systems medicine and proactive p4 medicine have reached a...

49
Systems medicine and proactive P4 medicine have reached a tipping point: transforming healthcare predictive, preventive, personalized and participatory Lee Hood Institute for Systems Biology, Seattle 11-7-13

Upload: others

Post on 07-Sep-2020

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Systems medicine and proactive P4

medicine have reached a tipping point:

transforming healthcare

predictive, preventive, personalized and participatory

Lee Hood

Institute for Systems Biology, Seattle

11-7-13

Page 2: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Paradigm change in medicine focusing on

the individual patient—systems medicine

• The genomic revolution – Democratization of genome

– Genetic variants cause many diseases

– High throughput genomic tools—sequencing, arrays, etc. leading to Big Data.

– Parts list of genes and proteins essential for systems biology

• The systems-biology revolution – Global and comprehensive analysis of biological

systems

– Deciphering biological complexity with Big Data

– Creating models of biology and disease that are predictive and actionable

Page 3: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

I Participated in Five Paradigm Changes

in Biology over 40 years—managing

complexity

• Bringing engineering to biology—developed 5 instruments that led to high throughput biology and big data in biology

• The human genome project— invented enabling technology—automated DNA sequencing, advocate, participant, created one of first genomics companies, applying genomics to P4 medicine

• Cross-disciplinary biology—created 1st department—enabled technology development

• Systems biology—created 1st institute—deciphering biology complexity and applying it to disease

• Systems medicine and the emergence of proactive P4 medicine—early advocate and pioneer—is transforming healthcare

Page 4: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

What I learned from the 5 paradigm changes

• Each fundamentally changed how we think about and practice biology and medicine.

• Each was met initially with enormous skepticism.

• Each new paradigm change required a new organizational structure to be realized.

Page 5: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

What is system medicine?

Page 6: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

• The digital information of the genome

Human Phenotypes are Specified by Two Types of Biological Information

• The environmental information that impinges upon and modifies the digital information

Phenotype

Page 7: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Big data is one essence of systems medicine: In 5-10

years each individual will be surrounded by a virtual

cloud of billions of multi-scale data points—big data

Transactional

11010100010101010110101010100100

0

Phenome

Na143 K 3.7 BP 110/70

HCT32 BUN 12.9 Pulse

110 PLT150 WBC 92

GCGTAG ATGCGTAGGCATGCATGCCATTATAGCTT

CCA

Genome

Proteome

arg-his-pro-gly-leu-ser-thr-ala-trp-

tyr-val-met-phe-

Transcriptome

UUAGUG AUGCGUCUAGGCAUGCAU

GCC

Epigenome

1101010001010101011010101010010001011010

10001

Single Cell

11010100010101010110101010100100

iPS Cells

11010100010101010110101010100100

Social Media

1101010001010101011010101010010001011010

10001

TeleHealth

1101010001010101011010101010010001011010

10001

Page 8: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Systems medicine: disease-perturbed

network of networks

Page 9: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Systems biology (medicine) infrastructure

and culture—drives discovery and

innovation

Page 10: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Holy Trinity: Biology Drives Technology Drives Computation

Learn languages Foster teams

Biologists Chemists Computer scientists Engineers Mathematicians Physicists Physicians

Page 11: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

ISB

Broad

Whitehead

CSHL

HHMI

JCVI Sanger

SIB Novartis

George Institute

American Cancer Society

Joslin

Harvard-MIT

SCImago Institution Rankings of 3290 Research Institutions in 2012—ISB is 4th in the world

Page 12: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

The Institute for Systems Biology (ISB)

has participated in creating 17 companies in

the 13 years of its existence—raised half a

billion dollars for investment and created

more than 500 jobs

Page 13: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Systems medicine has reached a tipping

point and is changing the practice of

healthcare

Page 14: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Systems Medicine Transforms Healthcare

• Provide fundamental insights into dynamical disease-perturbed networks – Enable mechanistic insights, diagnosis, therapy and prevention for the individual patient

• Family genome sequencing—identifying disease genes – Identify disease, wellness genes and drug-intolerant genes. For the identification for each

individual of 300 actionable genes

• Transform blood into a window to distinguish health from disease – Disease diagnostics, assess drug toxicity, assess wellness

– Human examples: lung cancer, PTSD, liver toxicity, liver hepatitis

• Stratify diseases into their distinct subtypes – For impedance match with appropriate drugs

– Human example: various cancers

• Stratify patients—drug adverse reactions, modifier genes to disease mechanisms, eg, early and late onset of Huntington’s disease, Variant genes increase mercury susceptibility in kids

