st. cecilia churchaug 16, 2020 · reduce stress - modern life brings a lot of stress, but relief...
TRANSCRIPT
St. Cecilia Church 20th Sunday in Ordinary Time
August 16, 2020
“O woman, great is your faith! Let it be done for you as your wish.” And the woman’s daughter was healed from that hour.
Sunday Vigil 5:00pm (Saturday)
6:30am, 8:00am, 9:30am, 11:00am
Monday through Friday 6:30 and 8:30 am
Saturday 8:30 am
#179 2
OFFICES Rectory 215.725.1240 Eleanor Kerwick Business 215.725.1240 Susan Wagner PREP 215.725.2821 Marcia Mason School 215.725.8588 Bobbie Mitchell Tuition 215.725.2201 Lisa Hnat Fax 215.725.2130 Website: www.stceciliafc.org School: scsfoxchase.org CYO Facebook: Saint Cecilia Catholic Youth Organization
Rectory Office Hours Currently closed ~ call 215-725-1240 for emergency.
Saint Cecilia Church 535 Rhawn Street
Philadelphia, Pennsylvania 19111
PASTOR Reverend Charles E. Bonner
PASTOR EMERITUS Reverend Msgr. Francis X. Dreger
PAROCHIAL VICAR Reverend Robert Lucas PERMANENT DEACON Deacon Patrick Diamond
PRINCIPAL Sister Catherine Irene Masino , IHM
VICE PRINCIPAL Sister Carolyn Elizabeth Braun, IHM
SACRAMENTS Baptism First three Sundays of the month at 12:15pm. Arrangements must be made at least two weeks prior to the Baptism. At-tendance at a Pre-Jordan class is required for first time par-ents. Please pre-register for class by contacting the Rectory at 215-725-1240. Marriage Couples must contact a priest six months prior to the wedding. Reconciliation Saturdays from 4:00 to 5:00pm Homebound Visitation Please contact the Rectory.
https://www.facebook.com/St-Cecilia-Church-Fox-Chase
Mass Schedule for Weekend ~ August 22 & 23 Saturday (Vigil) 5:00pm Celebrant: Fr. Bonner Lector: Ed Sharp 6:30am Celebrant: Fr. Lucas Lector: Paula Potts 8:00am Celebrant: Fr. Lucas Lector: Paula Potts 9:30am Celebrant: Fr. Bonner Lector: Rose Messina 11:00am Celebrant: Fr. Bonner Lector: Michelle Riccobono
Mass is live-streamed 9:30am on Sundays
Lectors play a key role in the celebration of Mass. A lector is a Minister of the Word who pro-claims God’s Word to the assem-
bled faith community. Liturgical proclamation of the Word is an awesome responsibility to which one is called and into which one is formed.
Being a lector is more than reading. This ministry in-volves studying, preparing and gaining an understand-ing of God’s Word that can be transferred to the assem-bly in a clear and understandable manner. The vital role of the lector is to communicate the depth and im-portance of the scriptures.
Anyone interested in joining this ministry for Sunday Masses, please contact Dave Schein by stopping in the Sacristy on the weekend or call 215-725-0903.
#179 3
20th Sunday in Ordinary Time The Liturgy of the Word First Reading Book of prophet Isaiah 56:1,6-7 Thus says the LORD: Observe what is right, do what is just; for my salvation is about to come, my justice, about to be revealed. The foreigners who join themselves to the LORD, ministering to him, loving the name of the LORD, and becoming his servants—all who keep the sabbath free from profanation and hold to my covenant, them I will bring to my holy mountain and make joyful in my house of prayer; their burnt offerings and sacrifices will be acceptable on my altar, for my house shall be called a house of prayer for all peoples. The word of the Lord. Thanks be to God. Responsorial Psalm O God, let all the nations praise you! Second Reading Letter of St. Paul to the Romans 11:13-15,29-32
Brothers and sisters: I am speaking to you Gentiles. Inasmuch as I am the apostle to the Gentiles, I glory in my ministry in order to make my race jealous and thus save some of them. For if their re-jection is the reconciliation of the world, what will their ac-ceptance be but life from the dead? For the gifts and the call of God are irrevocable. Just as you once disobeyed God but have now received mercy because of their diso-bedience, so they have now disobeyed in order that, by virtue of the mercy shown to you, they too may now receive mercy. For God delivered all to disobedience, that he might have mercy upon all. The word of the Lord. Thanks be to God. Gospel The holy Gospel according to Matthew 15: 21-28
At that time, Jesus withdrew to the region of Tyre and Sidon. And behold, a Canaanite woman of that district came and called out, “Have pity on me, Lord, Son of David! My daughter is tor-mented by a demon.” But Jesus did not say a word in answer to her. Jesus’ disciples came and asked him, “Send her away, for she keeps calling out after us.” He said in reply, “I was sent only to the lost sheep of the house of Israel.” But the woman came and did Jesus homage, saying, “Lord, help me.” He said in reply, “It is not right to take the food of the children and throw it to the dogs.” She said, “Please, Lord, for even the dogs eat the scraps that fall from the table of their masters.” Then Jesus said to her in reply, “O woman, great is your faith! Let it be done for you as you wish.” And the woman’s daughter was healed from that hour. The Gospel of the Lord. Praise to you, Lord Jesus Christ.
