The Dictyostelium discoideum GPHR Ortholog Is an EndoplasmicReticulum and Golgi Protein with Roles during Development

Jaqueline Deckstein, Jennifer van Appeldorn, Marios Tsangarides, Kyriacos Yiannakou, Rolf Müller, Maria Stumpf, Salil K. Sukumaran,Ludwig Eichinger, Angelika A. Noegel, Tanja Y. Riyahi

Institute of Biochemistry I, Medical Faculty, Center for Molecular Medicine Cologne (CMMC), and Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD), University of Cologne, Cologne, Germany

Dictyostelium discoideum GPHR (Golgi pH regulator)/Gpr89 is a developmentally regulated transmembrane protein present onthe endoplasmic reticulum (ER) and the Golgi apparatus. Transcript levels are low during growth and vary during development,reaching high levels during the aggregation and late developmental stages. The Arabidopsis ortholog was described as a G pro-tein-coupled receptor (GPCR) for abscisic acid present at the plasma membrane, whereas the mammalian ortholog is a Golgiapparatus-associated anion channel functioning as a Golgi apparatus pH regulator. To probe its role in D. discoideum, we gener-ated a strain lacking GPHR. The mutant had different growth characteristics than the AX2 parent strain, exhibited changes dur-ing late development, and formed abnormally shaped small slugs and fruiting bodies. An analysis of development-specific mark-ers revealed that their expression was disturbed. The distributions of the endoplasmic reticulum and the Golgi apparatus wereunaltered at the immunofluorescence level. Likewise, their functions did not appear to be impaired, since membrane proteinswere properly processed and glycosylated. Also, changes in the external pH were sensed by the ER, as indicated by a pH-sensitiveER probe, as in the wild type.

The highly conserved GPR89 (G protein-coupled receptor 89),also known as GPHR (Golgi pH regulator), has for a long time

been thought to be an orphan G protein-coupled receptor(GPCR) (1, 2). In recent reports, the proteins from Arabidopsis,Drosophila, and mouse were characterized with regard to theirroles (3–5). The Arabidopsis orthologs GTG1 and GTG2 (GPCR-type G proteins 1 and 2) were identified as abscisic acid receptors.Mutants lacking GTG1 and GTG2 exhibit abscisic acid hyposen-sitivity. GTG1 and GTG2 are unique among the GPR89 proteins,as they harbor a degenerate Ras GTPase-activating protein do-main at their C termini and have GTPase activity. The green flu-orescent protein (GFP)-tagged Arabidopsis proteins GTG1 andGTG2 were detected at the cell peripheries of protoplasts (3). Thislocalization contrasts with that of the Drosophila and mouseGPHRs, which were found at intracellular membranes (4, 5). Re-cently, the view that GTG1 and GTG2 have a GPCR-type structurehas been challenged, since they have more than seven predictedtransmembrane regions (6).

In mammalian cells, the protein was identified in a search for aprotein involved in pH regulation. It was identified as an anionchannel critical for acidification and functions of the Golgi appa-ratus, hence the name GPHR, a term that we use for the D. discoi-deum protein, as well. GPHR could restore delayed protein trans-port, impaired glycosylation, and Golgi apparatus disorganizationin mutant Chinese hamster ovary cells by reestablishing Golgiapparatus acidification. The authors also demonstrated voltage-dependent anion channel activity after reconstitution of the pro-tein into planar lipid bilayers (4). Earlier studies had identified thegene in a search for human genes that activate NF-�B and MAPKsignaling pathways (7). Expression analysis in the mouse showedubiquitous presence. The inactivation of the single mouse gene byhomologous recombination resulted in lethality of the homozy-gous mutants, whereas no notable phenotype was observed for theheterozygous mice (8). A keratinocyte-specific GPHR knockoutled to hypopigmented skin, hair loss, and scaliness. As an under-

lying defect, diminished formation of lamellar bodies that resultedin an impaired skin barrier was noted. Through the secretion oflamellar bodies, lipids and proteins are delivered to the extracel-lular spaces of the stratum corneum, where they establish the bar-rier functions (9).

The Drosophila GPHR (dGPHR) is associated with the endo-plasmic reticulum (ER) and the Golgi apparatus. Loss of the pro-tein caused disorganization of these compartments and a defectivesecretory pathway. At the organismal level, it led to a growth de-fect, and to death in the late larval stages. Expression in neuronalor gut cells rescued the growth defect. The authors suggested thatthis might be due to the restoration of the secretion of some un-known factor(s) (5).

We analyzed the D. discoideum GPHR homolog (DdGPHR) byexpressing the protein as a GFP fusion protein and generatingknockout cells. DdGPHR localized to internal membranes, pri-marily of the ER, and also accumulated at the Golgi apparatus. Itsloss led to a defect during growth in shaking suspension, andGPHR� cells exhibited severe changes during late developmentthat can be explained by the developmental expression pattern ofthe gene. The morphologies of the slugs and of fruiting bodies

Received 3 September 2014 Accepted 4 November 2014

Accepted manuscript posted online 7 November 2014

Citation Deckstein J, van Appeldorn J, Tsangarides M, Yiannakou K, Müller R,Stumpf M, Sukumaran SK, Eichinger L, Noegel AA, Riyahi TY. 2015. TheDictyostelium discoideum GPHR ortholog is an endoplasmic reticulum and Golgiprotein with roles during development. Eukaryot Cell 14:41–54.doi:10.1128/EC.00208-14.

Address correspondence to Angelika A. Noegel, noegel@uni-koeln.de, or Tanja Y.Riyahi, triyahi@uni-koeln.de.

J.D., J.V.A., M.T., K.Y., and S.K.S. contributed equally to this article.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

doi:10.1128/EC.00208-14

January 2015 Volume 14 Number 1 ec.asm.org 41Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

were significantly altered, as well as the expression patterns ofdevelopmentally regulated genes, where timing and abundancewere affected.

MATERIALS AND METHODSGrowth and development of D. discoideum strains and mutant gener-ation. The D. discoideum strains used were AX2 (10), AX2 expressingGFP-LimD (11), a GPHR-deficient strain derived from AX2 (GPHR–),and GPHR– expressing GPHR carrying a GFP tag at its C terminus(GPHR-GFP) (GPHR� rescue). The strains were grown submerged at22°C in axenic medium or on a lawn of Klebsiella aerogenes on SM agarplates in order to obtain sufficient quantities of cells for experimentalanalysis (10). Growth on Escherichia coli B/r in shaking suspension (160rpm) was done as described previously (12). Development was initiatedby resuspending cells in Soerensen phosphate buffer (17 mM sodium-potassium-phosphate, pH 6.0) at a density of 1 � 107 cells/ml and shakingat 160 rpm. The cells were sampled at the indicated time points and usedfor protein analysis. These conditions allowed the formation of aggre-gates. For development on a solid substratum, which allows developmentuntil fruiting body formation, 5 � 107 cells were spread onto Soerensenphosphate-buffered agar plates (10 cm in diameter) and incubated at22°C. Photographs were taken at identical times after plating for compar-ison of the developmental stages.

The GPHR gene was amplified from genomic DNA derived fromstrain AX2 and cloned into pGEM-T Easy (Promega). The sequence wasverified and used for all further cloning steps. For inactivation of theGPHR gene, a gene replacement vector was established. Nucleotides 7 to630 and 866 to 1410 of the genomic DNA (A of the starting ATG is takenas position 1) were cloned into the pLPBLP vector (13). The plasmid wastransformed into AX2, and transformants were selected using blasticidinS (MP Biomedicals, Eschwege, Germany) at 1.5 �g/ml. Single colonieswere selected on a Klebsiella lawn, DNA was isolated from nuclei usingphenol-chloroform extraction, and PCR analysis was carried out withprimers that allowed detection of the gene replacement event. For sizedetermination of the PCR products, a 100-bp ladder (Bioline, Lucken-walde, Germany) was used. For expression of GPHR-GFP, the genomicDNA was cloned into p1ANeo8 (14). A plasmid allowing expression of theER marker calreticulin fused to ratiometric pHluorin (calpHluorin) wasobtained from dictybase (http://dictybase.org/index.html) (15). It wastransformed into AX2 and GPHR� cells. Selection of transformantswas done with G418 (2 �g/ml).