• Permit a multi-organ approach to the study of disease – Unraveling the complexity of the individual patient’s disease

• Enable a new computational approaches to pioneering drug reuse and drug target discovery

– Re-engineer disease-perturbed networks to normalcy with drugs, Repurpose drugs.

faster and cheaper, drugs that prevent networks from becoming disease-perturbed

• Increasing focus on wellness

• Large-scale,multiparameter, Framingham-like clinical trials to permit all of the above

Page 15: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Family genome sequencing—

integrating genetics and genomics

to identify disease genes

Page 16: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Whole Genome Sequencing of Family of Four

The genome sequences of a family

permit one to use the principles

of Mendelian genetics to:

• Identify 70% sequencing errors—

current error rate—less than 1/106

• Identify rare variants

• Determine chromosomal haplotypes—

reduce disease search space

• Determine intergenerational mutation

rate—35 mutations per child

• Identify candidate genes for simple

Mendelian diseases

Unaffected parents

Children with

craniofacial

Malformation

(Miller Syndrome)

and lung disease

(ciliary dyskinesia)

Page 17: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Alternating Hemiplegia of Childhood

* *

N

* * * * * *

* * * * * * * * *

?

ATP1A3

spl /wt

spl /wt

spl /spl

spl /wt

CYYR1

del /wt

G>W /wt

G>W /del

G>W /del

del /wt

del /wt

del /del

del /del

wt /wt

C22orf25

del /wt

wt /wt

del /wt

del /wt

del /wt

INADL

Page 18: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Systems diagnostics--making blood a

window into distinguishing health from

disease

Page 19: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

A systems approach to blood diagnostic for

identifying benign lung nodules in human

lung cancer

Integrated Diagnostics—Paul Kearney, Xiao-jun Li,

etc.

Page 20: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Indeterminate Pulmonary Nodules

Integrated Diagnostics

Is this cancer?

~3 million cases annually in the USA

Patrick Nana-Sinkham, MD Ohio State University

Page 21: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Lung Nodules Found by CT Scan in USA

PET Scan Needle Aspiration Bronchoscopic Biopsy

Repeat CT studies

Surgery for nodule removal

(Ost DE and Gould MK. Decision Making in the Patient with Pulmonary Nodules. Am. J. Respir. Crit. Care Med. October 6, 2011 as doi:10.1164/rccm.201104-0679C)

Cancer Risk

lower intermediate higher

Watchful waiting for 2

years

Look for cancer

surgery threshold “watchful waiting” threshold

~0.8 – 2.0 cm

3 million cases/yr 600,000 in “dilemma zone”

Page 22: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Lung cancer blood biomarker panel

• From 400 candidates to a panel of 13 proteins—using systems approaches to deal with signal to noise issues

• 92% accurate detection of malignant lung nodules

• Rule out about 70% of the benign nodules

• Save the healthcare system in US about $3.5 billion

• Bring “peace of mind” to many patients

• Panel is independent of 3 classical criteria for lung cancer—age, smoking history and size of lung nodule

Page 23: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Blood 13-protein Panel: Lung Rule Out

Function – Prevalence Adjusted

Rule Out

May 2013

Page 24: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Three Lung Cancer Networks Monitored:

12/13 biomarkers map to these networks

Page 25: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Blood Biomarker Panels for Detecting

Disease—Five Features

• Distinguish normal individuals from

diseased individuals

• Early diagnosis

• Follow progression

• Follow response to therapy

• Stratification of disease into different

subgroups for impedance match against

effective drugs—and proper prognosis

Page 26: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

ISB Approaches to Disease Stratification—

One of the Grand Challenges for Medicine

• Patient iPS cells differentiated to relevant

cells in a test tube—and perturbation with

environmental signals

• Delineate dynamic networks in diseased

tissues

• Employ organ-specific blood proteins and

blood miRNA fingerprints

Page 27: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Personalized use of drugs for cancer

therapy

• Sequencing tumor genomes to identify

mutated protein targets for which we have

drugs—examples, melanoma, breast

cancer, colon cancer, etc.

