The SdiA-Regulated Gene srgE Encodes a Type III Secreted Effector

Fabien Habyarimana,a,b Anice Sabag-Daigle,a,b Brian M. M. Ahmera,b,c

Department of Microbial Infection and Immunity,a Center for Microbial Interface Biology,b and Department of Microbiology,c The Ohio State University, Columbus, Ohio,USA

Salmonella enterica serovar Typhimurium is a food-borne pathogen that causes severe gastroenteritis. The ability of Salmonellato cause disease depends on two type III secretion systems (T3SSs) encoded in two distinct Salmonella pathogenicity islands, 1and 2 (SPI1 and SPI2, respectively). S. Typhimurium encodes a solo LuxR homolog, SdiA, which can detect the acyl-homo-serine lactones (AHLs) produced by other bacteria and upregulate the rck operon and the srgE gene. SrgE is predicted toencode a protein of 488 residues with a coiled-coil domain between residues 345 and 382. In silico studies have providedconflicting predictions as to whether SrgE is a T3SS substrate. Therefore, in this work, we tested the hypothesis that SrgE isa T3SS effector by two methods, a �-lactamase activity assay and a split green fluorescent protein (GFP) complementationassay. SrgE with �-lactamase fused to residue 40, 100, 150, or 300 was indeed expressed and translocated into host cells,but SrgE with �-lactamase fused to residue 400 or 488 was not expressed, suggesting interference by the coiled-coil do-main. Similarly, SrgE with GFP S11 fused to residue 300, but not to residue 488, was expressed and translocated into hostcells. With both systems, translocation into host cells was dependent upon SPI2. A phylogenetic analysis indicated thatsrgE is found only within Salmonella enterica subspecies. It is found sporadically within both typhoidal and nontyphoidal sero-vars, although the SrgE protein sequences found within typhoidal serovars tend to cluster separately from those found in non-typhoidal serovars, suggesting functional diversification.

The members of the Salmonella genus are rod-shaped, Gram-negative, facultative anaerobes. This genus is divided into two

species, S. enterica and S. bongori. Of the 2,600 different serovars inthe genus, more than 2,500 are within S. enterica, which itself issplit into six subspecies. The most clinically relevant subspecies,also called enterica, includes over 1,500 serovars (1). The diversi-fication of Salmonella from other Enterobacteriaceae is marked bythe horizontal acquisition of numerous Salmonella pathogenicityislands (SPI) (2–6). Each of the two most important pathogenicityislands of Salmonella enterica, SPI1 and SPI2, encode a distincttype III secretion system (T3SS) capable of translocating effectorproteins across eukaryotic membranes (7–9). Effector proteinsfunction to modulate host cell physiology and promote bacterialsurvival in host tissues.

In Salmonella enterica serovar Typhimurium, the effectors se-creted by T3SS1 are injected directly into intestinal enterocytes orM cells (10–20). Alteration of host cell signaling ensues, which canlead to the uptake of bacteria into the host cell via macropinocy-tosis (21, 22). This invasion event is also associated with the elic-itation of inflammation and fluid secretion in bovine ligated ilealloops, streptomycin-treated mice, mice with human flora, andgermfree mice (23–31). In contrast, T3SS2, which is encodedwithin SPI2, is maximally induced after Salmonella has enteredeukaryotic cells (32–36). These observations led to the hypothesesthat T3SS1 is needed to invade intestinal cells but is not requiredduring the subsequent phases of Salmonella pathogenesis and thatT3SS2 is expressed only when the bacteria reside within eukaryoticcells. However, the roles of the Salmonella T3SSs appear to bemore intertwined. For example, SPI1 mutants have a replicationdefect and are unable to form normal Salmonella-containing vac-uoles inside epithelial cells (37), and they have been recovered inhigh-throughput screens for genes involved in systemic survival(38, 39). Conversely, SPI2 genes have been shown to be involvedin the induction of the inflammatory response caused by serovar

Dublin in a bovine ligated ileal loop model and to contribute toinflammation in the streptomycin-treated and germfree mousemodels (23–25, 30, 40–43). Some Salmonella effector proteins areencoded within SPI1 and SPI2, while others are encoded else-where in the genome. Furthermore, other secretion systems havebeen reported in Salmonella, including the T6SS (44–47), outermembrane vesicles (48), and the flagellar T3SS (49–53).

The secretion of Salmonella effectors is temporally and spa-tially regulated (54–56). For instance, a cocktail of effector pro-teins is injected within a few minutes after the T3SS1 apparatus isactivated by host cell contact. While SPI2 gene expression isprimed before cellular invasion, there is a rapid transition fromSPI1 to SPI2 gene expression following Salmonella internalization.This differential gene expression is known to be induced by vacu-olar signals, such as pH and the concentration of Mg2�, Fe2�, orphosphate (54, 57–61). This transitional gene expression suggestsa functional cooperation between T3SS1 and T3SS2 effectors toenhance host cell manipulation by Salmonella.

Salmonella encodes a LuxR homolog, SdiA, which detects N-acyl homoserine lactones (AHLs) (62, 63). Salmonella does notencode an AHL synthase, so SdiA detects solely the AHLs pro-duced by other species of bacteria (64). SdiA is active in turtles,and it is likely that Aeromonas hydrophila is the AHL producer inthose animals (65). SdiA is also active in mice infected with Yer-sinia enterocolitica, another AHL producer (66). The advantage ofAHL detection to Salmonella is not clear. SdiA regulates seven

Received 25 February 2014 Accepted 8 April 2014

Published ahead of print 11 April 2014

Address correspondence to Brian M. M. Ahmer, ahmer.1@osu.edu.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.01602-14

June 2014 Volume 196 Number 12 Journal of Bacteriology p. 2301–2312 jb.asm.org 2301

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

genes located in two different loci: the rck locus (resistance tocomplement killing) and the srgE locus (sdiA-regulated gene E).The rck operon is borne by the virulence plasmid of S. Typhimu-rium and includes six genes (pefI, srgD, srgA, srgB, rck, and srgC)(64, 67). The srgE locus is a single-gene horizontal acquisition lo-cated in the chromosome at 33.6 centisomes (64). The srgE gene has aG�C content of 36%, which is much lower than the overall Salmo-nella G�C content of 53% (64). SrgE has a length of 488 aminoacid residues, a molecular mass of 55 kDa, and a pI of 6.8. Twocomputer algorithms have suggested that SrgE possesses a type 3secretion signal (68, 69), while three other algorithms do not sup-port this conclusion (70–72). SrgE also encodes a putative coiled-coil (CC) domain, located between residues 345 and 382. CC do-mains are known to mediate protein-protein interactions and area common feature of Salmonella T3SS substrates (73, 74). There-fore, we sought to test the hypothesis that SrgE is a member of theS. Typhimurium T3SS effector arsenal. In this study, we deter-mined that SrgE is indeed translocated into host cells via T3SS2.

MATERIALS AND METHODSBacterial strains and growth conditions. Salmonella enterica serovarTyphimurium strain ATCC 14028 and its isogenic derivatives used in thisstudy are listed in Table 1. Salmonella strains were routinely grown at 37°Cwith shaking in Luria Bertani (LB) broth (EMD Chemicals, Germany). Toinduce SPI1 gene expression, we grew Salmonella in LB broth with aera-tion overnight at 37°C and subcultured it for 4 h with aeration (75). Toinduce the expression of SPI2 genes, we grew Salmonella in minimal phos-phate carbon nitrogen with low phosphate (PCN-P) at pH 5.8, as previ-ously described (76, 77). The antibiotics kanamycin, chloramphenicol,and tetracycline were added to the media at concentrations of 50, 30, and20 �g/ml, respectively, as necessary (Sigma-Aldrich, St. Louis, MO). Ex-pression of proteins was induced by 1 mM isopropyl-�-D-1-thiogalacto-pyranoside (IPTG) and confirmed by Western blotting using anti-�-lac-tamase (anti-Bla) antibody at a 1/1,000 dilution (Santa CruzBiotechnology, Inc.) or antihistidine antibody at a 1/1,000 dilution forexpression of green fluorescent protein (GFP) S11 fusion proteins (Gen-Script, Atlanta, GA). Anti-DnaK antibody was used at a 1/10,000 dilution(Assay Design) to detect S. Typhimurium chaperone protein DnaK as aloading control.