FOCUS: God’s grace and mercy are promised to all.
The readings today wrestle with the questions of who is in and who is out. When it comes to God’s grace, who will receive it? We learn that all who
accept the gift of faith are incorporated into the cove-nant relationship with God. LITURGY OF THE WORD: The Lord speaks through Isaiah giving his promise that all who hold to his covenant will be brought to his holy mountain. In the second reading, Saint Paul tells the Gentiles that God delivered all to disobedience, that he might have mercy upon all. In the Gospel, a Canaanite woman asks Christ to have pity on her, for her daugh-ter is tormented by a demon. In spite of initial rejec-tion, the woman perseveres in faith and Jesus heals her daughter.
REFLECTION: The Canaanite (Gentile) woman comes to plead for her tormented daughter. Her hun-ger and need are great. She comes to Jesus, the source of nourishment and healing. She is considered an out-sider and not one of "the chosen." But she is focused on Jesus and will not be dissuaded. She represents each of us today hungry for the bread from the table and longing for God.
So, we ask ourselves:
Where and when in our lives have we experi-enced being an "outsider?"
Who offered us a welcome?
Shall we give thanks today for the welcome we received?
God bless our newly baptized
Griffin Matthew Ishler Fiona Jayde Callahan
Second Collection this weekend is taken up for the Catholic University of America in Washington, DC. Thank you for your financial support. We also take this opportunity to thank everyone who continues to support Saint Cecilia Parish. You generosity both in church and mailing in your envelopes is very much appreciated. May God bless you for your kindness and continued support.
6 feet apart of course
#179 4
Pray For Our Troops Jason Showmaker (Navy) Mark Strecker (Navy) Michael D’Antonio (Air Force) Sean Lay (Army) Brian A. Mason (Army) Christopher J. Starrett (USMC) Brandan Beaudet (USMC) Michael Molz (Army) Patrick Breslin (Army) Erin Bartholomew (Navy) Nick Marteney (Navy) Martin P. O’Donnell (Trauma Nurse-Air Force)
Pre-Cana Attending a Pre-Cana session is re-quired for all engaged couples preparing to celebrate the Sacrament of Matrimo-ny. Maternity BVM Parish, located at 9220 Old Bustleton Avenue (19115) will be holding their Fall Pre-Cana Day on Saturday, September 26, 2020. Advance registration is necessary. To register, please call the rectory at 215-673-8127.
PREP Volunteers We are in need of volunteer PREP teachers for online instruction for the 2020-2021 school year. At this moment, classes will take place online and not in the classroom. Teachers will be instructed how to do virtual classes. If you are interested in volunteering your time for this very important min-istry, please contact the rectory at 215-725-1240.
Meditate at Home A regular meditation practice can bring a host of spiritual, psychological and physical benefits to your life. Meditation isn’t just for monks and mys-tics – anyone can learn it! Christian meditation allows us to spend more quality time with God. It teaches us to control our thought-life and helps us maintain our mental health and emotional well-being.
6 Reasons to Meditate 1. Reduce Stress - Modern life brings a lot of
stress, but relief is a few breaths away. 2. Manage Depression - In many cases, medita-
tion can reduce or eliminate the need for anti-depressant medications.