Fluorescence measurements. Excitation scans were generated using aTecan fluorescence plate reader. Cells were washed and starved for 2 h inSoerensen phosphate buffer, and 1 � 106 cells expressing calpHluorinwere added per well of a 96-well plate. Excitation scans were performedbetween wavelengths 340 nm and 490 nm. Emission was set at 510 nm. ForpH experiments, cells were harvested, starved for 2 h in Soerensen phos-phate buffer at a density of 1 � 107 cells/ml in order to reduce autofluo-rescence due to the medium that had been taken up, and resuspended inthe appropriate buffer. To manipulate the intracellular pH, cells wereharvested by centrifugation, and the Soerensen phosphate buffer was re-placed by 20 mM 2-(N-morpholino)ethanesulfonic acid (MES) buffer,pH 6.0, containing 20 mM propionic acid or by 20 mM Tris-HCl, pH 8.0,containing 20 mM NH4Cl. Both reagents, propionic acid and NH4Cl,diffuse through the plasma membrane and dissociate in the cell, wherethey alter the pH. For live-cell microscopy, the pH was changed by addingMES buffer containing increasing concentrations of propionic acid (10 to30 mM) or NH4Cl (10 to 17.5 mM) (16).

Mutant analysis. Growth analysis, Saccharomyces cerevisiae phagocy-tosis, measurement of mannosidase activity, analysis of cell motility, andphototaxis were done as described previously (12). Mannosidase activitywas determined in cell pellets and in the supernatant. Cells were starved ata density of 1 � 107 cells/ml. At the beginning of the experiment (t0) andafter 2, 4, and 6 h, 500 �l of cell suspension was taken to measure man-nosidase activity. For determination of the secreted enzyme, 100 �l of the

supernatant was mixed with 100 �l Na-citrate buffer, pH 5.0, and 200 �lsubstrate solution (2 �l p-nitrophenyl-�-D-mannopyranoside [150mM]). The substrate was dissolved in dimethylformamide (DMF). Thereaction was stopped after a 30-min incubation at 37°C by addition of 600�l sodium borate (0.2 M, pH 9.8), and the product was extracted intobutanol. Nitrophenol formation was estimated by measuring the absor-bance at 405 nm. For determination of the total enzyme activity, cells werelysed by addition of Triton X-100 (0.5%).

For chemotaxis analysis, cells were starved in suspension (Soerensenphosphate buffer, pH 6.0) at a density of 1 � 107 cells/ml and taken foranalysis of cell motility after 5 h of development. Twenty-five to 30 �l ofcell suspension was diluted in 3 ml of Soerensen phosphate buffer andmixed well by pipetting (25 to 30 times with occasional vortexing) in orderto dissociate cells from aggregates; 1.5 ml of the diluted cells was thentransferred onto a glass coverslip with a plastic ring placed on a Leicainverse microscope equipped with a 20� UplanFl 0.3 objective. Time-lapse image series were captured and stored on a computer hard drive at30-s intervals with a JAI CV-M10 charge-coupled device (CCD) cameraand an Imagenation PX610 frame grabber (Imagenation Corp., Beaver-ton, OR) controlled through Optimas software (Optimas Corp., Bothell,WA). Cells migrating toward an aggregation center were analyzed. DIASsoftware (Solltech, Oakdale, IA) was used to trace individual cells alongimage series; it automatically outlined the cell perimeters and convertedthem to replacement images from which the position of the cell centroidwas determined. Speed and change of direction were computed from thecentroid position.

Development on phosphate agar was followed by visual inspectionand determining the expression of developmental markers by quantitativereal-time PCR (qRT-PCR) experiments using the primers listed in Table 1and Western blot analysis probing for development of specific proteins.For qRT-PCR, defined amounts of D. discoideum annexin 7 cDNA wasused as an internal standard. RNA was isolated from AX2 and GPHR�

cells that had been starved on phosphate agar plates (5 � 107 cells perplate) using phenol-chloroform extraction after cell lysis with SDS (0.5%)and converted into cDNA using reverse transcriptase (Promega) and ran-dom primers. GAPDH (glyceraldehyde-3-phosphate dehydrogenase)amounts were used for normalization. For spore viability assessment, de-velopment was carried out on phosphate-buffered agar plates, spores wereharvested and treated or not with Triton X-100, and colony formation waschecked by plating appropriate numbers of spores onto a lawn of Kleb-siella (17). Spore and stalk cells were assessed after staining with calcofluorwhite stain (Fluka). They were incubated for 1 min in a solution preparedaccording to the data sheet and analyzed under UV light (17). Calcofluorwhite binds to cellulose that is present around differentiated spore andstalk cells. Development was also followed after neutral red staining ofcells. Neutral red, a vital dye, is specific for prestalk cells, which have large

TABLE 1 Primers used for qRT-PCR

Primera Sequence (5=¡3=)cadA-122-for TCATGTCATGTTTGGTTGGTTCAAATGcadA-550-rev CTGTAACTTGGCCAGTTGTTGGGAGTcarA-515-for GGGCAATTTCAGCAGTATTGGTTGGTTcarA-977-rev TCGGAACTACATTGCACATCATCACCAcsa-476-for TCGTGCCAAATACAATCGCTGGTGcsa-960-rev TGGGCTTGAGGTTCCCCATGGTTecmA-4570-for TGCATCGAAGTCCCAATGAATTGTTACCecmA-5010-rev ACCAGTCTTGGAATCGCAACTATCAGCecmB-2710-for CCGAAGATAAATGTACTCAATCAGGTGGTGecmB-3140-rev TTCCAAATGTTTTGCATTGGGTCATTGpspA-82-for GCCAATCAAAATCCAGTTTGTGCTTCApspA-499-rev GGGAAAGAATCATTGAGAAAATAATGAGTGAspiA-221-for CTCCAGCAACTGCTCATCCAAGACAAGspiA-674-rev ACAGTAGCCATGGCACCAACTGCATTAa The numbers next to the gene names indicate the positions in the cDNA.

Deckstein et al.

42 ec.asm.org January 2015 Volume 14 Number 1Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

acidic vacuoles. Cells were incubated for 1 min in an equal volume of 0.1%neutral red solution (in Soerensen phosphate buffer) and subsequentlywashed and plated onto phosphate agar. To analyze growth behavior un-der stress, cells were grown in petri dishes in axenic medium in the pres-ence of 30 mM NaCl or 115 mM sorbitol. For statistical analysis, theStudent t test was used.

Immunofluorescence, Western blot analysis, and antibodies used.For immunofluorescence analysis, methanol-fixed cells were stained foractin with the mouse monoclonal antibody (MAb) act1 (18), tubulin wasdetected with rat MAb YL1/2 (19), CAP with mouse MAb 223-445-1 (20),protein disulfide isomerase (PDI) with MAb 221-135-1 (21), annexin 7with MAb 185-338-1 (22), and the nuclear envelope-associated proteininteraptin with MAb 260-60 (23). MAb 190-340 recognized the Golgiapparatus marker comitin (24), MAb 83-418 the 56-kDa D2 protein (25),MAb 130-80 the 69-kDa crystal protein CP (25), and MAb 70-11-1 the30-kDa mitochondrial porin (26). MAb 221-35-2 is directed against thevacuolar ATPase subunit VatA (27). For detection, goat anti-mouse orgoat anti-rat antibodies coupled to Alexa Fluor 488 (Life Technologies)were used. Mitochondria were also stained using MitoTracker (Life Tech-nologies). Cells in medium were incubated for 15 min with MitoTracker(1:1,000 dilution of a 1-mg/ml stock [in dimethyl sulfoxide {DMSO}]) atroom temperature and fixed with ice-cold methanol. The cells were thenstained with the MAb act1 to visualize the boundaries of the cells. Analysisof fixed and living cells was done by laser scanning confocal microscopyusing a Leica TCS SP5 microscope equipped with a very sensitive hybriddetector (HyD).

Proteins were separated by SDS-PAGE (10% acrylamide), blottedonto nitrocellulose membranes, and probed with appropriate antibodies.GFP-tagged protein was detected with MAb K3-184-2 (28), and the celladhesion molecule contact site A (csA) with MAb 33-294 (29). N- andO-glycosylation of csA was detected with MAb 123-353, which primarilyrecognizes N-glycosylated csA, and MAb 24-210, detecting O-glycosy-lated proteins (29), with MAb 188-19 directed against cap32 (30) as aloading control. The centrosome was labeled with MAb K68-332-3, de-tecting CP250 (31). In Western blots, proteins were detected with en-hanced chemiluminescence using horseradish peroxidase-coupled sec-ondary antibodies.