Plasmid construction. To engineer C-terminal translational fusionsof the TEM-1 Bla to SrgE, plasmids pSipA-3�Flag-Bla, pFlag-Bla, andpGST-3�Flag-Bla kindly provided by Andreas Baumler were used (78).In these constructs, the sec-dependent signal sequence of Bla was deletedand replaced by 3�Flag. The S. Typhimurium ATCC 14028 srgE gene wasamplified to yield an srgE PCR product lacking the stop codon but flankedwith NdeI and XhoI restriction endonuclease sites (the BA1958 andBA1915 primers are listed in Table 2). This PCR product was cloned intopCR2.1-TOPO to yield plasmid pCR2.1-TOPO-SrgE. pGST-3�Flag-Blaand pTopo-SrgE plasmids were digested with NdeI and XhoI. The di-gested vector and insert were ligated to give rise to plasmid pSrgE–3�Flag-Bla (Table 1), encoding a full-length SrgE488 –3�Flag-Bla fusionprotein under the control of the trc promoter. Truncated versions ofsrgE were engineered in a similar manner using different reverse primers(BA2682, BA2066, BA2068, BA2069, and BA2488 are listed in Table 2) togenerate pSrgE300 –3�Flag-Bla, pSrgE150 –3�Flag-Bla, pSrgE100 –3�Flag-Bla, and pSrgE40 –3�Flag-Bla fusion constructs (Table 1). ThepSrgE–3�Flag-Bla, pSrgE300 –3�Flag-Bla, pSrgE150 –3�Flag-Bla,pSrgE100 –3�Flag-Bla, pSrgE40 –3�Flag-Bla, pSipA–3�Flag-Bla, andpFlag-Bla fusion constructs (Table 1) were introduced into the S. Typhi-murium wild-type strain ATCC 14028 and its isogenic derivative mutantstrains by electroporation. In a similar cloning approach, the C-terminalregion of SrgE was tagged with the small 11th strand of the GFP beta-barrel (GFP S11) from the pGFP S11 construct by using forward andreverse primers carrying NdeI and BamHI restriction sites (primers

BA1958 and BA2114) (Table 2), respectively, resulting in the pSrgE300-GFP S11 fusion construct. pGFP S11 and pGFP1–10 constructs were pur-chased from Sandia Biotech, Inc. (Albuquerque, NM) (79). The plasmidconstructs pGFP S11, pSrgE300-GFP S11 and pPipB2-GFP S11 (Table 1)were transformed into the S. Typhimurium wild-type strain and its iso-genic derivative mutant strains by electroporation.

Construction of mutant strains. Phage P22HTint (80) was used totransduce �(ssaG-ssaU)::kan from YD515 into ATCC 14028 andYD039, to generate YD516 and YD517, respectively. Phage P22HTintwas used to transduce flhD::Tn10 from strain AT351 into strain YD517to generate FH0137. The �(ssaG-ssaU)::kan allele in YD515 was con-structed using Wanner mutagenesis (81) with primers BA996 andBA1281 (Table 2).

Cell culture. RAW264.7 and J774.1 murine macrophage cell lines ob-tained from the ATCC were cultivated in Dulbecco’s modified Eagle’smedium (DMEM) (Gibco, Rockville, MD) containing 10% inactivatedfetal bovine serum (FBS) (Biowest, Miami, FL), 1% nonessential aminoacids, and 1 mM L-glutamine. The cells were seeded in 24-well cultureplates containing coverslips 18 h prior to infection. All cells were incu-bated at 37°C in the presence of 5% CO2.

TABLE 1 Strains and plasmids used in this study

Strain or plasmid DescriptionSource orreference

Salmonella Typhimuriumstrains

ATCC 14028 Wild-type Salmonella entericaserovar Typhimurium

ATCC

YD039 ATCC 14028 �(avrA-invH) 98YD516 ATCC 14028 �(ssaG-ssaU)::kan This studyYD517 ATCC 14028 �(avrA-invH)

�(ssaG-ssaU)::kanThis study

AT351 ATCC 14028 flhD::Tn10 99FH0137 ATCC 14028 �(avrA-invH)

�(ssaG-ssaU)::kan flhD::Tn10This study

PlasmidspFlag-Bla Flag-Bla expression vector 100pSipA–3�Flag-Bla SipA–3�Flag-Bla expression

vector100

pGST–3�Flag-Bla GST–3�Flag-Bla expressionvector

100

pSrgE488–3�Flag-Bla SrgE488–3�Flag-Bla expressionvector

This study

pSrgE300–3�Flag-Bla SrgE300–3�Flag-Bla expressionvector

This study

pSrgE150–3�Flag-Bla SrgE150–3�Flag-Bla expressionvector

This study

pSrgE100–3�Flag-Bla SrgE100–3�Flag-Bla expressionvector

This study

pSrgE40–3�Flag-Bla SrgE40–3�Flag-Bla expressionvector

This study

pGFP S11 GFP strand 11 plasmid Sandia Biotech,Inc.

pPipB2-GFP S11 PipB2-GFP S11 expressionvector

79

pSrgE488-GFP S11 SrgE488-GFP S11 expressionvector

This study

pSrgE300-GFP S11 SrgE300-GFP S11 expressionvector

This study

pGFP1–10 GFP strand 1–10 plasmid Sandia Biotech,Inc.

pCR2.1-TOPO Cloning vector; Kanr ColE1 Invitrogen

Habyarimana et al.

2302 jb.asm.org Journal of Bacteriology

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Generation of the J774.1 cell line in which GFP1–10 is stably ex-pressed. J774.1 cells were grown in 6-well culture plates at a concentrationof 105 cells/ml in DMEM containing 10% FBS overnight. The subconflu-ent culture of cells was transiently transfected using Lipofectamine trans-fection reagent (Invitrogen) in the presence of the mammalian expressionvector pGFP1–10 (Sandia Biotech, Inc.). After 18 h of transfection, 1/10-diluted transiently transfected J774.1 cells were grown in the presence of1.4 mg/ml of Geneticin (Sigma) for 15 days, and every 3 days, the mediumwas replaced by fresh medium containing 1.4 mg/ml Geneticin. After 15days of cell cultivation, J774.1 cell colonies were picked and screened forGFP complementation by fluorescence microscopy analysis in the pres-ence of purified GFP S11 protein.

�-Lactamase activity assays. To examine the translocation of SrgE-Bla fusion proteins into host cells, J774.1 and RAW264.7 murine macro-phage-like cells were seeded at 105 cells/ml onto 24-well plates containingcoverslips 18 h prior to infection with S. Typhimurium strains expressingBla fusion proteins at a multiplicity of infection (MOI) of 20. Plates werecentrifuged at 1,000 rpm for 5 min at room temperature to synchronizethe infection. After incubation for 1 h at 37°C in 5% CO2, the infected cellswere washed three times to remove extracellular bacteria. To kill remain-ing extracellular bacteria, infected cells were incubated for 1 h in the pres-ence of 1 mM IPTG and 100 �g/ml gentamicin. After 1 h, gentamicin wasremoved by washing the cells, which were then further incubated for 8 h inthe presence of 1 mM IPTG and 20 �g/ml gentamicin to kill any extracel-lular bacteria that may have escaped from the infected cells. After 10 h ofinfection with Salmonella, infected cells were washed three times withHanks’ balanced salt solution (HBSS) (Invitrogen) and loaded with 1 mMfluorescence substrate CCF2/AM (Invitrogen) for 1.5 h at room temper-ature using the protocol recommended by the manufacturer. Then, thecells were washed three times with 1� phosphate-buffered saline (PBS)and fixed with 4% paraformaldehyde for fluorescence analysis. FluoViewOlympic confocal microscopy (Olympus, Japan) was used to examine thefluorescence of fixed cells with a blue filter (450-nm emission) and greenfilter (520-nm emission). The presence of blue fluorescent cells indicatestranslocation of the SrgE-Bla fusion protein, whereas the presence ofgreen fluorescent cells means the absence of translocation of the Bla fusionprotein.

Split GFP complementation assay. This assay takes advantage of theidentification of two interacting fragments of GFP that yield fluorescence(79). These two GFP fragments are the 11th strand of the GFP beta-barrel(GFP S11) and the first 10 strands of GFP (GFP1–10). The C terminus ofSrgE was tagged with the GFP S11 fragment, whereas the GFP1–10 frag-ment was expressed in trans within J774.1 cells. Stably transfected J774.1cells expressing GFP1–10 were generated using Lipofectamine transfec-

tion reagent, as described above. S. Typhimurium ATCC 14028 or itsisogenic mutant strains were transformed with the pGFP S11, pSrgE300-GFP S11, or pPipB2-GFP S11 expression construct. Stably transfectedJ774.1 macrophage-like cells (105 cells/ml) expressing the GFP1–10 frag-ment were seeded onto a 24-well plate containing coverslips and wereinfected with S. Typhimurium carrying the GFP S11 fusion constructs atan MOI of 20. Infection was allowed to proceed for 1 h before addition of100 �g/ml of gentamicin (Sigma) to kill extracellular bacteria for 1 h,followed by 20 �g/ml of gentamicin for the remainder of the course ofinfection. At 10 h and 18 h postinfection, infected cells were washed withPBS and subsequently fixed with 4% paraformaldehyde for GFP comple-mentation analysis. Translocation of GFP S11 fusion proteins in cellsexpressing the GFP1–10 fragment yields functional GFP and green fluo-rescence within the host cell (79).