3. Lessen Emotional Reactivity - Meditation can help you make better choices by responding mindfully instead of reacting impulsively.
4. Increase Focus - Meditation keeps you on task amidst the thousands of distractions you face every day.
5. Improve Relationships - Meditation can lead to greater self-awareness, emotional intelligence, and acceptance of yourself and others.
6. Strengthen Compassion - Christian meditation allows us to spend more quality time with God. A regular meditation practice can help you become kinder and more caring toward others and the natural world.
PREP Parish Religious Education Program
Register NOW for 2020-2021 year Deadline ~ Friday, August 21, 2020
Classes for the moment will be online via Zoom beginning Sunday, September 13.
Call the rectory at 215-725-1240 to register for PREP. A completed form along with payment, baptismal certifi-cate or permission from Pastor of another parish are due to the rectory no later than August 21. COST: $75 (one child) $125 (two children) $175 (three or more children) Study books will be available for pick up on Saturday, August 29 at the PREP office from 9:30am to 12:00 noon. This is the only day you will be able to pick up your books.
The Scriptural Rosary (from A Mi-nute in the Church by Gus Lloyd) The Rosary is a deeply meditative prayer. Each mystery recalls an event in the life of Jesus or His Mother. A wonderful way to meditate more deeply on the mysteries is by reflecting on Scripture. This can be done with the Scriptural rosary.
Here’s how it works: before praying each Hail Mary that corresponds with the mystery upon which you are meditat-ing, you read or say a passage of Scripture. Each Scripture passage is short—usually just one or two verses or even part of a verse. Since there are ten Hail Marys for each mystery, you will read 10 passages of Scripture for each mystery.
The Scripture passages tell the story of the mystery and help to familiarize you even more with God’s written Word. As St. Jerome said, “Ignorance of Scripture is ignorance of Christ.” With the Scripture passages added, a Scriptural Rosary may take a few minutes longer to pray. Enjoy the extra time spent in prayer!
There are many great resources—pamphlets, books, web-sites, etc. available to help you pray the Scriptural Rosary. You’ll find that combining God’s Word with the rosary will be a powerful way to enhance and deepen your prayer life!
#179 5
Saint Cecilia School 525 Rhawn Street, Philadelphia, PA 19111
A Christ-Center Community Committed to Academic Excellence
Extra Curricular Activities Student Council Future Cities Team Forensics Mathletes Altar Servers Service Commission School Band/Strings Program CYO Sports Scouting Reading Olympics
Academics Religious Education Archdiocesan Elementary Curriculum Honors Math Science Lab Program Technology Music Education Physical Education/Health Fine Arts
Special Services CARES (after school program) CORA (Educational & Counseling Services) SHALOM Program NDS Program (we offer FREE break-fast and lunch for students) Catapult (Title 1 Reading, ELL, Family Counseling )
Middle States Accreditation PA Licensed Early Childhood Program & Afternoon School Care
Register NOW for 2020-2021 215-725-8588 (Main Office) 215-725-2201 (Tuition Office)
Sponsor a Student (2020-2021) This program helps our families who want to send their children to Saint Cecilia School and may have some financial difficulty along the way. With your help these families can keep their child in our school and receive a good Catholic education.
There are several gifting levels and payment options - You can make a one time payment or select any option you wish. We will identify those students with the greatest need and allocate the funds accordingly. For more information on this program or to give a tax de-ductible gift, please feel free to contact Lisa Hnat, Tuition Coordinator at 215-725-2201 or email at [email protected].
