Strategy of Redesign for CTLMA2 Target Site AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA -7A -10A/-7A -5C/-4C Semi-saturation mutagenesis based on the X-tal structure Mutagenesis based on Rosseta design -5C/-4C Semi-saturation mutagenesis to promote the catalysis -10A/-7A/-5C/-4C Semi-saturation mutagenesis based on the X-tal structure Semi-saturation mutagenesis to optimize the catalysis +1C/+2A/+8C Saturation mutagenesis / Random mutagenesis CTLMA2 site Random mutagenesis Redesign for -7A Introduced mutations at T22, K23 and T29, in order to alter the contact with the bottom strand base at the position -7. AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA G : C A : T (Gray, WT target; magenta, CTLMA2 target) -7C > -7T R72 T29 T22 K23 -7G > -7A Selection for -7A Amino-acid substitutions F, L, I, V, Y, H, N, D, C, R, S, and G at T22 and T29 M, P, T, A, Q, K, E, W, F, L, I, V, Y, H, N, D, C, R, S, and G at K23 T22Y/K23G/T29S was chosen for the next selection (-10A/-7A). pCcdB pEndo HE Target Induction of HE gene Transformation Induction of both HE and CcdB genes + Arabinose 15 h + Arabinose + IPTG Data from 2 independent experiments Redesign for -10A/-7A Introduced mutations at K24, G25, K26, and Y27 in Y2 + T22Y/K23G/T29S background. AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA (Gray, WT target; magenta, CTLMA2 target) -10T > -10A G25 K26 K24 -10A > -10T Y27 -7A -7T T22 > Y22 K23 > G23 T29 > S29 -10T > -10A -10A > -10T Redesign for -5C/-4C Introduced mutations at Y18, S20, E31, G33, R59 and A68, based on Rossetta design. AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA S20 Y18 E31 G33 A68 R59 (Gray, WT target; magenta, CTLMA2 target) -4G > -4C -5G > -5C -5G > -5C -4G > -4C Selection for -5C/-4C Amino-acid substitutions S and Y at Y18; Q, K and S at S20; R, S, Q, A and E at E31; S, R and G at G33;F, L, I, V, H, N, D, C, R, S, G, and Y at R59; T, R, I, and S at A68 G33R/V56I/R59S/A68R was subjected to the next selection to promote the cleavage activity. pCcdB pEndo HE Target Induction of HE gene Transformation Induction of both HE and CcdB genes + Arabinose 24 h + Arabinose + IPTG * Mutation induced through PCR amplification Data from 2 independent experiments Redesign for -5C/-4C (2nd round) Introduced hydrophilic residues at E35, I55, S57 and S59. I55 G33 > R33 (Gray, WT target; magenta, CTLMA2 target) E35 R59 > S59 A68 > R68 S57 V56 > I56 -4G > -4C -5G > -5C