Immunofluorescence microscopy. For immunostaining of S. Typhi-murium and Bla fusion proteins, Salmonella-infected J774.1 cells werefixed with 4% paraformaldehyde for 15 min at room temperature andthen permeabilized with 0.1% Triton X-100 for 5 min at room tempera-ture. S. Typhimurium cells were stained using a polyclonal rabbit (1/500dilution) (Novus Biologicals) or monoclonal (1/200 dilution) (MeridianLife Science) anti-Salmonella Typhimurium antibody, whereas Bla fusionproteins were stained using monoclonal anti-Bla (1/500 dilution) (SantaCruz Biotechnology). Host cell nuclei were stained by DAPI (4=,6-di-amino-2-phenylindole). The anti-Salmonella primary antibodies were de-tected with a secondary red fluorescent Alexa Fluor 555-conjugated anti-rabbit antibody (1/4,000 dilution) (Invitrogen, Carlsbad, CA), whereasthe monoclonal anti-Bla antibodies were detected by a secondary anti-mouse antibody conjugated with Alexa Fluor 488 (green fluorescence)(1/4,000 dilution) (Invitrogen, Carlsbad, CA). Images were taken with aFluoView Olympic confocal microscope (Olympus, Japan).

Statistical methods. All experiments were performed in triplicatewells on three separate occasions. The statistical analysis was performedwith Prism 5 software (GraphPad) with one-way analysis of variance(ANOVA) and Bonferroni analyses or the two-tailed unpaired Student ttest. A P value of �0.05 was considered significant (*, P � 0.05; **, P �0.005; and ***, P � 0.0005).

SrgE phylogenetic analysis. A list of SrgE homologs was obtainedusing the SrgE sequence from S. Typhimurium LT2 to search with BLASTthe completed genomes deposited in the Kyoto Encyclopedia of Genesand Genomes (KEGG) database. Those sequences with an E value lessthan 10�5 were exported in FASTA file format and uploaded intoGeneious (version 7.0.6, created by Biomatters). Individual protein se-quences were analyzed for coiled-coil domains using the coiled-coil pre-

TABLE 2 Primers used in this study

Primer Sequencea Descriptionb

BA1958 CATATGATGATGAGTAGTATTACAAAAA F primer for fusing 3�Flag-Bla or GFP S11 to SrgE488BA1915 CTCGAGTTTCTTTTTATATGCCCCATACAA R primer for fusing 3�Flag-Bla to SrgE488BA2682 AACTCGAGATACTCTTCGACCACATT R primer for fusing 3�Flag-Bla to SrgE400BA2066 AACTCGAGACTATAAATAACCGGATCAAT R primer for fusing 3�Flag-Bla to SrgE300BA2068 AACTCGAGATTAGAAACATGTTCAAGTA R primer for fusing 3�Flag-Bla to SrgE150BA2069 AACTCGAGAAGGTGATTAGATATGTTATA R primer for fusing 3�Flag-Bla to SrgE100BA2488 CTCGAGATGAATCTACGTAATTCTT R primer for fusing 3�Flag-Bla to SrgE40BA2555 GGATCCTTTCTTTTTATATGCCCCATAC R primer for GFP S11 fusion SrgE488BA2114 AAGGATCCACTATAAATAACCGGATCAAT R primer for GFP S11 fusion SrgE300BA1905 CATGTTTTTACATGAATGGACTACGG F primer for deletion of NdeI restriction site in srgEBA1906 GTGGTTACTATAAATAACCGGATCAAT R primer for deletion of NdeI restriction site in srgEBA996 TCAAGCACTGCTCTATACGCTATTACCCTCTTAA

CCTTCGCATATGAATATCCTCCTTAGR primer to generate �(ssaG-ssaU)::kan mutation (the last 20 nucleotides bind priming

site 2 of pKD4 [81])BA1281 GCTGGCTCAGGTAACGCCAGAACAACGTGCG

CCGGAGTAAGTGTAGGCTGGAGCTGCTTCF primer to generate �(ssaG-ssaU)::kan mutation (the last 20 nucleotides bind priming

site 1 of pKD4 [81])a Bold letters indicate restriction endonuclease recognition sites.b F, forward; R, reverse.

SrgE Is a T3SS Effector

June 2014 Volume 196 Number 12 jb.asm.org 2303

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

diction tool in Geneious. The alignment was then used to generate aneighbor-joining consensus tree with 100 bootstrap replicates.

RESULTSTruncated forms of SrgE are expressed in Escherichia coli and S.Typhimurium. We fused a 3�Flag tag to the N terminus of SrgE, aswell as created a fusion of TEM-1 �-lactamase (Bla) (in which thesec-dependent signal sequence was deleted and replaced by 3�Flag)to the C terminus of SrgE (78). Expression of both the Flag-SrgE and

SrgE488–3�Flag-Bla (indicating that 3�Flag-Bla is fused to the488th residue of SrgE, which is the C terminus) fusion proteins wasdriven by the IPTG-inducible tac and trc promoters, respectively. Inseveral attempts, we could not detect the SrgE fusion proteins ex-pressed in either E coli or S. Typhimurium by Western blotting usinganti-�-lactamase or anti-Flag antibody. We then C-terminally fused3�Flag-Bla to SrgE proteins from which various lengths of the Cterminus had been deleted. SrgE400–3�Flag-Bla could not be ex-pressed either (Fig. 1). However, we could detect the expression of3�Flag-Bla-fused SrgE300, SrgE150, SrgE100, and SrgE40 (Fig. 1).The only readily apparent correlation with expression is the CC do-main, since removing this domain appears to allow expression. Sincewe were able to detect the expression of truncated SrgE–3�Flag-Blafusion constructs in vitro, we next tested whether we could detectexpression of these truncated fusion proteins within the bacteria dur-ing Salmonella infection of tissue culture cells. Therefore, we in-fected murine-macrophage-like J774.1 cells with S. Typhimuriumexpressing truncated SrgE–3�Flag-Bla fusion constructs or con-trol plasmids (pSipA–3�Flag-Bla and pFlag-Bla). At 5 h postin-fection, S. Typhimurium-infected cells were fixed and stainedsimultaneously with anti-Salmonella and anti-�-lactamase anti-bodies. Flag-Bla, SipA–3�Flag-Bla, and SrgE300 –3�Flag-Blawere expressed by a portion of the intracellular S. Typhimuriumcells (70%, 50%, and 60% of S. Typhimurium cells, respectively)(Fig. 2). The lack of expression of Bla fusion proteins in individualS. Typhimurium cells may be due to the loss of fusion constructsin these strains. These data confirm that Bla fusion proteins areexpressed and detectable in Salmonella during growth in vitro andduring infection of tissue culture cells.

SrgE-Bla fusion proteins are translocated into host cells.Since we have demonstrated that SrgE300-Bla is expressed in S.Typhimurium during infection of J774.1 cells (Fig. 2), we next

FIG 1 Truncated versions of SrgE-Bla, but not full-length SrgE-Bla, are ex-pressed in S. Typhimurium. After reaching the exponential phase of growth at37°C with shaking, the expression of various SrgE–3�Flag-Bla fusion proteinswas induced using IPTG for 4 h. Bacterial culture lysates were then analyzed byWestern blotting with anti-Bla antibody. Western blotting with anti-DnaKantibody was used as a loading control. Molecular weight marker positions (inthousands) are listed on the left side.

FIG 2 S. Typhimurium expresses Bla fusion proteins in J774.1 cells. Representative confocal microscopy images of J774.1 macrophages infected for 5 hpostinfection with S. Typhimurium (red) expressing 3�Flag-Bla fusion hybrids (green). Host cellular nuclei were stained with DAPI (blue). Colocalized,expressed 3�Flag-Bla fusion proteins within S. Typhimurium appear yellow. On the right are percentages of cells infected with S. Typhimurium expressing3�Flag-Bla fusion proteins.

Habyarimana et al.

2304 jb.asm.org Journal of Bacteriology

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

assessed whether SrgE300 –3�Flag-Bla is translocated into J774.1and RAW264.7 cells infected with wild-type S. Typhimurium. Weused SipA–3�Flag-Bla as a positive control and Flag-Bla as a neg-ative control. Uninfected cells loaded with �-lactamase substrate(CCF2/AM) served as an additional negative control. After 10 h ofinfection with S. Typhimurium expressing truncated SrgE–3�Flag-Bla and SipA–3�Flag-Bla fusion proteins, there were in-creased percentages of J774.1 cells with cleaved �-lactamase sub-strate (43%, 46%, 42%, 40%, and 50% of cells) compared to thepercentages of the negative controls, S. Typhimurium cells ex-pressing Flag-Bla (6%) or uninfected J774.1 cells loaded withCCF2/AM (0%) (Fig. 3A and B). Similar results were observedwith RAW264.7 cells (data not shown). These data indicate that S.Typhimurium translocates SrgE into host cells.