RESULTSCharacterization of DdGPHR. DdGPHR (DDB_G0283855), amember of the orphan vertebrate Gpr89 group, is highly con-served across eukaryotes. Its closest homologs in BLAST searchesare an Acanthamoeba castellanii protein (1e-125; 41% identity)and Golgi apparatus pH regulator-like isoform 1 from the marinemammal Trichechus manatus latirostris (3e-119; 41% identity).The identity with the mouse protein (3e-114) is also 41%, and32% with the Arabidopsis thaliana receptors GTG1 and GTG2(7e-85 and 2e-82). A phylogenetic analysis also showed that DdG-PHR is evolutionarily more closely related to the animal proteinsthan to the plant proteins (Fig. 1A). The DdGPHR gene is locatedon chromosome 4 and harbors two small introns. It encodes a547-amino-acid protein with a predicted molecular mass of64,244 Da containing eight predicted transmembrane domains, aDUF3735 domain, and an ABA_GPCR (abscisic acid G protein-coupled receptor) domain (Fig. 1B). Similar domain structuresare predicted for all the homologs. The mRNA is present through-out all stages of development. The levels are lowest during thegrowth phase, and they increase strongly during aggregation, witha peak at 8 to 12 h after the start of starvation on phosphate agarplates (early aggregation and aggregation). Then, they fall and riseagain during late development, when slugs are formed and culmi-nation occurs (the 18-h time point and onward) (Fig. 1C).

Since the antibodies we had generated against DdGPHR did

not react with the protein in Western blots or immunofluores-cence analysis, we could not assess its abundance and localizationin D. discoideum. To localize DdGPHR in cells, we ectopicallyexpressed the protein as a GFP-tagged fusion protein in AX2 cells.GFP was fused to the C terminus of GPHR, and expression wasunder the control of the actin 15 promoter, which is activethroughout growth and development. The fusion protein is func-tionally active, as described for the rescue experiments below.DdGPHR-GFP staining was observed around the nucleus and ona network throughout the cell (Fig. 1D). This network was iden-tified in coimmunofluorescence studies as the ER because it over-lapped with the ER marker PDI (13). At the nucleus, GPHR-GFPoverlapped with interaptin, which is located at the nuclear enve-lope (23). The ER network emanates from the outer nuclear mem-brane and extends throughout the cytosol. GPHR-GFP also colo-calized with the Golgi apparatus marker comitin, detected byMAb 190-340 (24). Comitin strongly stained the Golgi mem-branes in the vicinity of the nucleus and overlapped with the mi-crotubule organizing center, from which microtubules labeled byMAb YL1/2 (19) originated and which was stained with monoclo-nal antibodies recognizing centrosomal protein CP250 (31). ThePDI-specific antibodies did not label the GPHR-GFP-decoratedmembranes associated with Golgi membranes (Fig. 1D). Stainingfor CAP (cyclase-associated protein), an actin cytoskeleton-asso-ciated protein, was used to reveal the cell cortex (20).

Characterization of DdGPHR-deficient cells. The singleDdGPHR gene in strain AX2 was inactivated using a gene replace-ment vector. Disruption of the gene in the transformants was an-alyzed and confirmed by PCR using primers located outside thevector sequences (Fig. 2A). A GPHR-deficient clone (GPHR�)was isolated and characterized, with focus on the analysis ofgrowth and development and on processes that might be impairedby changes in membrane trafficking based on the presence ofGPHR on ER and Golgi membranes and the phenotype describedfor the mouse ortholog. DdGPHR-deficient cells had an appear-ance similar to that of AX2 cells, but they were significantly smallerwhen grown on a plastic surface (9.91 � 1.40 �m in diameter forGPHR� versus �11.44 � 1.77 �m in diameter for AX2; threeindependent experiments with more than 200 cells analyzed perexperiment and strain; P value, 0.018). A difference was also ob-served for cells grown on a lawn of K. aerogenes, where cells are ingeneral smaller. We found cell sizes of 8.80 � 1.08 �m for GPHR�

and 9.92 � 1.82 for AX2. In this case, the difference was not sig-nificant (P value, 0.23). Mutant and wild-type cells were mainlymono- and dinucleated. Growth in axenic medium in petri dishes,which is also a measure of pinocytosis activity, was slightly slowerthan that of the parental AX2 strain. Growth was not impaired inthe presence of NaCl (30 mM) and sorbitol (115 mM), whichindicates that stress resistance is normal. Cells did not grow inshaking suspension. On a lawn of K. aerogenes, growth was notsignificantly altered; however, we noted differences with regard toplaque formation. At the same time point after plating, AX2, butnot the GPHR� strain, had formed multicellular structures in thecenters of plaques (Fig. 2B). When grown on a suspension of E. coliB/r, the mutant cells had an extended lag phase; however, oncegrowth started, they attained a duplication time similar to that ofAX2 (�3 h for AX2 and �3.5 h for GPHR� cells), consumed allthe bacteria, and formed aggregates.

To assay the phagocytic capability, we performed yeast phago-cytosis assays and quantified the ingested yeast particles after 15,

D. discoideum GPHR

January 2015 Volume 14 Number 1 ec.asm.org 43Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

FIG 1 Evolutionary tree, GPHR domain structure, transcript accumulation during development, and subcellular distribution of GPHR-GFP. (A) Evolutionary tree forselected GPHRs from fungi, plants, amoebozoa, and animals. A CLUSTALX alignment of GPHR full-length protein sequences from different organisms was used tocreate a bootstrap neighbor-joining (N-J) tree with the TreeView program. The tree was rooted on the human serotonin receptor (NP_000515 Hs). Bootstrap values areprovided at the node of each branch. The scale bar indicates amino acid substitutions per site. The different clades are color coded in the tree. GenBank accession numbersare provided on the right of the tree. Hs, Homo sapiens; Np, Neofusicoccum parvum; Nc, Neurospora crassa; Mo, Magnaporthe oryzae; Sl, Solanum lycopersicum; At,Arabidopsis thaliana; Os, Oryza sativa; Zm, Zea mays; Ac, Acanthamoeba castellanii; Dd, Dictyostelium discoideum; Dp, Dictyostelium purpureum; Dm, Drosophilamelanogaster; Dr, Danio rerio; Gg, Gallus gallus; Ce, Caenorhabditis elegans. (B) Conserved domains were identified using the SMART (Simple ModularArchitecture Research Tool) database (http://smart.embl.de/) and a search at the Conserved Domain Database at NCBI (52, 53). The black bars representtransmembrane domains, and the positions of the first amino acids (aa) are indicated. DUF, domain of unknown function. The ABA_GPCR domain has beenidentified in the Arabidopsis homolog. (C) Transcript accumulation during development. RNA was isolated from AX2 undergoing starvation on phosphate agar platesat the indicated time points, converted into cDNA, and used for qRT-PCR. For quantification, an annexin 7 plasmid was used as an internal standard. Relative expressionlevels are given. The amount detected at 0 h was arbitrarily set to 1. (D) Distribution of GPHR-GFP, followed by immunofluorescence analysis. Cells were fixed withmethanol and labeled with monoclonal antibodies specific for the actin cytoskeleton-associated protein CAP, the Golgi apparatus marker comitin, the centrosomalprotein CP250, the nuclear envelope protein interaptin, the �-tubulin-specific antibody YL1/2, and the ER protein PDI. Appropriate secondary antibodies were used.Nuclei were stained with DAPI (4=,6-diamidino-2-phenylindole). Scale bars, 5 �m.

44 ec.asm.org January 2015 Volume 14 Number 1Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

D. discoideum GPHR

January 2015 Volume 14 Number 1 ec.asm.org 45Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

30, and 45 min of incubation in the presence of yeast. We foundthat the mutant had ingested fewer yeast particles at each timepoint and during incubation with different concentrations ofyeast. In the presence of 5 � 107 yeast particles per 1.4 � 106 cells,only �17% of AX2 cells did not contain yeast particles at the45-min time point, whereas in the case of GPHR�, �72% of thecells had not ingested yeast, indicating a severe phagocytosis defect(Table 2).