Page 28: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Computational approaches to identifying

drug targets—re-engineering disease-

perturbed networks to be more normal and

repurposing drugs

Page 29: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Wellness assays of the future using

a fraction of a droplet of blood to

follow wellness/disease in 50

human organs—organ-specific

blood proteins

Page 30: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

APLP1,SNAP25,LGI1,NACM1, CLSTN2

KINESIN,MAP1B,SYT3,CT

NND1

CAMKII,PCLO,GRIA4,GLUR3,NSF,ANK2,ENO2,DOCK3

,SCG3,

L1CAM,CTF1, ARF3,ANK3,

MAP3K12,CTNNA2,KIF3A,GFAP,CNTN1,ENC1

, CRMP2, SYNAPSIN1

NEUROMODULIN,HUC,CAMKIIA,RIN,SYNAPSIN1,RGS4,PEA15,RASGRF1,NR1

GNAO1, GNA13,

GABBR1, GLUR1,GRI

A1

MAP1A,SPTBN,

SPTBN4,FOXG1,EPHA5,N

CAM2, ELAVL3

TAU,MAP2, CAMKII, EPHA5,

UCHL1,NCAM1

RGS4,PEA15,CAMKII,RASGRF1,

NR1

Synaptic vesicle transport

Calcium mediated signaling

Synaptic Transmission

Neurogenesis

Cell surface receptor signaling

GPCR signaling

Cellular differentiation

Anatomical structure

development

Nerve growth factor signaling

179 Brain-Specific Blood Proteins

Reflect Key Networks (SRM assays)

Page 31: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Brian

Lymph node

lung

Spleen

Bone marrow

Stomach

Pancreas

Bladder Small intestine

Bone Marrow

Kidney

Liver

Heart

Muscle

Larynx Eye

Colon

PBMC

Skin

Tongue

Uterus

Cervix

Placenta Breast

Ovary

Testis Prostate

Thymus

Peripheral nerve

*: highlighted in GREEN circles

We have generated list of organ-specific blood proteins covering 19 major organs* in human body

Page 32: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Making Blood a Window into Health and Disease for 100s millions of patients:

50 organ-specific blood proteins from each of 50

organs—measure 2500 blood proteins

Integrated nanotech/microfluidics platform

Jim Heath, et al

cells out

300 nanoliters of plasma

Assay region

5 minute measurement 1. Uses fraction of droplet of blood

2. Assay takes 5 minutes to measure 50 proteins

3. Mid amole level of sensitivity

4. Already being used in hospitals

Page 33: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

P4 pilot project: studying wellness in

100,000 patients longitudinally—20-30 years

Page 34: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

We are rarely able to study what we

really want to related to health and

disease

Page 35: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Health: What do we really want to

understand from 100,000 well patients?

Wellness

Time

Wellness

Disease transition

Page 36: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Me

asu

rem

en

ts

Classic Blood Monitoring Blood collection and monitoring of traditional blood biomarkers • lipid panel, minerals, CRP, liver enzymes etc. • Blood tests 3 times a year – complete regeneration of blood in 120 days • Personalized and molecular feedback from changes in behavior

Self-Tracking (Quantified Self) Health monitoring though self-tracking - including digital devices • Activity, sleep, weight, blood pressure, stress, mood… • Instant & personalized feedback • Leveraging social networking for health

Genomics Genome sequencing & personalized interpretation • 300 actionable variants, and growing • Identify disease predisposition - personalized interventions to reduce disease • Pharmacogenomic analysis to optimize medication choices and dosages • Nutrigenomic analysis to optimize nutrition

Emerging/Novel Biomarkers Emerging: New applications for existing biomarkers • Microbiome

Novel: ISB tests–organ specific blood markers • Identify disease subtypes for proper drug match • Identify disease state and track disease progression

Big Data / Analytics

1. Collection, integration

& analysis of all accumulating health data

2. Correlations between different types and sources of health info

3. Discovery of novel indicators and patterns of health

4. Fuel scientific discovery

5. Personalize health information

6. Optimize clinical care

Page 37: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Follow transitions in 100,000 individuals

from

1) wellness to greater wellness,

2) from wellness to disease for all

major diseases and

3) from disease to wellness

Page 38: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Wellness/Health Demonstration Project:

Objectives/Benefits

• Short term—optimize wellness and reduce disease for each individual patient and reduce the costs

• Intermediate term—create a data base of wellness measurements to mine for the “wellness metrics”

• Long term—generate a data base from individuals that will allow us to follow transitions from wellness to disease for major diseases

• Long term—create a “Silicon Valley of Wellness and Disease Transitions” through the 100,000 person longitudinal database

Page 39: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

P4 medicine arises from a convergence of

three healthcare thrusts

Page 40: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

The emergence of P4 medicine:

predictive, preventive, personalized

and participatory

Digital Revolution Big Data

Systems Biology and Systems

Medicine

Consumer-Driven Healthcare and Social Networks

P4 Medicine

Three converging megatrends Driving the transformation of healthcare for patients