SrgE is translocated into host cells via T3SS2. Given that SrgEis predicted by some algorithms to encode a T3SS effector (68, 69)and that we have demonstrated translocation of SrgE into hostcells, we hypothesized that translocation would require eitherSPI1, SPI2, or the flagellar T3SS. Therefore, we tested mutantslacking any one of these systems and a triple mutant lacking allthree for their ability to translocate the SrgE300 –3�Flag-Bla fu-sion protein. Only the SPI2 mutant and triple mutant strains werefound to be defective for translocation of SrgE300 –3�Flag-Bla,indicating that the fusion protein is translocated into host cells viaT3SS2 (Fig. 4A and B). Expression of the fusion protein in each ofthese strains was confirmed (Fig. 4C). Wild-type S. Typhimurium

cells expressing Flag-Bla and SipA–3�Flag-Bla were used as neg-ative and positive controls in this experiment, respectively. To testthe hypothesis that the lack of �-lactamase activity in host cellsinfected with the SPI2 mutant could be due to a replication orsurvival defect, we performed a survival assay with J774.1 cellsunder the same conditions used for the translocation assay. Thenumber of SPI2 mutant cells surviving within J774.1 cells wasindeed reduced by 61% relative to the number of surviving cells ofthe wild-type strain. However, this defect was similar to that of theSPI1 and flhD mutant strains (reduced by 45% and 44%, respec-tively) and not as severe as that observed with the triple mutant,whose live-cell number was reduced by 84% (Fig. 5A). Despite asimilar defect between the SPI2 mutant and the two other mutantstrains, the ability of the SPI1 and flhD mutants to translocateSrgE-Bla was not impaired. We also checked SrgE-Bla expressionin all of the mutant strains during host cell infection by usingimmunofluorescence staining. All of the strains expressed the Blafusion proteins at comparable levels (Fig. 5B). Taken together,these data indicate that T3SS2 is the sole apparatus that translo-cates SrgE protein into the host cell cytosol.

Confirmation with a split GFP system. To confirm these re-sults, we used a second approach that consists of a split GFP system(79). The small portion of GFP (GFP S11) was attached to the Cterminus of SrgE300 and full-length SrgE. As observed with the Blafusions, the truncated SrgE300-GFP S11 fusion protein was expressed

FIG 3 Translocation of S. Typhimurium SrgE into J774.1 macrophages. Wild-type S. Typhimurium strain ATCC 14028 expressing 3�Flag-Bla fusion proteins wereused to infect J774.1 and RAW264.7 macrophages at an MOI of 20. At 10 h postinfection, infected cells were loaded with �-lactamase substrate (CCF2/AM) andtranslocation was assessed by counting the percentage of cells with cleaved CCF2/AM (blue). (A) Representative fluorescence micrographs showing control proteins(Flag-Bla and SipA–3�Flag-Bla) and SrgE300–3�Flag-Bla, SrgE150–3�Flag-Bla, SrgE100–3�Flag-Bla, and SrgE40–3�Flag fusion proteins from individual assaywells. (B) Quantitation of translocation of controls and SrgE in J774.1 cells. Results shown are the means standard deviations (SD) of results from three independentexperiments. **, P � 0.005; ***, P � 0.0005. WT, wild type.

SrgE Is a T3SS Effector

June 2014 Volume 196 Number 12 jb.asm.org 2305

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

but not the full-length SrgE-GFP S11 fusion protein (data notshown). Therefore, SrgE300-GFP S11 was used for all experiments.

The large portion of GFP (GFP1–10) was used to generate stablytransfected J774.1 cells. Expression of nonfluorescent GFP1–10 inJ774.1 cells was evaluated and confirmed by fluorescence microscopyin the presence of purified GFP S11 (Fig. 6). To assess SrgE translo-cation into host cells, J774.1 cells stably transfected with GFP1–10were infected with S. Typhimurium expressing SrgE300-GFP S11 oran empty vector for 10 h or 18 h. A PipB2-GFP S11 construct wasused as a positive control, and the empty vector pGFP S11 was used asa negative control. At each time point, S. Typhimurium-infected cellswere analyzed for GFP complementation using fluorescence micros-

copy. Fluorescence analysis indicated that at both time points, 10% to15% of J774.1 cells infected with wild-type S. Typhimurium express-ing SrgE300-GFP S11 and PipB2-GFP S11 became fluorescent, com-pared to 0% becoming fluorescent with an SPI2 mutant strain ex-pressing SrgE300-GFP S11 or with wild-type S. Typhimuriumexpressing GFP S11 alone (Fig. 7A and B). These data indicate that S.Typhimurium translocates SrgE into host cells in a T3SS2-dependentmanner.

DISCUSSION

T3SSs are the hallmark virulence factor of S. Typhimurium; their rolein pathogenesis is to translocate multiple effector proteins from the

FIG 4 S. Typhimurium SrgE is translocated into J774.1 macrophages by T3SS2. Wild-type S. Typhimurium strain ATCC 14028, the SPI1 mutant (YD039), theSPI2 mutant (YD516), the flhD mutant (AT351), and a triple mutant (FH0137) expressing 3�Flag-Bla fusion proteins were used to infect J774.1 macrophagesat an MOI of 20. At 10 h postinfection, infected cells were loaded with �-lactamase substrate (CCF2/AM), and translocation was assessed by the presence of cellswith cleaved CCF2/AM (blue). (A) Representative fluorescence micrographs showing control proteins (Flag-Bla and SipA–3�Flag-Bla) and SrgE300 –3�Flag-Bla fusion proteins from individual assay wells. (B) Quantitation of the percentage of cells with cleaved CCF2/AM from panel A. Results shown are the means SD of results from three independent experiments. **, P � 0.005; ***, P � 0.0005. (C) Western blot of SrgE300 –3�Flag-Bla, SipA–3�Flag-Bla, and Flag-Blaexpressed in S. Typhimurium wild-type, SPI1mutant, SPI2 mutant, flhD mutant, and triple mutant (lacking SPI1, SPI2, and flhD) cells in the presence of IPTG.The expression of the 3�Flag-Bla fusion proteins from bacterial cell lysates was probed using anti-Bla antibody.

Habyarimana et al.

2306 jb.asm.org Journal of Bacteriology

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

bacterial cytosol into the host cells. Through concerted actions, theseeffectors are known to modulate host cell functions, thereby contrib-uting to the virulence of S. Typhimurium (82, 83). Early in silicoanalyses of SrgE have provided conflicting predictions as to whether

SrgE is a T3SS substrate (68–72). To test the hypothesis that SrgE is aT3SS, we used two different methods, a �-lactamase activity reporterassay and a split GFP system, to demonstrate that SrgE is indeed aT3SS effector delivered into host cells via T3SS2.

FIG 5 Quantitation of survival of S. Typhimurium SPI1, SPI2, and flhD mutant cells and of a triple mutant expressing 3�Flag-Bla fusion proteins within J774.1cells. Wild-type S. Typhimurium strain ATCC 14028, an SPI1 mutant, an SPI2 mutant, a flhD mutant, and a triple mutant expressing 3�Flag-Bla fusion proteinswere used to infect J774.1 macrophages at an MOI of 20. (A) At 10 h postinfection (10h pi), infected cells were lysed and plated for determination of CFUnumbers. Results shown are the means SD of results from three independent experiments. *, P � 0.05; **, P � 0.005; ***, P � 0.0005. (B) Correspondingrepresentative confocal microscopy images in which extracellular bacteria were labeled with Alexa Fluor 555 (red). The J774.1 cells were then permeabilized, andtotal bacteria were labeled with Alexa Fluor 405 (blue). The extracellular bacteria then appear pink, while the intracellular bacterial appear blue. The Bla fusionproteins were labeled with Alexa Fluor 488 (green). Bla fusion protein expression in extracellular bacteria appears white (red, blue, and green), while Bla fusionprotein expression in intracellular bacteria appears cyan (blue and green).

FIG 6 Production of J774.1 cell lines stably expressing GFP1–10. J774.1 cells were transiently transfected by the vector pGFP1–10 using Lipofectaminetransfection reagent. Transiently transfected J774.1 cells were subsequently grown in the presence of 1.4 mg/ml of Geneticin for 15 days. After 15 days, severalcellular colonies were formed and screened by confocal microscopy for GFP complementation after addition of purified GFP S11 peptide. GFP complementationoccurred only in cells that integrated the pGFP1–10 plasmid into their genome. Displayed are examples of positive stably transfected pGFP1–10 J774.1 cells(green), and cellular nuclei were stained with DAPI (blue).

SrgE Is a T3SS Effector

June 2014 Volume 196 Number 12 jb.asm.org 2307

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

It is not known why SrgE-Bla and SrgE-GFP S11 fusion pro-teins that include the CC domain could not be expressed. Sincecoiled-coil domains are known to mediate protein-protein inter-actions, the folding of the fusion protein and/or its protein-pro-tein interactions within the bacterial cell may have been disruptedby the presence of the fusion partner. The deletion of the coiled-coil domain solved this problem. It will be interesting to deter-mine what role this domain plays, either in the bacterial cell or inthe host cell, after translocation.

