited modified avrB activity on all soybean cultivarscarrying Rpgl.

Synthesis of protein products from the various recombi-nant genes in E. coli and P. syringae cells was confirmed byWestern immunoblot analysis. Whole-cell extracts of E. coliharboring each of the recombinant genes were run ondenaturing sodium dodecyl sulfate-polyacrylamide gels andelectroblotted onto nitrocellulose. The antiserum used con-tained antibodies directed against the avrC protein anddid not cross-react with bacteria expressing the wild-typeavrB gene. However, all recombinant genes, includingthose that did not express avirulence activity (CB38, CB41,CB43, CB44, CB45, CB46), directed the production ofprotein products of the expected molecular weight; pro-teins were detected by the anti-avrC antibody (data notshown).

DISCUSSION

The protein products of the avrB and avrC genes werefound to possess essential central regions that determinedavirulence gene specificity. The flanking sequences sur-

rounding the central regions were interchangeable betweenthe two avirulence genes but necessary to retain activity.Furthermore, recombinant genes that expressed avirulenceactivity were restricted to either of the parental phenotypes,and no new avirulence specificities were observed on 10different soybean cultivars. These findings have consider-able significance to the mechanism whereby these genescommunicate with plant cells carrying the complementarydisease resistance genes.The elicitor-receptor model has been proposed to account

for the molecular events of recognition in gene-for-geneinteractions (6). Several pathogen-derived molecules havebeen characterized which are responsible for eliciting theHR specifically in plants carrying the complementary resist-ance gene. For instance, isolates of the tomato pathogenCladosporiumfulvum, carrying avirulence gene A9, producean extracellular polypeptide of 28 amino acids (la, 19).Infiltration of the peptide into tomato leaves caused necrosisonly in tomato cultivars carrying the Cf9 resistance gene (2).Similarly, the coat proteins of certain strains of tobaccomosaic virus have been shown to interact specifically withtobacco plants carrying the N' resistance gene and singleamino acid substitutions alter recognition (1, 13). The Cla-dosporium and tobacco mosaic virus peptides thereforerepresent cases where primary or processed translationalproducts directly elicit the HR in plants carrying the corre-sponding resistance gene.

In contrast to the peptide elicitors described above, P.syringae cells expressing avirulence gene D from P. syringaepv. tomato secreted a low-molecular-weight elicitor of theHR in soybean plants carrying the complementary resistancegene Rpg4 (7, 10). In this case the primary gene product does

...................

............................ ....

..................................................

.................................

..............................................................

VOL. 173, 1991

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

306 TAMAKI ET AL.

not function as an elicitor but instead appears to catalyze theformation of a unique, low-molecular-weight elicitor withinthe bacterial cell that is secreted. Although the mechanismsby which the avrB and avrC genes of P. syringae pv.glycinea mediate hypersensitive resistance are not known,the results presented in this paper and elsewhere are mostreadily interpreted as indicating that these genes also maycause bacterial hosts to produce discrete elicitor substances.First, like the avrD product, the protein products of avrBand avrC appear to remain cytosolic (24). Second, it waspreviously observed that the deletion of a small number ofamino acids from the carboxyl termini of avrB and avrCnegated avirulence gene activity (23). Third, the centralregions of avrB and avrC condition specific avirulencephenotypes but require flanking sequences to retain activity.Most informative, however, were the subtle changes inHR phenotype observed from recombinant genes involvingthe Ball-HindIll and Dral-SacI regions of avrB and avrC(Fig. 2 and 3). These effects, particularly the modified avrBphenotype resulting from CB42, are difficult to explain bymodels involving direct recognition of the primary or proc-essed protein products by the plant. Instead, they suggestthat the avirulence gene phenotypes result from avrBand avrC catalytic activities that are perturbed by smallchanges in the amino acid sequences of certain but not alldomains (Fig. 2 and 3). Finally, indirect studies by Huynh etal. (5) have suggested that P. syringae pv. glycinea cellsexpressing avrB may produce an HR-eliciting factor with arapid turnover time of approximately 10 min. These findingsare all consistent with but do not prove the notion that theavrB and avrC gene products exhibit enzymatic functions inbacterial cells, leading to the production of extracellularelicitors.

Similar to avirulence genes, certain nod genes of Rhizo-bium spp. have been shown to be host range determinants.For instance, the nodE genes of Rhizobium leguminosarumand R. trifolii determine host specificity for Vicia spp. andTrifolium spp., respectively (21). These two genes also share78% amino acid sequence similarity. Recombinant genesconstructed from the two nodE genes revealed that a stretchof 185 amino acids (46% of the proteins) located within thecentral portions of the encoded proteins determined the hostspecificity of the bacterial strains. Similar to our results withavrB and avrC, chimeric nodE genes possessed activitycorresponding to either of the parental phenotypes, butrecombinant responses were not observed. Functional nodEgenes stimulated the colonization of a unique host species.This positive-acting function is therefore distinct from thenegative role of avirulence genes in restricting pathogen hostrange. As such, the strategic role of the nodE genes in plantrecognition may be dissimilar to that of avirulence genes.However, the parallel results observed in the recombinantgene constructions argue that the nodE genes as well as avrBand avrC may function by related biochemical strategies,perhaps as enzymes.

REFERENCES

1. Culver, J. N., and W. 0. Dawson. 1989. Point mutations in thecoat protein gene of tobacco mosaic virus induce hypersensitiv-ity in Nicotiana sylvestris. Mol. Plant-Microbe Interact. 2:209-213.

la.De Wit, P. Personal communication.2. De Wit, P. J. G. M., I. M. J. Toma, and M. H. A. J. Joosten.