Analysis of intracellular-membrane compartments and ofendoplasmic reticulum dynamics. Because of the presence ofGPHR-GFP on the ER, we probed the integrity of intracellularmembranes at the immunofluorescence level using markers forthe nuclear membrane (interaptin), the centrosome (CP250), theER (PDI), the Golgi apparatus (comitin), the endolysosomal sys-tem and the contractile vacuole (vacuolar ATPase subunit A[vatA]), and mitochondria (porin). We did not observe differ-ences in the localization and morphological appearance of theseorganelles at the microscopic level, except for mitochondria. InAX2, they were present as well-defined circular structures afterstaining both with the porin-specific MAb 70-11-1 and with Mi-toTracker; in GPHR�, the mitochondria had a more diffuse ap-pearance with both stains (Fig. 2C and D).

GPHR in mammalian cells is a Golgi apparatus pH regulatorthat functions as a counter-ion transport channel in the acidifica-tion of the Golgi apparatus. The pH of the ER resembles that of thecytosol. It has been reported that the ER membrane is highly per-meable to protons and that the pH of the lumen is susceptible toalterations of the pH in the cytosol (32). We therefore expressedcalpHluorin in AX2 and GPHR� in order to assess the pH of theER in resting cells and to follow the response to pH changes inliving cells. CalpHluorin is a fusion protein composed of calreti-culin and ratiometric pHluorin, a pH-sensitive GFP (15). Cal-pHluorin was distributed in an ER-like pattern in both strains,confirming the unaltered ER morphology in the mutant (Fig. 3B).We first performed excitation scans between 340 nm and 490 nmwith emission set at 510 nm using the calpHluorin-expressingcells. No difference between the wild type and the mutant wasobserved for the resting-stage pH. We then manipulated the pHby adding propionic acid and ammonium chloride. Both sub-stances are freely permeable and lead to acidification and alkalin-ization of the cytosol, respectively. Propionic acid traverses the

membrane, dissociates in the cytosol into H and propionate, andlowers the pH (16, 33). The measurements revealed characteristicfluorescence changes depending on the pH in similar manners inwild-type and mutant cells (data not shown). We further per-formed ratiometric analyses at different pHs, determining the ra-tio by dual excitation at 410 and 470 nm, which normalizes theexpression levels of the fluorescent proteins, and obtained similarratios (Fig. 3A). We conclude that the pH in the ER is regulated inAX2 and the mutant in similar manners.

When we probed the response of the ER to changes in thecytosolic pH, analyzing the cells by live-cell microscopy, we ob-served that upon addition of propionic acid the ER membranes inthe cytosol collapsed into large patches in the cell periphery. ForGPHR� cells, the collapse of the structures was apparent earlierthan in AX2 cells (Fig. 3B). When the pH was neutralized by theaddition of ammonium chloride, the patches were disassembled,and normal ER structures appeared. The time courses of disas-sembly and formation of normal structures were comparable inthe two strains (data not shown). Similar results were obtained forAX2 and GPHR�, which were fixed after the treatments andstained with PDI-specific antibodies to reveal the morphology ofthe ER (Fig. 3B, bottom). It appears that the distribution of the ERin the GPHR� cells is more sensitive to acidification than in AX2cells.

Protein modifications and secretory processes involving theendoplasmic reticulum. The ER is a biosynthetic organelle. Ingeneral, secreted proteins are synthesized as precursors into theER, where they are proteolytically processed, folded, N-glycosy-lated, further modified, and then passed on to the Golgi apparatusfor additional modifications. To assess the capacity of the mutantGPHR� to carry out ER-associated modifications, we studied theposttranslational modification of the csA protein. csA is an �80-kDa glycoprotein involved in the formation of EDTA-stable cell-cell adhesions during the aggregation stage of development. It issynthesized as a 53-kDa protein; modified in the ER and the Golgiapparatus by N- and O-glycosylation, respectively; and convertedfrom a 68-kDa intermediary product into the mature �80-kDaprotein, which is held in the plasma membrane by a phospholipidanchor (29, 34, 35). We used MAb 33-294 directed against theprotein moiety of csA to study the protein in Western blots. InAX2 and in mutant cells, csA was detected when the cells formed

FIG 2 Generation and characterization of GPHR-deficient cells. (A) Strategy of the knockout vector and PCR analysis of AX2 and mutant DNA using theindicated primers. (a) PCR product obtained with primer pair loxp-3=-for and gpcr-3=-rev. (b) Size (100-bp) ladder. (B) Plaque morphology. AX2 and GPHR�

cells were spread onto SM agar plates with K. aerogenes. Photographs were taken at the same time after plating. Scale bars, 1,000 �m. (C) Immunofluorescence analysisof AX2 and GPHR� cells. Strains grown on petri dishes in axenic medium were used for the analysis. Fixation was with ice-cold methanol. Monoclonal antibodiesrecognizing proteins specific for distinct cellular compartments (see Results) were used. Nuclei were stained with DAPI. Scale bar, 10 �m. (D) Mitochondria were alsostained with MitoTracker. The cell cortex was detected by MAb act1.

TABLE 2 Yeast phagocytosis

Incubation time (min)

% cells with indicated no. of yeast particlesa

AX2 GPHR�

0 1 2 �3 0 1 2 �3

15 49 23 14 14 90 8 2 030 30 16 20 35 82 15 2 145 18 18 17 45 75 18 5 4a 1.4 � 106 cells were incubated with 5 � 107 yeast particles.

Deckstein et al.

46 ec.asm.org January 2015 Volume 14 Number 1Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

FIG 3 Response of the ER to pH changes. (A) Ratiometric analysis. CalpHluorin was expressed in AX2 and GPHR� cells. They were placed in a buffer containingpropionic acid or NH4Cl and analyzed in a plate fluorimeter by dual excitation at 410 nm and 470 nm with an emission filter set at 510 nm. The 410-nm/470-nm ratiosare shown. The error bars indicate standard deviations. (B) In vivo imaging of calpHluorin-expressing AX2 and GPHR� cells under various pH conditions, which allowsthe dynamics of the ER to be followed. Addition of propionic acid (PA) led to clustering of the ER in GPHR� and AX2 cells. GPHR� cells responded with clustering ofthe ER at 20 mM propionic acid, whereas for AX2 cells, this effect was seen at 30 mM propionic acid. The same set of cells was followed over time. Fluorescence (left) andbright-field (right) images are shown. Scale bars, 10 �m. (Bottom) Cells were treated with 20 mM propionic acid and fixed with methanol. The ER was stained withPDI-specific antibodies.

January 2015 Volume 14 Number 1 ec.asm.org 47Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

aggregates and migrated as an �80-kDa protein in SDS-polyacryl-amide gels, indicating that its synthesis and processing were notnoticeably altered (Fig. 4A). Antibodies detecting the N- and O-glycosylated csA molecule (MAb 123-353 and MAb 24-210, re-spectively) also reacted with the mature protein. The faint bandbelow the 80-kDa csA is an incompletely glycosylated form of theprotein that can be frequently observed (36). Two more posttrans-lationally modified proteins, D2 (56 kDa) and the crystal proteinCP (69 kDa), were included in our analysis (MAbs 83-418 and130-80, respectively). They are present in growth phase cells andincrease in amount during development, when they are detectedin crystalline inclusion bodies, hence the name. Both proteins aresynthesized as precursors and secreted into vesicles that are sur-rounded by an ER membrane (25). We observed unaltered sizesand developmental expression patterns of the proteins, indicatingcorrect synthesis and processing in the GPHR� strain (Fig. 4A).Also, crystals were detected by immunofluorescence analysis inaggregation stage cells (Fig. 4B). From the results, we concludethat protein transport through the endomembrane system is notdisturbed and that glycosylation is not impaired.

We further tested the secretion of �-mannosidase. �-Manno-sidase is a lysosomal hydrolase produced during growth and thefirst hours of development. The protein is posttranslationallymodified on its way through the ER and Golgi apparatus to the latelysosomes before it is secreted (37). During growth, mannosidaseactivity is mainly found inside the cell, and very little of the en-zyme is secreted. This changes during development, and theamounts of the enzyme secreted into the supernatant increasegreatly. When we tested the mannosidase activity, we found thatAX2, GPHR�, and GPHR� expressing GPHR-GFP (rescue) cellsexhibited similar total mannosidase activities during growth anddevelopment; however, their abilities to secrete the enzyme dif-fered. For AX2 cells, �73% of mannosidase activity was present inthe supernatant at the 6-h time point of development, whereasGPHR� cells secreted only 42% of the enzyme. Expression ofGPHR-GFP in the GPHR� strain corrected the defect (Fig. 4C andTable 3).