A phylogenetic analysis of srgE indicates that it is present onlyin S. enterica subspecies enterica. At least among existing genomesequences, there are no occurrences of srgE in S. bongori or in theother subspecies of S. enterica. Since SPI2 is found throughout allsubspecies of S. enterica, this suggests that SrgE was horizontallyacquired after SPI2. There are over 1,500 serovars within subspe-cies enterica, and the occurrence of srgE among these serovars issomewhat sporadic (Fig. 8). There are considered to be two patho-vars within the subspecies enterica, consisting of those serovarsthat cause an extraintestinal typhoid-like enteric fever (the typhoi-dal serovars) and the nontyphoidal serovars, many of which causegastroenteritis (84). SrgE is present among the following availablegenome sequences for nontyphoidal serovars: Typhimurium,Agona, Cubana, Bovismorbificans, and Javiana. However, it is notfound in Enteritidis, Gallinarum, Pullorum, or Heidelberg. srgE isfound in the typhoidal serovars Typhi, Paratyphi B, and ParatyphiC but not in Paratyphi A. Alignment of SrgE homologs indicates

that there are two types of SrgE proteins (Fig. 8). One is found inthe typhoidal serovars, and the other is found primarily in thenontyphoidal serovars, with the exception that Paratyphi B en-codes a nontyphoidal type of SrgE. However, the name of Paraty-phi B may be misleading, as some isolates actually cause gastro-enteritis rather than extraintestinal infection (84). Both types ofSrgE encode the putative coiled-coil domain near the C terminus.

SrgE is expressed only from its natural position in the Typhi-murium chromosome when the SdiA transcription factor is ac-tive, which is upon detection of AHL (64). Since Salmonella doesnot make AHLs, the AHLs detected must originate from othermicrobes. However, to date, AHLs have not been detected withinthe gastrointestinal tracts of healthy mammals (85). We have pre-viously determined that SdiA becomes active in turtles colonizedby Aeromonas hydrophila and mice infected with Yersinia entero-colitica (65, 66). In addition, through literature searches and scan-ning the metagenomic data of the human microbiome project, wehave identified up to seven other bacteria that have the potential tomake AHLs that might be found in the gastrointestinal tract (85).All of the bacteria mentioned are members of the Proteobacteria,and it is known that inflammation leads to proteobacterial blooms(86–89). One possibility is that SdiA detects the AHLs producedby members of these proteobacterial blooms, although this ispurely conjecture at this time. Even if true, it still does not ex-plain why Salmonella would add a single T3SS effector, SrgE, to itsarsenal during a proteobacterial bloom. The other locus regulated

FIG 7 The split GFP complementation system confirms the translocation of SrgE into host cells by T3SS2. Wild-type S. Typhimurium strain ATCC 14028 andan SPI2 mutant strain (YD516), each expressing GFP S11 fusion proteins, were used to infect J774.1 macrophages stably expressing GFP1–10 at an MOI of 20.At 10 and 18 h postinfection, infected cells were fixed with paraformaldehyde for GFP complementation analysis, which is the result of interaction of bothportions of GFP in the host cell cytosol. (A) Representative confocal microscopy images of GFP complementation (green) are shown. Host cellular nuclei werestained with DAPI (blue). (B) Quantitation of complementation of SrgE-GFP S11 and controls are presented. Results shown are the means SD of results fromthree independent experiments. ***, P � 0.005.

Habyarimana et al.

2308 jb.asm.org Journal of Bacteriology

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

by SdiA, the rck operon, includes a gene, srgA, that encodes adisulfide bond oxidoreductase. SrgA is known to play a role in thefolding of the PefA fimbrial subunit and an outer membrane com-ponent of T3SS2 (90, 91). The Rck protein itself is an outer mem-brane beta-barrel that confers resistance to complement killingand adhesion to and invasion of host cells (92–96). Since Yersiniais known to block phagocytosis and Salmonella is known to induceuptake, we recently determined that Yersinia is “dominant” in thatit blocks the invasion of Salmonella into epithelial cells but, sur-prisingly, not macrophages (97). We tested the hypothesis that theSdiA regulon may play a role in these interactions and found noeffect. Therefore, to date, the function of SrgE remains unknown.We are currently trying to identify any protein interaction part-ners of SrgE and the function of SrgE within host cells in the hopethat this will shed more light on the purpose of AHL detection bySalmonella.

ACKNOWLEDGMENTS

We thank Andreas J. Baumler for TEM-1 lactamase fusion constructs,Amy E. Palmer for GFP S11 fusion constructs, and Yakhya Dieye forconstructing YD516 and YD517. We also thank staff members from theOSU Campus Microscopy and Imaging Facility (CMIF).

This project was supported by award numbers R01AI073971,R01AI097116, and 1–T32-AI065411 (an NRSA training grant adminis-tered by the Center for Microbial Interface Biology [CMIB] at The OhioState University) from the National Institute of Allergy and InfectiousDiseases.

The content is solely the responsibility of the authors and does notnecessarily represent the official views of the National Institute of Allergyand Infectious Diseases or the National Institutes of Health.

REFERENCES1. Guibourdenche M, Roggentin P, Mikoleit M, Fields PI, Bockemuhl J,

Grimont PA, Weill FX. 2010. Supplement 2003-2007 (no. 47) to theWhite-Kauffmann-Le Minor scheme. Res. Microbiol. 161:26 –29. http://dx.doi.org/10.1016/j.resmic.2009.10.002.

2. Haraga A, Ohlson MB, Miller SI. 2008. Salmonellae interplay with host cells.Nat. Rev. Microbiol. 6:53–66. http://dx.doi.org/10.1038/nrmicro1788.

3. Ochman H, Groisman EA. 1996. Distribution of pathogenicity islandsin Salmonella spp. Infect. Immun. 64:5410 –5412.

4. Gerlach RG, Hensel M. 2007. Salmonella pathogenicity islands in hostspecificity, host pathogen-interactions and antibiotics resistance of Sal-monella enterica. Berl. Munch. Tierarztl. Wochenschr. 120:317–327.http://dx.doi.org/10.2376/0005-9366-120-317.

5. Fookes M, Schroeder GN, Langridge GC, Blondel CJ, Mammina C,Connor TR, Seth-Smith H, Vernikos GS, Robinson KS, Sanders M,Petty NK, Kingsley RA, Baumler AJ, Nuccio SP, Contreras I, Santivi-ago CA, Maskell D, Barrow P, Humphrey T, Nastasi A, Roberts M,Frankel G, Parkhill J, Dougan G, Thomson NR. 2011. Salmonellabongori provides insights into the evolution of the Salmonellae. PLoSPathog. 7:e1002191. http://dx.doi.org/10.1371/journal.ppat.1002191.

6. Hall RM. 2010. Salmonella genomic islands and antibiotic resistance inSalmonella enterica. Future Microbiol. 5:1525–1538. http://dx.doi.org/10.2217/fmb.10.122.

7. Hensel M, Shea JE, Waterman SR, Mundy R, Nikolaus T, Banks G,Vazquez-Torres A, Gleeson C, Fang FC, Holden DW. 1998. Genesencoding putative effector proteins of the type III secretion system ofSalmonella pathogenicity island 2 are required for bacterial virulence andproliferation in macrophages. Mol. Microbiol. 30:163–174. http://dx.doi.org/10.1046/j.1365-2958.1998.01047.x.

8. Hapfelmeier S, Stecher B, Barthel M, Kremer M, Muller AJ, Heiken-walder M, Stallmach T, Hensel M, Pfeffer K, Akira S, Hardt WD. 2005.The Salmonella pathogenicity island (SPI)-2 and SPI-1 type III secretionsystems allow Salmonella serovar typhimurium to trigger colitis viaMyD88-dependent and MyD88-independent mechanisms. J. Immunol.174:1675–1685.

9. Ustun S, Muller P, Palmisano R, Hensel M, Bornke F. 2012. SseF, atype III effector protein from the mammalian pathogen Salmonella en-terica, requires resistance-gene-mediated signalling to activate cell deathin the model plant Nicotiana benthamiana. New Phytol. 194:1046 –1060.http://dx.doi.org/10.1111/j.1469-8137.2012.04124.x.

10. Collazo CM, Galan JE. 1997. The invasion-associated type-III proteinsecretion system in Salmonella. Gene 192:51–59. http://dx.doi.org/10.1016/S0378-1119(96)00825-6.

11. Collazo CM, Galan JE. 1997. The invasion-associated type III system ofSalmonella typhimurium directs the translocation of Sip proteins intothe host cell. Mol. Microbiol. 24:747–756. http://dx.doi.org/10.1046/j.1365-2958.1997.3781740.x.

100

10060

60

62

FIG 8 Phylogeny of SrgE homologs. (A) Alignment of SrgE protein sequences; (B) neighbor-joining tree of the SrgE alignment. Only branches with bootstrapsgreater than 50 are labeled.

SrgE Is a T3SS Effector

June 2014 Volume 196 Number 12 jb.asm.org 2309

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

12. Wood MW, Rosqvist R, Mullan PB, Edwards MH, Galyov EE. 1996.SopE, a secreted protein of Salmonella dublin, is translocated into thetarget eukaryotic cell via a Sip-dependent mechanism and promotes bac-terial entry. Mol. Microbiol. 22:327–338. http://dx.doi.org/10.1046/j.1365-2958.1996.00116.x.