179 Church of St. Cecilia, Philadelphia, PA (3rd) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Stone • Brick • Concrete • Pointing • EP Henry • Stucco • Waterproofi ngZucaroZucaroCONTRACTINGCONTRACTING
Masonry ContractorsSince 1922
215.533.1934215.533.1934
20% Discounton Labor for all Mechanical Work
15% Cash Paidfor Accident Referrals
$39.00+tax
Inspection & Emissions
$19.95Oil Change
(Most Cars)
Auto Body & Repair Shop
612 Huntingdon Pike, Rockledge 215-379-3113 www.abbysautocenter.com
Lifetime Warranty on all Paint & Body Work. Satisfaction Guaranteed
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you money with your monthly
payments on your commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600, Philadelphia, PA 19103
• Physical, Occupational & Speech Therapy• Short & Long Term Care• Beautiful On-Site Chapel With Daily Mass• Memory Support • Respite Stay• Adult Daycare • Woundcare• IV Therapy • Trach Care
ST. JOHN NEUMANN CENTERFOR REHAB AND HEALTHCARE
10400 Roosevelt Blvd.Philadelphia, PA
215-698-5600www.stnrehab.org
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY- Shop Local -
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
Advertise Your Business Here800-333-3166
ext. 161www.jppc.net
Rafferty Roofi ng215-281-0771
PA062531
For Quality & Honest Work at Reasonable PricesFree Estimates • Licensed & Insured
20 YEAR GUARANTEE ON HOT WHITE RUBBER ROOF
After
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
rivate & Public Healthcare - La- - - -- -- - - - nforcement, Public Safety - OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOfficeccecececececececececececece
ponders - Fooooooooooood &d & d &d & d & d & d & d &d & d &d &d &d & d & d & AAAAAAgrAAAAAAAAlture - Energy Sector rrrrrrrr rrrrr - Wa- Wa- Wa- WWW- Wa- Wa- Wa- WaWa- Wa- Wa- WWaste
Waterwaste - Transportattattattattattattatattatattattattattta ion ion ion ononononon on on onon on on on & Lo&&&&&&&& gics - Public Woooooooorks r & - & Infrfffffffffffff astastrastrtstttstaststtsttstst uctur
Communicatatatttttttatattatttioionononsionsionionionionsionionsiooniono & I&&&&&&&&& nforf matioy Workeorkekkekekekekekekekekekkekers -rs -rs -rs -rs -rs -rs -rs rs -rs -rs -rs -rs -s -s - Community
overnment WWWWWWWWWWWWWWWorkeorkeorkeorkeorkorkorkeorkeorkeorkeorkeorkorkorkeorkerrs - Critical Maacturing -g ---g --g -g ---g --g --- CheCheCheCheCheCheCheCheCheCheCheCheCheCheChemical & Hazardouateteeeeeeeeeeeeeerialrrrrrrrrrrrrrr s FiFiFiFiFiFiFiFiFiFiFiFiFiFiFinancnancnannannananaannanannancnancnancan ial Services - Defensdustristristristristristrstrtristristristritristritritrial Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Bal Baasasasasasasase - Commercial Faciesssssessessssssss WorWorWorWorWorWorWorWorWorWorWorWorWorWorWorkkkkkkekekekerskekekkkk - Resid ti l & Sh ltervicesicesicesicescescecescesicesicesicescescescesces & Facilities - Hygiene Prod
To all thoserivate & Publicrivate & nforcement Pubnforcement Pub
ssentialFirst RespFirst Resp
workersWaterwaste Waterwaste
keepingcs - PublicuCommunCommun
s safe,chnologychnology
yzardouzardouD fD
service isvices DefensDefenmercial Facimercial Faci
invaluable &idential & Shelteidential & ShelteH i P dH i Ptha
nk yo
u