Motile behavior. Cell motility is a characteristic feature of Dic-tyostelium amoebae during all phases of growth and development.GPHR� cells exhibited a severe defect. We tested chemotactic mo-tility of aggregation stage cells and found a significant alteration oftheir migratory behavior. The speed was reduced from 14.22 � 2.0�m/min for AX2 amoebae to 4.13 � 1.49 �m/min for GPHRamoebae. Furthermore, the mutant cells changed direction morefrequently and were less persistent (Table 4).

Developmental analysis. D. discoideum multicellular develop-ment is initiated upon starvation and is controlled through extra-cellular signaling molecules that include cyclic AMP (cAMP). Toevaluate possible roles of GPHR during development, we followedaggregation by starving cells in Soerensen phosphate buffer inshaken suspension and on phosphate-buffered agar as a solid sub-stratum. In suspension, cells develop until the aggregation stageand form tight aggregates; on a solid substratum, they can un-dergo the complete developmental cycle, which results in the for-mation of fruiting bodies composed of a stalk and a spore head.We monitored development in suspension by following the de-crease in the optical density at 600 nm (OD600) due to aggregateformation. GPHR� cells and AX2 cells formed aggregates in sim-ilar manners (Fig. 4D). The csA protein, which mediates cell-cell

contacts in the aggregates, was detected in a timely manner in bothstrains (38) (Fig. 4A).

When developed on phosphate agar plates, the GPHR� cellsaggregated normally; however, during later stages, abnormalitieswere noted. Many of the slugs did not have the typical cigar-likeshape with a smooth and even surface; instead, they often had aknobby appearance and were of uneven thickness and irregularshape (Fig. 5A).

In order to analyze pattern formation during development, weused the vital stain neutral red (Fig. 5B). Neutral-red-stained tipswere observed in aggregates of AX2 and GPHR�. In GPHR� ag-gregates, a significant number of neutral-red-stained cells werepresent throughout the aggregate. In AX2 slugs, the staining wasretained at the tip, where the prestalk cells reside, and in the backof the slug, as reported previously (39). Neutral-red-positive cells,which correspond to anterior-like cells (ALC), were also scatteredthroughout the prespore region. In GPHR� slugs, neutral-red-stained cells were not strongly enriched at the tip but were presentthroughout the slug. Toward the rear of the slug, they were lessprominent (Fig. 5B). We also noted that mutant multicellularstructures were smaller than those of AX2 (Fig. 5A). To confirmthe reduction in size, we determined the numbers that wereformed from identical numbers of cells initially plated. We foundthat for AX2, a defined area contained �6 slugs or aggregates,whereas for GPHR�, we counted �22 multicellular structures in asimilar-size area. The mutant slugs developed into small fruitingbodies, and the head contained viable spores. Stalk cells and sporeswere fully differentiated, as detected by calcofluor white staining(Fig. 5C). AX2 and GPHR� stalk cells were large and had irregularshapes, while spores from AX2 had an elliptical shape and were ofrelatively uniform size. For GPHR� spores, we detected variousshapes from round to oval (Fig. 5C). Also, their sizes varied,and the majority of them were smaller than the spores of AX2(Fig. 5D).

Slugs are motile and migrate toward light. In phototaxis exper-iments, AX2 slugs migrated in a highly oriented fashion towardthe light source. Mutant slugs formed but migrated over shortdistances only and were less directed (Fig. 5E). The developmentaldefect was rescued by reexpression of DdGPHR-GFP (Fig. 5A)and by mixing mutant and wild-type cells in a ratio of 70 to 30(data not shown). When we mixed AX2 cells expressing a GFP-tagged protein (LimD) (11) with GPHR� cells, multicellularstructures that contained both types of cells were formed. Also, theGFP-positive cells were distributed equally throughout the slugand did not show particular enrichment in a special area (data notshown).

To analyze development further, we monitored the expressionof developmental markers at the mRNA level by quantitative real-time PCR (Fig. 6). Development was on phosphate-buffered agar,and RNA was isolated at the indicated time points. For early de-velopmental markers, we studied the mRNA levels of cadA, carA,and csA (38, 40, 41). cadA is a cadherin-like cell adhesion mole-cule that is responsible for the formation of EDTA-sensitive celladhesions, carA is the cAMP receptor that senses cAMP signalsduring early aggregation, and csA mediates EDTA-stable adhe-sions. The highest mRNA levels for cadA, carA, and csA werereached in GPHR� at the 12.5-h time point, which corresponds tothe aggregation stage. The levels were higher than those in AX2 atthis time point. Maximum levels of carA and csA transcripts werereached at 16.5 h in AX2. Markers specific for later developmental

Deckstein et al.

48 ec.asm.org January 2015 Volume 14 Number 1Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

FIG 4 Posttranslational protein processing and modification of developmentally regulated proteins and secretion of mannosidase. (A) Protein modification ofdevelopmentally regulated proteins. Cells were starved in Soerensen phosphate buffer in shaken suspension, and samples were taken for Western blot analysis at theindicated time points (in hours). The blot was probed with monoclonal antibodies recognizing the 80-kDa csA protein (MAb 33-294, which is directed against theprotein moiety; MAb 123-353, which detects N-glycosylated residues; and MAb 24-210, which detects O-glycosylated residues on the csA molecule), the 69-kDa CP(MAb 130-80), and the 56-kDa D2 protein (MAb 83-418). cap32 (MAb 188-19) was used as a loading control. The cap32 blot for MAb 33-294 staining is shown. (B)Crystal formation in aggregation-competent AX2 and GPHR� cells as detected with MAb 83-418. Scale bars, 5 �m. (C) Bar graph showing mannosidase secretionfor AX2, GPHR�, and GPHR� expressing GPHR-GFP (rescue). Cells were starved in Soerensen phosphate buffer, pH 6.0, and at the indicated time points, the

D. discoideum GPHR

January 2015 Volume 14 Number 1 ec.asm.org 49Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

stages showed a different pattern. The mRNAs for ecmA and pspA,prestalk- and prespore-specific genes that encode structural com-ponents of the stalk and of spores (42), respectively, showed max-imum accumulation at 12.5 h in AX2, while in GPHR�, the levelsreached a maximum at 16.5 h. Maximum levels of ecmA werecomparable in both strains, whereas maximum pspA levels werelower in the mutant. The product of the ecmB gene is a marker forstalk cell differentiation and has a structural role in the stalk tube(39). The corresponding transcript levels showed similar patternsof accumulation in both strains; however, the amounts werestrongly reduced in GPHR�. Dramatically lower transcript levelswere noted for the late developmental marker spiA in GPHR-deficient cells (Fig. 6; note the logarithmic scale of the y axis). spiAis a marker of terminal differentiation. It is a spore coat protein,and the gene is expressed concomitant with the encapsulation ofspores (43). Taken together, the pattern of developmental-geneexpression, in particular of genes that are expressed at the laterdevelopmental stages, is strongly disturbed in the mutant, whichmay lead to the morphological alterations.

DISCUSSION

Dictyostelium GPHR is primarily an ER-associated protein withsome accumulation at the Golgi apparatus. This parallels the lo-calization of the GPHR of Drosophila, with which it shares a highhomology. Since our results were obtained using GFP-taggedGPHR that was expressed under the control of the actin 15 pro-moter, we cannot exclude the possibility that the distribution ofthe endogenous protein might differ. In the Drosophila studies, ahemagglutinin (HA)-tagged protein was overexpressed and usedfor localization studies (5). GPHRs have been well studied in onlya few organisms so far, and functions ranging from abscisic acidreceptor to Golgi apparatus pH regulator have been identified forplants and mammalian cells, respectively (3, 4). Ablation of theDrosophila ortholog disturbed the ER and Golgi apparatus orga-nization and affected growth (5). In D. discoideum, we observedchanges at the growth phase and during late development.

The altered ER dynamics in response to acidification were re-markable. The peripheral ER of cells is highly dynamic and under-goes constant rearrangement. Furthermore, ER tubules are re-tracted toward the cell center and extend outward again. Thismechanism ensures correct distribution of the peripheral ER. Itinvolves the cytoskeleton—in yeast, the actin cytoskeleton and atype V myosin, and in animal cells, mainly the microtubule system

(44). CalpHluorin expression allowed us to follow the ER dynam-ics in response to pH changes in vivo. Acidification by propionicacid caused the formation of ER patches in the cell periphery. InGPHR�, this response occurred at a concentration as low as 20mM, whereas for AX2, 30 mM propionic acid was needed. Theregulation of ER dynamics in D. discoideum has not been underextensive investigation. Involvement of the class I myosin MyoKin the delivery of ER membranes to the early phagosome has beenreported, and recruitment of calnexin-positive ER to Legionellapneumophila-containing vacuoles (45, 46). From the publisheddata, it is reasonable to assume that the ER associates with the actinand the microtubule cytoskeletons in D. discoideum. For the actincytoskeleton, pH-sensitive regulators have been described,such as �-actinin, hisactophilin, and cofilin, which have thecapacity to influence the cytoskeletal reorganization in a pH-sensitive manner, and thereby, they may also influence the ERdynamics (47–49).