13. Collazo CM, Zierler MK, Galan JE. 1995. Functional analysis of theSalmonella typhimurium invasion genes invl and invJ and identificationof a target of the protein secretion apparatus encoded in the inv locus.Mol. Microbiol. 15:25–38. http://dx.doi.org/10.1111/j.1365-2958.1995.tb02218.x.

14. Zierler MK, Galan JE. 1995. Contact with cultured epithelial cells stim-ulates secretion of Salmonella typhimurium invasion protein InvJ. Infect.Immun. 63:4024 – 4028.

15. Garcia-del Portillo F, Finlay BB. 1994. Invasion and intracellular pro-liferation of Salmonella within non-phagocytic cells. Microbiologia 10:229 –238.

16. Garcia-del Portillo F, Finlay BB. 1994. Salmonella invasion ofnonphagocytic cells induces formation of macropinosomes in the hostcell. Infect. Immun. 62:4641– 4645.

17. Galan JE, Ginocchio C. 1994. The molecular genetic bases of Salmonellaentry into mammalian cells. Biochem. Soc. Trans. 22:301–306.

18. Galan JE. 1999. Interaction of Salmonella with host cells through thecentisome 63 type III secretion system. Curr. Opin. Microbiol. 2:46 –50.http://dx.doi.org/10.1016/S1369-5274(99)80008-3.

19. Ly KT, Casanova JE. 2007. Mechanisms of Salmonella entry into hostcells. Cell. Microbiol. 9:2103–2111. http://dx.doi.org/10.1111/j.1462-5822.2007.00992.x.

20. McGhie EJ, Brawn LC, Hume PJ, Humphreys D, Koronakis V. 2009.Salmonella takes control: effector-driven manipulation of the host. Curr.Opin. Microbiol. 12:117–124. http://dx.doi.org/10.1016/j.mib.2008.12.001.

21. Alpuche-Aranda CM, Racoosin EL, Swanson JA, Miller SI. 1994.Salmonella stimulate macrophage macropinocytosis and persist withinspacious phagosomes. J. Exp. Med. 179:601– 608. http://dx.doi.org/10.1084/jem.179.2.601.

22. Francis CL, Ryan TA, Jones BD, Smith SJ, Falkow S. 1993. Rufflesinduced by Salmonella and other stimuli direct macropinocytosis of bac-teria. Nature 364:639 – 642. http://dx.doi.org/10.1038/364639a0.

23. Stecher B, Macpherson AJ, Hapfelmeier S, Kremer M, Stallmach T,Hardt WD. 2005. Comparison of Salmonella enterica serovar Typhimu-rium colitis in germfree mice and mice pretreated with streptomycin.Infect. Immun. 73:3228 –3241. http://dx.doi.org/10.1128/IAI.73.6.3228-3241.2005.

24. Thiennimitr P, Winter SE, Winter MG, Xavier MN, Tolstikov V,Huseby DL, Sterzenbach T, Tsolis RM, Roth JR, Baumler AJ. 2011.Intestinal inflammation allows Salmonella to use ethanolamine to com-pete with the microbiota. Proc. Natl. Acad. Sci. U. S. A. 108:17480 –17485. http://dx.doi.org/10.1073/pnas.1107857108.

25. Lopez CA, Winter SE, Rivera-Chavez F, Xavier MN, Poon V, NuccioSP, Tsolis RM, Baumler AJ. 2012. Phage-mediated acquisition of a typeIII secreted effector protein boosts growth of Salmonella by nitrate res-piration. mBio 3(3):e00143–12. http://dx.doi.org/10.1128/mBio.00143-12.

26. Tsolis RM, Kingsley RA, Townsend SM, Ficht TA, Adams LG, Baum-ler AJ. 1999. Of mice, calves, and men. Comparison of the mousetyphoid model with other Salmonella infections. Adv. Exp. Med. Biol.473:261–274.

27. Wallis TS, Galyov EE. 2000. Molecular basis of Salmonella-inducedenteritis. Mol. Microbiol. 36:997–1005. http://dx.doi.org/10.1046/j.1365-2958.2000.01892.x.

28. Lee CA, Silva M, Siber AM, Kelly AJ, Galyov E, McCormick BA. 2000.A secreted Salmonella protein induces a proinflammatory response inepithelial cells, which promotes neutrophil migration. Proc. Natl. Acad.Sci. U. S. A. 97:12283–12288. http://dx.doi.org/10.1073/pnas.97.22.12283.

29. Zhang S, Kingsley RA, Santos RL, Andrews-Polymenis H, RaffatelluM, Figueiredo J, Nunes J, Tsolis RM, Adams LG, Baumler AJ. 2003.Molecular pathogenesis of Salmonella enterica serotype typhimurium-induced diarrhea. Infect. Immunity 71:1–12. http://dx.doi.org/10.1128/IAI.71.1.1-12.2003.

30. Kaiser P, Diard M, Stecher B, Hardt WD. 2012. The streptomycinmouse model for Salmonella diarrhea: functional analysis of the micro-biota, the pathogen’s virulence factors, and the host’s mucosal immune

response. Immunol. Rev. 245:56 – 83. http://dx.doi.org/10.1111/j.1600-065X.2011.01070.x.

31. Chung H, Pamp SJ, Hill JA, Surana NK, Edelman SM, Troy EB,Reading NC, Villablanca EJ, Wang S, Mora JR, Umesaki Y, Mathis D,Benoist C, Relman DA, Kasper DL. 2012. Gut immune maturationdepends on colonization with a host-specific microbiota. Cell 149:1578 –1593. http://dx.doi.org/10.1016/j.cell.2012.04.037.

32. Bijlsma JJ, Groisman EA. 2005. The PhoP/PhoQ system controls the intramac-rophage type three secretion system of Salmonella enterica. Mol. Microbiol.57:85–96. http://dx.doi.org/10.1111/j.1365-2958.2005.04668.x.

33. Cirillo DM, Valdivia RH, Monack DM, Falkow S. 1998. Macrophage-dependent induction of the Salmonella pathogenicity island 2 type IIIsecretion system and its role in intracellular survival. Mol. Microbiol.30:175–188. http://dx.doi.org/10.1046/j.1365-2958.1998.01048.x.

34. Pfeifer CG, Marcus SL, Steele-Mortimer O, Knodler LA, Finlay BB.1999. Salmonella typhimurium virulence genes are induced upon bacte-rial invasion into phagocytic and nonphagocytic cells. Infect. Immun.67:5690 –5698.

35. Worley MJ, Ching KH, Heffron F. 2000. Salmonella SsrB activates aglobal regulon of horizontally acquired genes. Mol. Microbiol. 36:749 –761. http://dx.doi.org/10.1046/j.1365-2958.2000.01902.x.

36. Valdivia RH, Falkow S. 1997. Probing bacterial gene expression withinhost cells. Trends Microbiol. 5:360 –363. http://dx.doi.org/10.1016/S0966-842X(97)01111-6.

37. Steele-Mortimer O, Brumell JH, Knodler LA, Meresse S, Lopez A,Finlay BB. 2002. The invasion-associated type III secretion system ofSalmonella enterica serovar Typhimurium is necessary for intracellularproliferation and vacuole biogenesis in epithelial cells. Cell. Microbiol.4:43–54. http://dx.doi.org/10.1046/j.1462-5822.2002.00170.x.

38. Lawley TD, Chan K, Thompson LJ, Kim CC, Govoni GR, MonackDM. 2006. Genome-wide screen for Salmonella genes required for long-term systemic infection of the mouse. PLoS Pathog. 2:e11. http://dx.doi.org/10.1371/journal.ppat.0020011.

39. Santiviago CA, Reynolds MM, Porwollik S, Choi SH, Long F, An-drews-Polymenis HL, McClelland M. 2009. Analysis of pools of targetedSalmonella deletion mutants identifies novel genes affecting fitness dur-ing competitive infection in mice. PLoS Pathog. 5:e1000477. http://dx.doi.org/10.1371/journal.ppat.1000477.

40. Winter SE, Thiennimitr P, Winter MG, Butler BP, Huseby DL, Craw-ford RW, Russell JM, Bevins CL, Adams LG, Tsolis RM, Roth JR,Baumler AJ. 2010. Gut inflammation provides a respiratory electronacceptor for Salmonella. Nature 467:426 – 429. http://dx.doi.org/10.1038/nature09415.

41. Bispham J, Tripathi BN, Watson PR, Wallis TS. 2001. Salmonellapathogenicity island 2 influences both systemic salmonellosis and Salmo-nella-induced enteritis in calves. Infect. Immun. 69:367–377. http://dx.doi.org/10.1128/IAI.69.1.367-377.2001.

42. Brown NF, Vallance BA, Coombes BK, Valdez Y, Coburn BA, FinlayBB. 2005. Salmonella pathogenicity island 2 is expressed prior to pene-trating the intestine. PLoS Pathog. 1:e32. http://dx.doi.org/10.1371/journal.ppat.0010032.