Page 41: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

The “new medicine” or P4 medicine

• Is far more that just personalized

medicine—hence P4 medicine—nuanced

description of major features—predictive,

preventive, personalized and participatory

• Precision medicine is a terrible term

– It not precise—big data is all about dealing

with enormous signal to noise problems

– Precise does not describe any of the features

of the new medicine

Page 42: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

P4 Medicine • Predictive

• Probabilistic health history from patient data clouds

• DNA sequence & longitudinal multi-parameter (blood) measurements

• Preventive

• Design of therapeutic and preventive drugs/vaccines via systems approaches

• Wellness

• Personalized

• Unique individual human genetic variation and environments mandates individual treatment

• Deal with patient as an individual not as population

• Patient will be their own control for longitudinal (lifelong) data analyses

• Participatory:

• Patient-driven social networks for disease and wellness will be a driving force in P4 medicine

• Society must access patient data and make it available to biologists for pioneering predictive medicine of the future

• How does one educate patients, physicians and the healthcare community about P4?

• IT for healthcare

Page 43: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

How P4 medicine differs from

Evidence-based Medicine

• Proactive

• Focus on Individual

• Focus on Wellness

• Generate, mine and integrate enormous amounts of data on individual patients to produce predictive and actionable models of wellness/disease

• Large patient populations analyzed at single individual level (not population averages!) to generate quantized stratification of patient populations and create the predictive medicine of the future. N=1 experiments.

• Patient-driven social networks are a key to driving the acceptance of P4 medicine. The emergence of the quantified self networks in many cities demonstrates crowd sourcing and the ability to drive physician to start learning about wellness.

Page 44: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Conceptual Themes of P4 Medicine

Disease Demystified Wellness Quantified

P4 Medicine Predictive

Preventive

Personalized

Participatory

Page 45: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Two Challenges for Bringing Paradigm-

Changing P4 Medicine to Patients • Technical

– Biology informational science

– Strategies

– Technologies

– Computational/mathematical tools

• Societal – Education of patients, physicians and healthcare community

– Social networks will be key to educational process

– Bring P4 to the healthcare delivery system—a radical change

– Access to patient records and materials for mining the predictive medicine of the future

– Others: ethics, legal, social, security, privacy, policy, regulation, economics

How to bring P4 medicine to patients and the healthcare system? Through pilot projects for proof of principle—100K wellness project

Through creation of Institutes for Systems Medicine at medical schools to disseminate the vision Patient-activated social networks

Page 46: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Systems Medicine has Five Societal

Implications

• Turn sharply around escalating costs of healthcare—democratization of healthcare

• Digitalize medicine for the individual patient—a larger revolution than the digitization of information technologies and communication—patient-driven medicine and wellness

• Force a revision of business plans of every sector of healthcare industry—enormous opportunities for innovation and economic gain

• Systems Medicine will create significant wealth

• Transform the practice of medicine – Improved healthcare

– Decreased costs

– Enhanced innovation

Page 47: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Why the P4 Medicine Will Turn Around the

Sharply Escalating Costs of Healthcare

• Blood is a window into health and disease—early diagnosis will lead to saving

• Diagnosis will stratify disease and patients and create an impedance match effective drugs—companion diagnostics

• Re-engineering disease-perturbed networks to normalicy with drugs—new and less expensive strategy for drug target discovery

• Benefits of wellness-- survey biannually 2500 blood organ-specific protein measurements—50 from each of 50 organs—global early detection of the transition from health to disease

• Digital technologies exponentially increasing in measurement potential and decreasing in cost--sculpt for individuals the dimensions of health/disease while dramatically decreasing measurement costs, e.g. sequencing a human genome in 2000 about $300 million dollars; in 2012 about $3000—a 100,000-fold decrease in cost—digitalization of medicine

• Other medical advances arising from mechanistic insights—stem cells, neurodegenerative, aging, vaccines, cancer etc.

Page 48: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish

Health Policy Recommendations • Support the science of Systems Medicine and

application of P4 Medicine to healthcare

• Support the education of patients, physicians and the healthcare systems about P4 medicine

• Create effective patient (consumer)-driven social networks around P4 pilot projects

• Pioneer a truly effective IT for healthcare system that can manage the aggregation, mining, integration and modeling of patient data clouds of billions of features

• Create a “gold standard” web site of modern medical information—accessible for patients (and physicians)

• Encourage the industrial innovation that is emerging in the areas of wellness, P4 medicine and the emerging digitization of medicine

• Make certain that the patient’s data clouds are available for mining for the predictive medicine of the future—for our children and grandchildren.

Page 49: Systems medicine and proactive P4 medicine have reached a …personalizedmed.eu/live/wp-content/uploads/Leroy_Hood.pdf · 2015. 5. 7. · • Transform blood into a window to distinguish