Posttranscriptional processing and modifications of proteinswere probed for the plasma membrane protein csA and for D2 andCP, which are contained in membrane-surrounded structures inthe cytosol. The modifications and trafficking occurred in a timelymanner during development in GPHR�. These findings, togetherwith similar responses of the ER pH sensor calpHluorin to pHchanges in AX2 and GPHR�, may be an indication that pH regu-lation in the ER is ensured by additional proteins, as has beensuggested for Drosophila. Multiple assurance of pH homeostasisseems to be essential for a free-living unicellular organism like D.discoideum, which in its natural habitat is subjected to frequentenvironmental changes, such as changing pH and osmotic condi-tions.

In contrast, the secretion of mannosidase was impaired in themutant. In AX2, the majority of the protein was secreted duringdevelopment, reaching more than 70% of the total enzyme activ-ity, whereas in GPHR�, only about 40% of the enzyme activity wassecreted. Differences between the wild type and mutant were alsonoted during late development. GPHR� developed in a timelymanner, but the multicellular structures were smaller and theslugs and stalks had aberrant shapes. The slugs were of uneventhickness, and the stalks were knobby. For the fruiting bodies, wenoted a reduction in size and variability with regard to stalk shapeand length. We presume that this is due to the deranged expres-sion pattern of developmental marker proteins, which may not

�-mannosidase activity was determined. �-Mannosidase secretion and total �-mannosidase activity are shown. The �-mannosidase activity was determined inthe medium and in the cell pellet at the indicated time points after the beginning of starvation. The results represent the means of three (AX2-GPHR�) and two(AX2-rescue) experiments. The error bars indicate standard deviations. (D) Cell-cell adhesion during starvation in suspension culture in AX2 and GPHR�. Theoptical density of the cell suspensions was determined at 600 nm at the indicated time points. Aggregation was measured as a decrease in the OD600. The OD600

at the start of the experiment was set to 100%.

TABLE 3 Mannosidase secretion of AX2 and GPHR� and AX2 and GPHR� expressing GPHR-GFP (GPHR� rescue)a

Strain

% mannosidase secreted at h: Total mannosidase activity (�mol/ml/107 cells) at h:

0 2 4 6 0 2 4 6

AX2 9.5 63.9 73.4 74.5 0.88 0.97 1.20 1.30GPHR� 9.9 20 32.5 42 1.41 1.46 1.31 1.34AX2 12.75 50.35 60.41 66.93 1.40 1.47 1.73 1.95GPHR– rescue 7.29 41.52 54.33 66.63 1.88 2.22 2.27 2.35a The results represent the means of three (AX2 and GPHR–) and two (AX2 and GHPR– rescue) experiments. Standard deviations are indicated in the graph in Fig. 4C.

Deckstein et al.

50 ec.asm.org January 2015 Volume 14 Number 1Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

allow timely synthesis of essential proteins for differentiation andmorphogenesis. A role in development is also suggested by theexpression pattern of the GPHR gene, where we noted two max-ima of expression, one during aggregation and a further one in latedevelopment.

The slugs of the GPHR� strain resemble those of strains carry-ing a mutation in G�1 (Q206L), converting it to a constitutivelyactive molecule. G�1 was proposed to be involved in signalingpathways that play an essential role in regulating multicellulardevelopment by controlling prestalk morphogenesis (50).Whether G�1 and GPHR act in the same pathway is not known,and how GPHR regulates expression of developmentally regulatedgenes is unclear at present. Regulation by the ER at the level oftranscription occurs in the unfolded-protein response (UPR).With the UPR, a network of signaling pathways is described thatmaintains the protein-folding capacity of the ER. It is initiated byproteins in the ER membrane that detect incompletely folded orunfolded proteins and activate a transcriptional program thatleads to correction of the defect. These sensors are normally pres-ent in the ER. Upon stress, they are cleaved and released into the

TABLE 4 Analysis of cell motilitya

StrainNo. ofcells

Speed(�m/min)

Direction change(degrees)

Persistence(�m/min- degree)

AX2 6 12.91 � 0.835 13.80 � 4.48 5.647 � 1.1610 13.667 � 2.86 15.287 � 9.326 5.505 � 2.516 16.51 � 2.45 15.43 � 2.258 5.338 � 0.847 13.829 � 1.88 14.19 � 3.589 5.54 � 1.8129 14.229 � 2.0 14.676 � 4.91 5.50 � 1.58

GPHR� 6 4.655 � 2.669 32.47 � 17.52 1.645 � 1.1593 4.21 � 1.09 33.144 � 16.039 1.365 � 0.7854 3.725 � 0.42 30.096 � 16.127 1.358 � 0.3817 3.937 � 1.8 27.585 � 17.3 1.40 � 0.74820 4.13 � 1.49 30.82 � 16.74 1.442 � 0.768

a Cells were starved for 5 h and then used for the analysis. The data were obtained fromfour individual experiments. The differences in speed, direction change, and persistencewere significant (P 0.0001). The combined results of all experiments are in boldface.The experiments were carried out together with the analysis of sec7� mutant cells, andhence, the data for AX2 were the same as in this analysis (12).

FIG 5 Analysis of late developmental stages. (A) Slugs and fruiting bodies of AX2, GPHR�, and GPHR� expressing GPHR-GFP (rescue) are shown. Starvation was onphosphate-buffered agar. The photographs were taken at the same time after plating to allow correct comparison of development. (B) Neutral-red-stained aggregates andslugs. (C) Stalks and spores stained with calcofluor white. (D) Distribution of pore sizes. More than 200 spores were evaluated. (E) Phototactic migration is defective inGPHR�. Although GPHR� slugs were formed, they traveled only over very short distances. The position of the light source is indicated.

D. discoideum GPHR

January 2015 Volume 14 Number 1 ec.asm.org 51Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

FIG 6 Transcript levels of late developmental markers as analyzed by qRT-PCR. Starvation was on phosphate-buffered agar plates (5 � 107 cells/plate). Cellswere harvested at the indicated time points. Evaluation of the developmental stage was by visual inspection. The 12.5-h time points corresponded to theaggregation stage, and at 16.5 h, slugs had formed and culmination had started. RNA was isolated and used for qRT-PCR. Relative amounts are given. Primersspecific for the indicated markers are listed in Table 1. Note the logarithmic scale for spiA expression.

Deckstein et al.

52 ec.asm.org January 2015 Volume 14 Number 1Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

cytosol. The cytosolic portion migrates into the nucleus and func-tions as a transcriptional regulator (51). A role in this responsesystem could be an intriguing possibility for GPHR.

ACKNOWLEDGMENTS

This work was supported by the DFG and SFB 670. T.Y.R. had supportfrom the Professorinnen Programm of the University of Cologne.

We thank C. S. Clemen for help with fluorescence spectroscopy, S.Neumann and laboratory 14 members for help with figures, B. Gaßen forproviding monoclonal antibodies, and dictybase for providing reagents.

REFERENCES1. Eichinger L, Pachebat JA, Glöckner G, Rajandream MA, Sucgang R,

Berriman M, Song J, Olsen R, Szafranski K, Xu Q, Tunggal B, Kum-merfeld S, Madera M, Konfortov BA, Rivero F, Bankier AT, LehmannR, Hamlin N, Davies R, Gaudet P, Fey P, Pilcher K, Chen G, SaundersD, Sodergren E, Davis P, Kerhornou A, Nie X, Hall N, Anjard C,Hemphill L, Bason N, Farbrother P, Desany B, Just E, Morio T, Rost R,Churcher C, Cooper J, Haydock S, van Driessche N, Cronin A, Good-head I, Muzny D, Mourier T, Pain A, Lu M, Harper D, Lindsay R,Hauser H, James K, Quiles M, Madan Babu M, Saito T, Buchrieser C,Wardroper A, Felder M, Thangavelu M, Johnson D, Knights A,Loulseged H, Mungall K, Oliver K, Price C, Quail MA, Urushihara H,Hernandez J, Rabbinowitsch E, Steffen D, Sanders M, Ma J, Kohara Y,Sharp S, Simmonds M, Spiegler S, Tivey A, Sugano S, White B, WalkerD, Woodward J, Winckler T, Tanaka Y, Shaulsky G, Schleicher M,Weinstock G, Rosenthal A, Cox EC, Chisholm RL, Gibbs R, LoomisWF, Platzer M, Kay RR, Williams J, Dear PH, Noegel AA, Barrell B,Kuspa A. 2005. The genome of the social amoeba Dictyostelium discoi-deum. Nature 435:43–57. http://dx.doi.org/10.1038/nature03481.