43. Stecher B, Paesold G, Barthel M, Kremer M, Jantsch J, Stallmach T,Heikenwalder M, Hardt WD. 2006. Chronic Salmonella enterica serovarTyphimurium-induced colitis and cholangitis in streptomycin-pretreated Nramp1�/� mice. Infect. Immun. 74:5047–5057. http://dx.doi.org/10.1128/IAI.00072-06.

44. Filloux A, Hachani A, Bleves S. 2008. The bacterial type VI secretionmachine: yet another player for protein transport across membranes. Micro-biology 154:1570–1583. http://dx.doi.org/10.1099/mic.0.2008/016840-0.

45. Wang M, Luo Z, Du H, Xu S, Ni B, Zhang H, Sheng X, Xu H, HuangX. 2011. Molecular characterization of a functional type VI secretionsystem in Salmonella enterica serovar Typhi. Curr. Microbiol. 63:22–31.http://dx.doi.org/10.1007/s00284-011-9935-z.

46. Pezoa D, Yang HJ, Blondel CJ, Santiviago CA, Andrews-PolymenisHL, Contreras I. 2013. The type VI secretion system encoded in SPI-6plays a role in gastrointestinal colonization and systemic spread of Sal-monella enterica serovar Typhimurium in the chicken. PLoS One8:e63917. http://dx.doi.org/10.1371/journal.pone.0063917.

47. Blondel CJ, Jimenez JC, Leiva LE, Alvarez SA, Pinto BI, Contreras F,Pezoa D, Santiviago CA, Contreras I. 2013. The type VI secretionsystem encoded in Salmonella pathogenicity island 19 is required forSalmonella enterica serotype Gallinarum survival within infected macro-

Habyarimana et al.

2310 jb.asm.org Journal of Bacteriology

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

phages. Infect. Immunity 81:1207–1220. http://dx.doi.org/10.1128/IAI.01165-12.

48. Yoon H, Ansong C, Adkins JN, Heffron F. 2011. Discovery of Salmo-nella virulence factors translocated via outer membrane vesicles to mu-rine macrophages. Infect. Immun. 79:2182–2192. http://dx.doi.org/10.1128/IAI.01277-10.

49. Macnab RM. 2004. Type III flagellar protein export and flagellar assem-bly. Biochim. Biophys. Acta 1694:207–217. http://dx.doi.org/10.1016/j.bbamcr.2004.04.005.

50. Minamino T, Imada K, Namba K. 2008. Mechanisms of type III proteinexport for bacterial flagellar assembly. Mol. Biosyst. 4:1105–1115. http://dx.doi.org/10.1039/b808065h.

51. Sun YH, Rolan HG, Tsolis RM. 2007. Injection of flagellin into the hostcell cytosol by Salmonella enterica serotype Typhimurium. J. Biol. Chem.282:33897–33901. http://dx.doi.org/10.1074/jbc.C700181200.

52. Singer HM, Erhardt M, Steiner AM, Zhang MM, Yoshikami D, BulajG, Olivera BM, Hughes KT. 2012. Selective purification of recombinantneuroactive peptides using the flagellar type III secretion system. mBio3(3):e00115–12. http://dx.doi.org/10.1128/mBio.00115-12.

53. Galkin VE, Schmied WH, Schraidt O, Marlovits TC, Egelman EH.2010. The structure of the Salmonella typhimurium type III secretionsystem needle shows divergence from the flagellar system. J. Mol. Biol.396:1392–1397. http://dx.doi.org/10.1016/j.jmb.2010.01.001.

54. Van Engelenburg SB, Palmer AE. 2008. Quantification of real-timeSalmonella effector type III secretion kinetics reveals differential secre-tion rates for SopE2 and SptP. Chem. Biol. 15:619 – 628. http://dx.doi.org/10.1016/j.chembiol.2008.04.014.

55. Lara-Tejero M, Kato J, Wagner S, Liu X, Galan JE. 2011. A sortingplatform determines the order of protein secretion in bacterial type III sys-tems. Science 331:1188–1191. http://dx.doi.org/10.1126/science.1201476.

56. Stamm LM, Goldberg MB. 2011. Microbiology. Establishing the secretionhierarchy. Science 331:1147–1148. http://dx.doi.org/10.1126/science.1203195.

57. Lee AK, Detweiler CS, Falkow S. 2000. OmpR regulates the two-component system SsrA-SsrB in Salmonella pathogenicity island 2. J. Bacte-riol. 182:771–781. http://dx.doi.org/10.1128/JB.182.3.771-781.2000.

58. Brumell JH, Tang P, Zaharik ML, Finlay BB. 2002. Disruption of theSalmonella-containing vacuole leads to increased replication of Salmo-nella enterica serovar Typhimurium in the cytosol of epithelial cells. In-fect. Immun. 70:3264 –3270. http://dx.doi.org/10.1128/IAI.70.6.3264-3270.2002.

59. Zaharik ML, Vallance BA, Puente JL, Gros P, Finlay BB. 2002. Host-pathogen interactions: host resistance factor Nramp1 up-regulates theexpression of Salmonella pathogenicity island-2 virulence genes. Proc.Natl. Acad. Sci. U. S. A. 99:15705–15710. http://dx.doi.org/10.1073/pnas.252415599.

60. Osborne SE, Coombes BK. 2011. Transcriptional priming of Salmonellapathogenicity island-2 precedes cellular invasion. PLoS One 6:e21648.http://dx.doi.org/10.1371/journal.pone.0021648.

61. Yu XJ, McGourty K, Liu M, Unsworth KE, Holden DW. 2010. pHsensing by intracellular Salmonella induces effector translocation. Sci-ence 328:1040 –1043. http://dx.doi.org/10.1126/science.1189000.

62. Ahmer BM, van Reeuwijk J, Timmers CD, Valentine PJ, Heffron F.1998. Salmonella typhimurium encodes an SdiA homolog, a putativequorum sensor of the LuxR family, that regulates genes on the virulenceplasmid. J. Bacteriol. 180:1185–1193.

63. Michael B, Smith JN, Swift S, Heffron F, Ahmer BM. 2001. SdiA ofSalmonella enterica is a LuxR homolog that detects mixed microbial com-munities. J. Bacteriol. 183:5733–5742. http://dx.doi.org/10.1128/JB.183.19.5733-5742.2001.

64. Smith JN, Ahmer BM. 2003. Detection of other microbial species bySalmonella: expression of the SdiA regulon. J. Bacteriol. 185:1357–1366.http://dx.doi.org/10.1128/JB.185.4.1357-1366.2003.

65. Smith JN, Dyszel JL, Soares JA, Ellermeier CD, Altier C, Lawhon SD,Adams LG, Konjufca V, Curtiss R, III, Slauch JM, Ahmer BM. 2008.SdiA, an N-acylhomoserine lactone receptor, becomes active during thetransit of Salmonella enterica through the gastrointestinal tract of turtles.PLoS One 3:e2826. http://dx.doi.org/10.1371/journal.pone.0002826.

66. Dyszel JL, Smith JN, Lucas DE, Soares JA, Swearingen MC, Vross MA,Young GM, Ahmer BM. 2010. Salmonella enterica serovar Typhimu-rium can detect acyl homoserine lactone production by Yersinia entero-colitica in mice. J. Bacteriol. 192:29 –37. http://dx.doi.org/10.1128/JB.01139-09.

67. Soares JA, Ahmer BM. 2011. Detection of acyl-homoserine lactones byEscherichia and Salmonella. Curr. Opin. Microbiol. 14:188 –193. http://dx.doi.org/10.1016/j.mib.2011.01.006.

68. Samudrala R, Heffron F, McDermott JE. 2009. Accurate prediction ofsecreted substrates and identification of a conserved putative secretionsignal for type III secretion systems. PLoS Pathog. 5:e1000375. http://dx.doi.org/10.1371/journal.ppat.1000375.

69. Sato Y, Takaya A, Yamamoto T. 2011. Meta-analytic approach to theaccurate prediction of secreted virulence effectors in gram-negative bac-teria. BMC Bioinformatics 12:442. http://dx.doi.org/10.1186/1471-2105-12-442.

70. Buchko GW, Niemann G, Baker ES, Belov ME, Smith RD, Heffron F,Adkins JN, McDermott JE. 2010. A multi-pronged search for a commonstructural motif in the secretion signal of Salmonella enterica serovarTyphimurium type III effector proteins. Mol. Biosyst. 6:2448 –2458.http://dx.doi.org/10.1039/c0mb00097c.

71. Tay DM, Govindarajan KR, Khan AM, Ong TY, Samad HM, Soh WW,Tong M, Zhang F, Tan TW. 2010. T3SEdb: data warehousing of viru-lence effectors secreted by the bacterial type III secretion system. BMCBioinformatics 11(Suppl 7):S4. http://dx.doi.org/10.1186/1471-2105-11-S7-S4.

72. Arnold R, Brandmaier S, Kleine F, Tischler P, Heinz E, Behrens S,Niinikoski A, Mewes HW, Horn M, Rattei T. 2009. Sequence-basedprediction of type III secreted proteins. PLoS Pathog. 5:e1000376. http://dx.doi.org/10.1371/journal.ppat.1000376.