afeeeefeeeeeeeefefefefetyty --ttty --ttttty t -tt -- OffiOOOOOOOOOOOOO cers & First RespondeFFFoFFFFFF od &d &d &d &&&d &&d &&od d &&d &d &d &d &d &d &d &d &d AgrAAgrAAAAAgrAAAAAgrgrrgrrAggrrrAgrA rrgAAA rAAAgrAAgg iculicucuiculuiculiculiculcuiculiiicuicultureturetureurertureurturertureurrrurerrrurrtur - E- E- EE- E- E- E-- EEE- EEEnergy Se
ooroorror rrr - WaWa- WaWa- Wa- WW- WaWWWWWW- W- WWaa- WWaWaWaaWaasteststtstee stesssteetsteetts ess ees e & Wa& Wa& W& Wa& WaWaWW& Wa& Wa& WaW& Wa& Wa& WaWWWaa&& W& WaWa& Waterwterwterwterwteterwterwterwterwerwtterwe wteteerwerwerwrwwterwtterwwwasteastasteaasteasteaastesteteasteaassteasteaststststeeeeeee - TTT- T- TT- TT- T--- T- TT- T-- ranrarrarararrararraararaaaraarortrtrtrtrtrrrttttttatioatitiatiotitatiattiiatataatatataaaa n &&n & n &&n &nn Logistics - Public Wor
MASSES FOR THE WEEK OF August 17
MONDAY, August 17 6:30am – Thomas Wagner 8:30am – Patrick McGettigan
TUESDAY, August 18 6:30am – Catherine McGinley 8:30am – Caterina & Domenico Tomeo
WEDNESDAY, August 19 6:30am – Helen Xibos 8:30am – Ethel Raffay & Dorothy Laut
THURSDAY, August 20 6:30am – Francisco Xavier Le & Ane Phung 8:30am – Thomas J. Costello & Kathleen Costello Bockol
FRIDAY, August 21 6:30am – Thomas Rush 8:30am – Rosemarie McKinney
SATURDAY, August 22 8:30am – Peter Della Vecchia 5:00pm – Richard Eidmann
Remember Our Sick and Suffering Walter Hnat Ed Lieber Christopher Rodgers Patricia Moore James J. Tobin Mary Schultz Ann Marie Tobin Masgai Charles Friel Meghan Kovacs Joan Marie Reiley John Lawrysk Maki Turner Kirsten Hosack-Edling Helen Flood Stephanie Morgan James Potts Owen Doyle Mary Benson Esther Sharp Mary Jane Brough Leo Wuestkamp Stephen Ruczynski Helen Tobin Mike McKee Andrew Slivjak Melissa Fischer George Burbage Patricia Greenleaf Rita Giordano Daniel Mitchell Lisa Kovacs-Breuer Gregory Farrell Ed MacNew Timothy Martin John Smykal Julia McCauley Alice Davis Mary Matthews Josephine O’Donnell Marguerite Zeltman Alice Zmijewski Jack Vogler Eileen Gaynor Alberta DeMasi Eleanor DeNoble Eugenia DiSilva Marian Diel Kathi Silcox Catherine Needham Connie Merkel Ellen Jones
Let us pray for the souls of all the faithful departed, especially Carolyn Robinson
179 Church of St. Cecilia, Philadelphia, PA (i) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
FOX CHASE WINDOWS & DOORSSALES - INSTALLATION
Please Call ... 215-725-4211
FREE ESTIMATES
Parish Member
ALL TYPES WIRING & REPAIRS215–329–9456 Parish Member
G.J. ROSSI & SONELECTRICIANS
Now In Our 3rd Generation
PATRICK J. FOY(215) 281-9656
Interior & Exterior PaintingWallpapering & Scraping
FREE Estimates • Reliable • Honest
309 Central Ave., Cheltenham379-0881
JOSEPH P. FARLEYPLUMBING & HEATING
Alterations-Jobbing
Reg. No. 3121P.A. 043294
Classic OpticalDR. AMY C. TAN, O.D. 215-722-2242
*Eye Exams * Contact Lenses * Eyeglasses6516 R S A . (G R S )
Sweeney’sVerree Tavern
KITCHEN OPEN FROM 11 AM TO MIDNIGHT
The all new Kim’s Crab CakesPhilly’s Largest Wings
All Soups & Chili HomemadeTAKE OUT AVAILABLE
All Major Sporting Events With 6 Colored TV’s
Finest Tavern Food Now Available in our
New Private Dining Room
7968 VERREE RD.215–725-3366
Mariann OwensOffi ce: (215) 698-2000Direct: (215) 698-2027Cell: (215) 280-7222Email: [email protected] Buyers and Sellersin Philadelphia, Bucks, and Montgomery CountiesEach Offi ce Independently Owned and Operated
2000
SENIOR CITIZEN DISCOUNTS
ReliableFull Service Plumber
PLUMBING, HEATING & DRAIN CLEANING EMERGENCY SERVICE