2. Heidel AJ, Lawal HM, Felder M, Schilde C, Helps NR, Tunggal B, RiveroF, John U, Schleicher M, Eichinger L, Platzer M, Noegel AA, Schaap P,Glöckner G. 2011. Phylogeny-wide analysis of social amoeba genomes high-lights ancient origins for complex intercellular communication. Genome Res21:1882–1891. http://dx.doi.org/10.1101/gr.121137.111.

3. Pandey S, Nelson DC, Assmann SM. 2009. Two novel GPCR-type Gproteins are abscisic acid receptors in Arabidopsis. Cell 136:136 –148. http://dx.doi.org/10.1016/j.cell.2008.12.026.

4. Maeda Y, Ide T, Koike M, Uchiyama Y, Kinoshita T. 2008. GPHR is a novelanion channel critical for acidification and functions of the Golgi apparatus.Nat Cell Biol 10:1135–1145. http://dx.doi.org/10.1038/ncb1773.

5. Charroux B, Royet J. 2014. Mutations in the Drosophila ortholog of thevertebrate Golgi pH regulator (GPHR) protein disturb endoplasmic retic-ulum and Golgi organization and affect systemic growth. Biol Open 3:72–80. http://dx.doi.org/10.1242/bio.20137187.

6. Taddese B, Upton GJ, Bailey GR, Jordan SR, Abdulla NY, Reeves PJ,Reynolds CA. 2014. Do plants contain G protein-coupled receptors?Plant Physiol 164:287–307. http://dx.doi.org/10.1104/pp.113.228874.

7. Matsuda A, Suzuki Y, Honda G, Muramatsu S, Matsuzaki O, NaganoY, Doi T, Shimotohno K, Harada T, Nishida E, Hayashi H, Sugano S.2003. Large-scale identification and characterization of human genes thatactivate NF-B and MAPK signaling pathways. Oncogene 22:3307–3318.http://dx.doi.org/10.1038/sj.onc.1206406.

8. Tang T, Li L, Tang J, Li Y, Lin WY, Martin F, Grant D, Solloway M,Parker L, Ye W, Forrest W, Ghilardi N, Oravecz T, Platt KA, Rice DS,Hansen GM, Abuin A, Eberhart DE, Godowski P, Holt KH, Peterson A,Zambrowicz BP, de Sauvage FJ. 2010. A mouse knockout library forsecreted and transmembrane proteins. Nat Biotechnol 28:749 –755. http://dx.doi.org/10.1038/nbt.1644.

9. Tarutani M, Nakajima K, Uchida Y, Takaishi M, Goto-Inoue N, IkawaM, Setou M, Kinoshita T, Elias PM, Sano S, Maeda Y. 2012. GPHR-dependent functions of the Golgi apparatus are essential for the formationof lamellar granules and the skin barrier. J Investig Dermatol 132:2019 –2025. http://dx.doi.org/10.1038/jid.2012.100.

10. Harloff C, Gerisch G, Noegel AA. 1989. Selective elimination of thecontact site A protein of Dictyostelium discoideum by gene disruption.Genes Dev 3:2011–2019. http://dx.doi.org/10.1101/gad.3.12a.2011.

11. Khurana B, Khurana T, Khaire N, Noegel AA. 2002. Functions of LIMproteins in cell polarity and chemotactic motility. EMBO J 21:5331–5342.http://dx.doi.org/10.1093/emboj/cdf550.

12. Müller R, Herr C, Sukumaran SK, Omosigho NN, Plomann M, Riyahi

TY, Stumpf M, Swaminathan K, Tsangarides M, Yiannakou K, Blau-Wasser R, Gallinger C, Schleicher M, Kolanus W, Noegel AA. 2013. Thecytohesin paralog Sec7 of Dictyostelium discoideum is required for phago-cytosis and cell motility. Cell Commun Signal 11:54. http://dx.doi.org/10.1186/1478-811X-11-54.

13. Faix J, Kreppel L, Shaulsky G, Schleicher M, Kimmel AR. 2004. A rapidand efficient method to generate multiple gene disruptions in Dictyoste-lium discoideum using a single selectable marker and the Cre-loxP system.Nucleic Acids Res 32:e143. http://dx.doi.org/10.1093/nar/gnh136.

14. Gräf R, Daunderer C, Schliwa M. 2000. Dictyostelium DdCP224 is amicrotubule-associated protein and a permanent centrosomal residentinvolved in centrosome duplication. J Cell Sci 113:1747–1758.

15. Miesenböck G, De Angelis DA, Rothman JE. 1998. Visualizing secretionand synaptic transmission with pH-sensitive green fluorescent proteins.Nature 394:192–195. http://dx.doi.org/10.1038/28190.

16. Hanakam F, Albrecht R, Eckerskorn C, Matzner M, Gerisch G. 1996.Myristoylated and non-myristoylated forms of the pH sensor proteinhisactophilin II: intracellular shuttling to plasma membrane and nucleusmonitored in real time by a fusion with green fluorescent protein. EMBOJ 15:2935–2943.

17. Prabhu Y, Müller R, Anjard C, Noegel AA. 2007. GrlJ, a DictyosteliumGABAB-like receptor with roles in post-aggregation development. BMCDev Biol 7:44. http://dx.doi.org/10.1186/1471-213X-7-44.

18. Simpson PA, Spudich JA, Parham P. 1984. Monoclonal antibodies pre-pared against Dictyostelium actin: characterization and interactions withactin. J Cell Biol 99:287–295. http://dx.doi.org/10.1083/jcb.99.1.287.

19. Kilmartin JV, Wright B, Milstein C. 1982. Rat monoclonal antitubulinantibodies derived by using a new nonsecreting rat cell line. J Cell Biol93:576 –582. http://dx.doi.org/10.1083/jcb.93.3.576.

20. Gottwald U, Brokamp R, Karakesisoglou I, Schleicher M, Noegel AA.1996. Identification of a cyclase-associated protein (CAP) homologue inDictyostelium discoideum and characterization of its interaction with actin.Mol Biol Cell 7:261–272. http://dx.doi.org/10.1091/mbc.7.2.261.

21. Monnat J, Hacker U, Geissler H, Rauchenberger R, Neuhaus EM,Maniak M, Soldati T. 1997. Dictyostelium discoideum protein disulfideisomerase, an endoplasmic reticulum resident enzyme lacking a KDEL-type retrieval signal. FEBS Lett 418:357–362. http://dx.doi.org/10.1016/S0014-5793(97)01415-4.

22. Döring V, Veretout F, Albrecht R, Mühlbauer B, Schlatterer C, Schlei-cher M, Noegel AA. 1995. The in vivo role of annexin VII (synexin):characterization of an annexin VII-deficient Dictyostelium mutant indi-cates an involvement in Ca(2)-regulated processes. J Cell Sci 108:2065–2076.

23. Rivero F, Kuspa A, Brokamp R, Matzner M, Noegel AA. 1998. Inter-aptin, an actin-binding protein of the alpha-actinin superfamily in Dictyo-stelium discoideum, is developmentally and cAMP-regulated and associ-ates with intracellular membrane compartments. J Cell Biol 142:735–750.http://dx.doi.org/10.1083/jcb.142.3.735.

24. Weiner OH, Murphy J, Griffiths G, Schleicher M, Noegel AA. 1993. Theactin-binding protein comitin (p24) is a component of the Golgi appara-tus. J Cell Biol 123:23–34. http://dx.doi.org/10.1083/jcb.123.1.23.