73. Gazi AD, Charova SN, Panopoulos NJ, Kokkinidis M. 2009. Coiled-coils in type III secretion systems: structural flexibility, disorder andbiological implications. Cell. Microbiol. 11:719 –729. http://dx.doi.org/10.1111/j.1462-5822.2009.01297.x.

74. Knodler LA, Ibarra JA, Perez-Rueda E, Yip CK, Steele-Mortimer O.2011. Coiled-coil domains enhance the membrane association of Salmo-nella type III effectors. Cell. Microbiol. 13:1497–1517. http://dx.doi.org/10.1111/j.1462-5822.2011.01635.x.

75. Ibarra JA, Knodler LA, Sturdevant DE, Virtaneva K, Carmody AB,Fischer ER, Porcella SF, Steele-Mortimer O. 2010. Induction of Salmo-nella pathogenicity island 1 under different growth conditions can affectSalmonella-host cell interactions in vitro. Microbiology 156:1120 –1133.http://dx.doi.org/10.1099/mic.0.032896-0.

76. Nikolaus T, Deiwick J, Rappl C, Freeman JA, Schroder W, Miller SI,Hensel M. 2001. SseBCD proteins are secreted by the type III secretionsystem of Salmonella pathogenicity island 2 and function as a translocon.J. Bacteriol. 183:6036 – 6045. http://dx.doi.org/10.1128/JB.183.20.6036-6045.2001.

77. Beuzon CR, Banks G, Deiwick J, Hensel M, Holden DW. 1999.pH-dependent secretion of SseB, a product of the SPI-2 type III secretionsystem of Salmonella typhimurium. Mol. Microbiol. 33:806 – 816. http://dx.doi.org/10.1046/j.1365-2958.1999.01527.x.

78. Raffatellu M, Wilson RP, Chessa D, Andrews-Polymenis H, Tran QT,Lawhon S, Khare S, Adams LG, Baumler AJ. 2005. SipA, SopA, SopB,SopD, and SopE2 contribute to Salmonella enterica serotype Typhimu-rium invasion of epithelial cells. Infect. Immun. 73:146 –154. http://dx.doi.org/10.1128/IAI.73.1.146-154.2005.

79. Van Engelenburg SB, Palmer AE. 2010. Imaging type-III secretionreveals dynamics and spatial segregation of Salmonella effectors. Nat.Methods 7:325–330. http://dx.doi.org/10.1038/nmeth.1437.

80. Maloy SR, Steward VJ, Talyor RK. 1996. Genetic analysis of pathogenicbacteria: a laboratory manual. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY.

81. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl.Acad. Sci. U. S. A. 97:6640 – 6645. http://dx.doi.org/10.1073/pnas.120163297.

82. Agbor TA, McCormick BA. 2011. Salmonella effectors: important play-ers modulating host cell function during infection. Cell. Microbiol. 13:1858 –1869. http://dx.doi.org/10.1111/j.1462-5822.2011.01701.x.

83. van der Heijden J, Finlay BB. 2012. Type III effector-mediated pro-cesses in Salmonella infection. Future Microbiol. 7:685–703. http://dx.doi.org/10.2217/fmb.12.49.

84. Nuccio S-P, Bäumler AJ. 2014. Comparative analysis of Salmonellagenomes identifies a metabolic network for escalating growth in the in-flamed gut. mBio 5(2):e00929 –14. http://dx.doi.org/10.1128/mBio.00929-14.

85. Swearingen MC, Sabag-Daigle A, Ahmer BM. 2013. Are there acyl-

SrgE Is a T3SS Effector

June 2014 Volume 196 Number 12 jb.asm.org 2311

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

homoserine lactones within mammalian intestines? J. Bacteriol. 195:173–179. http://dx.doi.org/10.1128/JB.01341-12.

86. Winter SE, Lopez CA, Baumler AJ. 2013. The dynamics of gut-associated microbial communities during inflammation. EMBO Rep.14:319 –327. http://dx.doi.org/10.1038/embor.2013.27.

87. Spees AM, Lopez CA, Kingsbury DD, Winter SE, Bäumler AJ. 2013.Colonization resistance: battle of the bugs or ménage à trois with thehost? PLoS Pathog. 9:e1003730. http://dx.doi.org/10.1371/journal.ppat.1003730.

88. Stecher B, Robbiani R, Walker AW, Westendorf AM, Barthel M, KremerM, Chaffron S, Macpherson AJ, Buer J, Parkhill J, Dougan G, von MeringC, Hardt WD. 2007. Salmonella enterica serovar Typhimurium exploitsinflammation to compete with the intestinal microbiota. PLoS Biol.5:2177–2189. http://dx.doi.org/10.1371/journal.pbio.0050244.

89. Stecher B, Maier L, Hardt WD. 2013. ‘Blooming’ in the gut: howdysbiosis might contribute to pathogen evolution. Nat. Rev. Microbiol.11:277–284. http://dx.doi.org/10.1038/nrmicro2989.

90. Bouwman CW, Kohli M, Killoran A, Touchie GA, Kadner RJ, MartinNL. 2003. Characterization of SrgA, a Salmonella enterica serovar Typhi-murium virulence plasmid-encoded paralogue of the disulfide oxi-doreductase DsbA, essential for biogenesis of plasmid-encoded fimbriae.J. Bacteriol. 185:991–1000. http://dx.doi.org/10.1128/JB.185.3.991-1000.2003.

91. Miki T, Okada N, Danbara H. 2004. Two periplasmic disulfide oxi-doreductases, DsbA and SrgA, target outer membrane protein SpiA, acomponent of the Salmonella pathogenicity island 2 type III secretionsystem. J. Biol. Chem. 279:34631–34642. http://dx.doi.org/10.1074/jbc.M402760200.

92. Heffernan EJ, Reed S, Hackett J, Fierer J, Roudier C, Guiney D. 1992.Mechanism of resistance to complement-mediated killing of bacteriaencoded by the Salmonella typhimurium virulence plasmid gene rck. J.Clin. Invest. 90:953–964. http://dx.doi.org/10.1172/JCI115972.

93. Heffernan EJ, Harwood J, Fierer J, Guiney D. 1992. The Salmonellatyphimurium virulence plasmid complement resistance gene rck is

homologous to a family of virulence-related outer membrane proteingenes, including pagC and ail. J. Bacteriol. 174:84 –91.

94. Mijouin L, Rosselin M, Bottreau E, Pizarro-Cerda J, Cossart P, VelgeP, Wiedemann A. 2012. Salmonella enteritidis Rck-mediated invasionrequires activation of Rac1, which is dependent on the class I PI 3-ki-nases-Akt signaling pathway. FASEB J. 26:1569 –1581. http://dx.doi.org/10.1096/fj.11-189647.

95. Rosselin M, Virlogeux-Payant I, Roy C, Bottreau E, Sizaret PY, Mij-ouin L, Germon P, Caron E, Velge P, Wiedemann A. 2010. Rck ofSalmonella enterica, subspecies enterica serovar Enteritidis, mediates zip-per-like internalization. Cell Res. 20:647– 664. http://dx.doi.org/10.1038/cr.2010.45.

96. Wiedemann A, Rosselin M, Mijouin L, Bottreau E, Velge P. 2012.Involvement of c-Src tyrosine kinase upstream of class I phosphatidyl-inositol (PI) 3-kinases in Salmonella Enteritidis Rck protein-mediatedinvasion. J. Biol. Chem. 287:31148 –31154. http://dx.doi.org/10.1074/jbc.M112.392134.

97. Habyarimana F, Swearingen MC, Young GM, Seveau S, Ahmer BMM.2014. Yersinia enterocolitica inhibits Salmonella enterica serovar Typhi-murium and Listeria monocytogenes cellular uptake. Infect. Immun. 82:174 –183. http://dx.doi.org/10.1128/IAI.00984-13.

98. Teplitski M, Al-Agely A, Ahmer BM. 2006. Contribution of the SirAregulon to biofilm formation in Salmonella enterica serovar Typhimu-rium. Microbiology 152:3411–3424. http://dx.doi.org/10.1099/mic.0.29118-0.

99. Teplitski M, Goodier RI, Ahmer BM. 2003. Pathways leading from BarA/SirA to motility and virulence gene expression in Salmonella. J. Bacteriol.185:7257–7265. http://dx.doi.org/10.1128/JB.185.24.7257-7265.2003.

100. Raffatellu M, Sun YH, Wilson RP, Tran QT, Chessa D, Andrews-Polymenis HL, Lawhon SD, Figueiredo JF, Tsolis RM, Adams LG, Baum-ler AJ. 2005. Host restriction of Salmonella enterica serotype Typhi is notcaused by functional alteration of SipA, SopB, or SopD. Infect. Immun.73:7817–7826. http://dx.doi.org/10.1128/IAI.73.12.7817-7826.2005.

Habyarimana et al.

2312 jb.asm.org Journal of Bacteriology

on Novem

ber 11, 2020 by guesthttp://jb.asm

.org/D

ownloaded from