INSURED • FREE ESTIMATES215-722-6783215-379-8300
SERVING ENTIRE CITY & SUBURBS
CITY VIOLATIONS CORRECTED
SEWER LINES REPLACED • HOT WATER HEATERSFROZEN PIPES • WATER PRESSURE INCREASED
DIGGING & EXCAVATION SPECIALISTS
Reg. Master Plumber #4287Michael Zalewski
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Leslie AitaVocalist
Parishioner
Visit Us At Our New Location
Rockledge Plaza Huntingdon Pike
408 Huntingdon PikeRockledge, PA 19046215-379-2100
Family Ownedand Operated
Since 1948
$350Off Any New Stairlift With This Ad
• FREE in home evaluations• Family owned & operated for more than 20 years
1.888.900.8883
www.Tri-StateStairlifts.com
Traditional Funerals, Church Funerals & Memorial Services, Cremations“ONE FAMILY HELPING ANOTHER”
7450 Oxford Ave Phila, PA 19111 215-728-1050
David G RichardsonSupervisor/Owner
Cher l A Webb-RichardsonManager & LCBA Insurance Rep
Parishioner
richardsonsfuneralhome.com Councilman Brian O’Neill
Northeast offi ces near St. Cecilia ParishionersFox Chase - 432 Rhawn Street • 215-685-6431 • Rhawnhurst - 7522 Castor Ave • 215-685-0438
FreeNotaryPublic
Free copies
& Faxes
Karon MassadoReal Estate Salesperson
o 267.435.8015 m [email protected]
1601 Market St.- Fl. 19, Phila, PA
Wackerman Funeral Home, Inc.Wackerman Funeral Home, Inc.8060 Verree Rd. Philadelphia, PA 19111
www.wackermanfuneralhome.com 215-342-5200 Elizabeth Wackerman Bailey, Supervisor 1944 – Austin C. Wackerman - 2017 Emily Wackerman Funeral Director
Free & Confi dential Pregnancy Services24 Hour Hotline: 1-800-550-4900
www.BirthRight.org
“It is the right of every pregnant woman to give birth, and the right of every child to be born.”
~Birthright Charter7986 Oxford Avenue
Philadelphia, PA 19111215-728-0385
A Blessing from God
John DeCristofaroROOFING
Specializing in: Hot Asphalt RoofsShingle Roofs • Gutters • Spouts
215-379-2953 Member of St. Cecilia
A Tompkins Community BankFormerly Madison Bank
8000 Verree Rd., Philadelphia(215) 722-4566
www.risingsunhomecare.org
Providing The Highest Quality Care
Parishioner of St. Cecilia
215-605-9555
catering For your next event, call ahead to order
- Pickup or Delivery -WHITMAN SQUARE 215-969-3455 x1
Eric McHughParishioner
CYO Volunteer OFFERING AUTO, HOME, LIFE,
& BUSINESS INSURANCE Call for a quote
215-328-9990 x7001 or email [email protected]
210 Huntingdon Pike, Rockledge
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting. This describes the power of...
ve, supuuuu portive, refefefefefefefferrals, relationshipppps,,,, affordable, repeeee etitious, versatile, last
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN! Call 1.800.333.3166!
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
Patronize the Adve isers who make this bulletin possible!
BUILD YOUR COMMUNITY!
Patt o i e the A
SHOP LOCAL
To advertise your business in this weekly bulletin,contact us at 1.800.333.3166
or visit us at www.jppc.net
179 - Church of St. Cecilia, Philadelphia, PA (b) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net
Schmidt’s Florist 700 Solly Ave., Phila., PA 19111
www.schmidtsfl orist.com 215-745-6234
LAW OFFICES
PAUL A. COGHLAN437 RHAWN STREET
PHILADELPHIA, PA 19111(215) 725-5998
FAX (215) 725-3904
Robert Wetzel, F.D.419 Huntingdon Pike, Rockledge
Erich Wetzel, Supv.Willow Grove - Bill Herchenroder, Supv. INC.