25. Bomblies L, Biegelmann E, Döring V, Gerisch G, Krafft-Czepa H,Noegel AA, Schleicher M, Humbel BM. 1990. Membrane-enclosed crys-tals in Dictyostelium discoideum cells, consisting of developmentally regu-lated proteins with sequence similarities to known esterases. J Cell Biol110:669 – 679. http://dx.doi.org/10.1083/jcb.110.3.669.

26. Troll H, Malchow D, Müller-Taubenberger A, Humbel B, Lottspeich F,Ecke M, Gerisch G, Schmid A, Benz R. 1992. Purification, functionalcharacterization, and cDNA sequencing of mitochondrial porin from Dic-tyostelium discoideum. J Biol Chem 267:21072–21079.

27. Jenne N, Rauchenberger R, Hacker U, Kast T, Maniak M. 1998. Tar-geted gene disruption reveals a role for vacuolin B in the late endocyticpathway and exocytosis. J Cell Sci 111:61–70.

28. Noegel AA, Blau-Wasser R, Sultana H, Müller R, Israel L, Schleicher M,Patel H, Weijer CJ. 2004. The cyclase-associated protein CAP as regulatorof cell polarity and cAMP signaling in Dictyostelium. Mol Biol Cell 15:934 –945. http://dx.doi.org/10.1091/mbc.E03-05-0269.

29. Bertholdt G, Stadler J, Bozzaro S, Fichtner B, Gerisch G. 1985. Carbo-hydrate and other epitopes of the contact site A glycoprotein of Dictyoste-lium discoideum as characterized by monoclonal antibodies. Cell Differ16:187–202.

30. Haus U, Trommler P, Fisher PR, Hartmann H, Lottspeich F, NoegelAA, Schleicher M. 1993. The heat shock cognate protein from Dictyoste-

D. discoideum GPHR

January 2015 Volume 14 Number 1 ec.asm.org 53Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from

lium affects actin polymerization through interaction with the actin-binding protein cap32/34. EMBO J 12:3763–3771.

31. Blau-Wasser R, Euteneuer U, Xiong H, Gassen B, Schleicher M, NoegelAA. 2009. CP250, a novel acidic coiled-coil protein of the Dictyosteliumcentrosome, affects growth, chemotaxis, and the nuclear envelope. MolBiol Cell 20:4348 – 4361. http://dx.doi.org/10.1091/mbc.E09-03-0180.

32. Kim JH, Johannes L, Goud B, Antony C, Lingwood CA, Daneman R,Grinstein S. 1998. Noninvasive measurement of the pH of the endoplas-mic reticulum at rest and during calcium release. Proc Natl Acad Sci U S A95:2997–3002. http://dx.doi.org/10.1073/pnas.95.6.2997.

33. Williams GB, Elder EM, Sussman M. 1986. NH3 and propionate mod-ulate the morphological response of aggregation-competent Dictyosteliumdiscoideum to cAMP. Differentiation 31:92–99. http://dx.doi.org/10.1111/j.1432-0436.1986.tb00388.x.

34. Hohmann HP, Bozzaro S, Yoshida M, Merkl R, Gerisch G. 1987.Two-step glycosylation of the contact site A protein of Dictyostelium dis-coideum and transport of an incompletely glycosylated form to the cellsurface. J Biol Chem 262:16618 –16624.

35. Stadler J, Keenan TW, Bauer G, Gerisch G. 1989. The contact site Aglycoprotein of Dictyostelium discoideum carries a phospholipid anchor ofa novel type. EMBO J 8:371–377.

36. Faix J, Gerisch G, Noegel AA. 1990. Constitutive overexpression of thecontact site A glycoprotein enables growth-phase cells of Dictyosteliumdiscoideum to aggregate. EMBO J 9:2709 –2716.

37. Cardelli JA, Schatzle J, Bush JM, Richardson J, Ebert D, Freeze H. 1990.Biochemical and genetic analysis of the biosynthesis, sorting, and secre-tion of Dictyostelium lysosomal enzymes. Dev Genet 11:454 – 462. http://dx.doi.org/10.1002/dvg.1020110522.

38. Noegel A, Harloff C, Hirth P, Merkl R, Modersitzki M, Stadler J,Weinhart U, Westphal M, Gerisch G. 1985. Probing an adhesion mutantof Dictyostelium discoideum with cDNA clones and monoclonal antibodiesindicates a specific defect in the contact site A glycoprotein. EMBO J4:3805–3810.

39. Jermyn KA, Williams JG. 1991. An analysis of culmination in Dictyoste-lium using prestalk and stalk-specific cell autonomous markers. Develop-ment 111:779 –787.

40. Yang C, Brar SK, Desbarats L, Siu CH. 1997. Synthesis of the Ca(2)-dependent cell adhesion molecule DdCAD-1 is regulated by multiple fac-tors during Dictyostelium development. Differentiation 61:275–284. http://dx.doi.org/10.1046/j.1432-0436.1997.6150275.x.

41. Klein PS, Sun TJ, Saxe CL, III, Kimmel AR, Johnson RL, Devreotes PN.1988. A chemoattractant receptor controls development in Dictyosteliumdiscoideum. Science 241:1467–1472. http://dx.doi.org/10.1126/science.3047871.

42. Early A, McRobbie SJ, Duffy KT, Jermyn KA, Tilly R, Ceccarelli A,Williams JG. 1988. Structural and functional characterization of genesencoding Dictyostelium prestalk and prespore cell-specific proteins. DevGenet 9:383– 402. http://dx.doi.org/10.1002/dvg.1020090419.

43. Richardson DL, Loomis WF. 1992. Disruption of the sporulation-specificgene spiA in Dictyostelium discoideum leads to spore instability. Genes Dev6:1058 –1070. http://dx.doi.org/10.1101/gad.6.6.1058.

44. Du Y, Ferro-Novick S, Novick P. 2004. Dynamics and inheritance of theendoplasmic reticulum. J Cell Sci 117:2871–2878. http://dx.doi.org/10.1242/jcs.01286.

45. Dieckmann R, Guého A, Monroy R, Ruppert T, Bloomfield G, SoldatiT. 2012. The balance in the delivery of ER components and the vacuolarproton pump to the phagosome depends on myosin IK in Dictyostelium.Mol Cell Proteomics 11:886 –900. http://dx.doi.org/10.1074/mcp.M112.017608.

46. Weber S, Wagner M, Hilbi H. 2014. Live-cell imaging of phosphoinosi-tide dynamics and membrane architecture during Legionella infection.mBio 5:e00839-13. http://dx.doi.org/10.1128/mBio.00839-13.

47. Condeelis J, Vahey M. 1982. A calcium- and pH-regulated protein fromDictyostelium discoideum that cross-links actin filaments. J Cell Biol 94:466 – 471. http://dx.doi.org/10.1083/jcb.94.2.466.

48. Yonezawa N, Nishida E, Sakai H. 1985. pH control of actin polymeriza-tion by cofilin. J Biol Chem 260:14410 –14412.

49. Scheel J, Ziegelbauer K, Kupke T, Humbel BM, Noegel AA, Gerisch G,Schleicher M. 1989. Hisactophilin, a histidine-rich actin-binding proteinfrom Dictyostelium discoideum. J Biol Chem 264:2832–2839.

50. Dharmawardhane S, Cubitt AB, Clark AM, Firtel RA. 1994. Regulatoryrole of the G alpha 1 subunit in controlling cellular morphogenesis inDictyostelium. Development 120:3549 –3561.

51. Jäger R, Bertrand MJ, Gorman AM, Vandenabeele P, Samali A. 2012.The unfolded protein response at the crossroads of cellular life and deathduring endoplasmic reticulum stress. Biol Cell 104:259 –270. http://dx.doi.org/10.1111/boc.201100055.

52. Letunic I, Doerks T, Bork P. 2012. SMART 7: recent updates to theprotein domain annotation resource. Nucleic Acids Res 40:D302–D305.http://dx.doi.org/10.1093/nar/gkr931.

53. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK,DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, GwadzM, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F, Marchler GH,Mullokandov M, Omelchenko MV, Robertson CL, Song JS, ThankiN, Yamashita RA, Zhang D, Zhang N, Zheng C, Bryant SH. 2011.CDD: a Conserved Domain Database for the functional annotation ofproteins. Nucleic Acids Res 39:D225–D229. http://dx.doi.org/10.1093/nar/gkq1189.

Deckstein et al.

54 ec.asm.org January 2015 Volume 14 Number 1Eukaryotic Cell

on August 26, 2018 by guest

http://ec.asm.org/

Dow

nloaded from