1988. Race-specific elicitors and pathogenicity factors in theCladosporium fulvum-tomato interaction, p. 111-119. In N. T.Keen, T. Kosuge, and L. Walling (ed.), Physiology and bio-

chemistry of plant-microbial interactions. American Society ofPlant Physiologists, Rockville, Md.

3. Flor, H. 1971. Current status of the gene-for-gene concept.Annu. Rev. Phytopathol. 9:275-296.

4. Hagborg, W. A. F. 1970. A device for injecting solutions andsuspensions into thin leaves of plants. Can. J. Bot. 48:1135-1136.

5. Huynh, T. V., D. Dahlbeck, and B. J. Staskawicz. 1989. Bacterialblight of soybean: regulation of a pathogen gene determininghost cultivar specificity. Science 245:1374-1377.

6. Keen, N. T. 1982. Specific recognition in gene-for-gene host-parasite systems. Adv. Plant Pathol. 1:35-82.

7. Keen, N. T., and R. I. Buzzell. Theor. Appl. Genet., in press.8. Keen, N. T., T. Ersek, M. Long, B. Bruegger, and M. Holliday.

1981. Inhibition of the hypersensitive reaction of soybean leavesto incompatible Pseudomonas spp. by blasticidin S, strepto-mycin or elevated temperature. Physiol. Plant Pathol. 18:325-337.

9. Keen, N. T., and B. Staskawicz. 1988. Host range determinantsin plant pathogens and symbionts. Annu. Rev. Microbiol.42:421-440.

10. Keen, N. T., S. Tamaki, D. Kobayashi, D. Gerhold, M. Stayton,H. Shen, S. Gold, J. Lorang, H. Thordal-Christensen, D. Dahl-beck, and B. Staskawicz. 1990. Bacteria expressing avirulencegene D produce a specific elicitor of the soybean hypersensitivereaction. Mol. Plant-Microbe Interact. 3:112-121.

11. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988.Improved broad-host-range plasmids for DNA cloning in Gram-negative bacteria. Gene 70:191-197.

12. King, E. O., N. K. Ward, and D. E. Raney. 1954. Two simplemedia for the demonstration of pyocyanin and fluorescein. J.Lab. Clin. Med. 44:301-307.

13. Knorr, D. A., and W. 0. Dawson. 1988. A point mutation in thetobacco mosaic virus capsid protein gene induces hypersensi-tivity in Nicotiana sylvestris. Proc. Natl. Acad. Sci. USA85:170-174.

14. Kobayashi, D. Y., S. J. Tamaki, and N. T. Keen. 1989. Clonedavirulence genes from the tomato pathogen Pseudomonas sy-ringae pv. tomato confer cultivar specificity on soybean. Proc.Natl. Acad. Sci. USA 86:157-161.

15. Kobayashi, D. Y., S. J. Tamaki, D. J. Trollinger, S. Gold, andN. T. Keen. 1990. A gene from Pseudomonas syringae pv.glycinea with homology to avirulence gene D from P. s. pv.tomato but devoid of the avirulence phenotype. Mol. Plant-Microbe Interact. 3:103-111.

16. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

17. Maniatis, T., E. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

18. Mukherjee, D., J. W. Lambert, R. L. Cooper, and B. W.Kennedy. 1966. Inheritance of resistance to bacterial blight insoybeans. Crop Sci. 6:324-326.

19. Scholtens-Toma, I. M. J., and P. J. G. M. De Wit. 1988.Purification and primary structure of a necrosis-inducing pep-tide from the apoplastic fluids of tomato infected with Clado-sporium fulvum (syn. Fulvia fulva). Physiol. Mol. Plant Pathol.33:59-67.

20. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host rangemobilization system for in vivo genetic engineering: transposonmutagenesis in gram negative bacteria. Bio/Technology 1:784-790.

21. Spaink, H. P., J. Weinman, M. A. Djordjevic, C. A. Wuifjelman,R. J. H. Okker, and B. J. J. Lugtenberg. 1989. Genetic analysisand cellular localization of the Rhizobium host specificity-determining NodE protein. EMBO J. 8:2811-2818.

22. Staskawicz, B., D. Dahlbeck, and N. Keen. 1984. Cloned aviru-lence gene of Pseudomonas syringae pv. glycinea determinesrace-specific incompatibility on Glycine max (L.) Merr. Proc.Natl. Acad. Sci. USA 81:6024-6028.

23. Staskawicz, B., D. Dahlbeck, N. Keen, and C. Napoli. 1987.Molecular characterization of cloned avirulence genes from race

J. BACTERIOL.

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

VOL. 173, 1991 P. SYRINGAE PV. GLYCINEA AVIRULENCE GENES 307

0 and race 1 of Pseudomonas syringae pv. glycinea. J. Bacte- 25. Vieira, J., and J. Messing. 1987. Production of single-strandedriol. 169:5789-5794. plasmid DNA. Methods Enzymol. 153:3-11.

24. Tamaki, S., D. Dahlbeck, S. Staskawicz, and N. T. Keen. 1988. 26. Zoller, M., and M. Smith. 1982. Oligonucleotide mutagenesisCharacterization and expression of two avirulence genes cloned using M13 derived vectors; efficient and general technique forfrom Pseudomonas syringae pv. glycinea. J. Bacteriol. 170: the production of point mutations in any fragment of DNA.4846-4854. Nucleic Acids Res. 10:6487-6500.

on March 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from