Funeral Directors Since 1881 215-663-8550 • www.wetzelandson.com
Stewart and McGowanATTORNEYS-AT-LAW
6221 RISING SUN AVE. (Opposite St. William’s Church)338-2800
S W D ’ E
WE DELIVER~ Traditional Pizza~ White Pizza~ Tomato Pies
The Original
Pizza6500 Rising Sun Ave. • 215-745-9992
Nora McCloskeyParishioner
Fine Art ClassesWorkshops & Partiesfor Children & Adults215-301-0103
www.bloomingartiststudio.comwww.bloomingartiststudio.com
PLUMBING, HEATING, DRAIN CLEANING & AIR CONDITIONING
SENIOR CITIZEN DISCOUNTFREE ESTIMATES
Ph: (215) 728-1482Fax: (215) 742-7098
8675 Torresdale Ave.Philadelphia, PA 19136
WWW.BILLFRUSCO.COM
O’Donnell PaintingInterior and Exterior
House Painting & Drywall RepairNeat Clean Work • No Job Too SmallFree Estimates 215-677-5854
THOMAS A. CUNNINGHAM, ESQ.Attorney At Law
AUTO ACCIDENT — PERSONAL INJURYWILLS — DIVORCE — REAL ESTATE
109 Huntingdon Pike • Rockledge, PA 19046215-722-6230
Traveling Hair DresserServicing Men, Women & Children
Parishioner for 48 years
215-806-8187
Krissy Tamaro
Reichwein
JOHN F. GIVNISH(3rd Generation)
JOHN F.X. GIVNISH, III(4th Generation)
Serving the Archdioceseof Philadelphia with
grace and dignity since 1928
1-800-GIVNISH
Each Offi ce Independently Owned and Operated
Larry AitaREALTOR®
Seniors Real Estate SpecialistOutstanding Agents. Outstanding Results.
Regency Realty
Cell: (215) 478-4344Offi ce: (215) [email protected]’s Get Moving!
2018 Outstanding
Agentof the Year
s.
Parishioner
Serving Families Since 1900
Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick Funeral Home, Inc.Joseph J. McGoldrick, F.D. 1924-2013
Th omas M. McGoldrick, F.D. SupervisorJames T. Meyers, F.D. • Timothy J. Meyers, F.D.
215-884-0800 507 West Avenue, Jenkintown, PA 19046 www.mcgoldrickfh .com
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 • [email protected] It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.Message and data rates may apply.
JIM CASEYWallcoveringPainting • ScrapingClean Work • Since 1986215-379-0558 Member of Parish
Professionals Serving Professionals
Jay B. ComlyBuilding & Offi ce Maintenance
w/an A+ Rating
Commercial • AutomotiveResidential • Safes
Fully Equipped RadioDispatched Mobile Trucks
7936 Oxford Ave. 215-745-5007
Full Service Locksmith Since 1978Member of Parish
VERREEPHARMACY
7960 VERREE RD.(AT RHAWN)Free Delivery
M-F 9AM - 8PMSat. 9AM - 6PM
Sun. 9AM - 1 PM215-342-0100
Mitchell Spivack, R. PH.
HandymanElectric, PlumbingOdd jobs... Just Ask!
From McCloy’s TV 267-231-8785
A Heavenly Hair Salon215-379-1880
Angel Cuts
See You Soon!930 Fox Chase Road, Rockledge
Tax & AccountingFrancis J. McConnell CPA
Tax Preparation • Individual & Business(Across from St. Williams)
Call (215) 742-3428 for Appointments
Charles P. Elliott, PC 110 Central Ave
Cheltenham, PA 19012
215-663-2500We Make House Calls
Complimentary InitialConsultation
We are here for all your tax, IRS, fraud investigations,
& inheritance tax.
RENEE ROACHEREALTOR ~ PARISHIONER
FOX CHASE SPECIALISTBuying or Selling a Home?
Call Today!
Office 215-961-6000 Cell [email protected]
EASTERNEEEAEAAEAEEEEEEEEEEEEEEEEAEASTSTTTSTTTSSTTTTTTTTTEEREEEEEEEEEEEEEEAEAEAEEEEEEEEASTSTTTSTTSSTTTEEEREEEE
A Signature Hair Salon llc$10 OFF Color ServiceMen | Women | Children
7950 Bustleton Ave., Philadelphia, PA215-821-3522
Cochrane Construction LLC
ROOFINGSIDING * GUTTERS
Chimney Restorations & RepairsLicensed & Insured PA # 154589
Senior Citizen Discounts • Free Est.215-839-4317
www.cochraneconstruction.org
Friends, Family, Neighbors!
1-844-640-4200 PaulsRun.org/Living
Wedding Invitations Wedding Invitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from yourconveniently from yourhome or offi ce.home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
WE CARE AND IT SHOWS
Beautiful On-Site Chapel with Daily Mass - Respite Stay Available
We Acknowledge We Appreciate
2990 Holme Ave., Phila.215-335-2100
www.imrehab.org
IMMACULATE MARYCENTER
Rehabilitation & Healthcare
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net