the structure and function of dna chapter 10 transcription (dna rna) rna polymerase processing of...

The Structure and Function of DNACHAPTER 10The Structure and Function of DNACHAPTER 10• Transcription (DNARNA)

• RNA Polymerase

•Processing of Eukaryotic RNA

•Translation (mRNAProtein)

• The Three Types of RNA

• Codons and the Genetic Code

• Ribosomes

• Steps of Translation

•Mutation

Viruses: Genes in Small Packages

Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes

A segment of DNA (gene)

carries specific coded

instructions for the making

of a single proteins.

Genotype:The genes carried in a cell for a particular trait

Phenotype: The physical expression of genes for a particular trait

Transcription: From DNA to RNA• In transcription,

– Genetic information is transferred from DNA to RNA.

– An RNA molecule is transcribed from a DNA template.

Transcription

Figure 10.14

In Eukaryotes, the mRNA is Edited Before Leaving the Nucleus


• RNA Polymerase





• Ribosomes


•Mutation and Mutagens


=

3 Types of RNA – Each With a Different JobMessenger RNA (mRNA)

Carries copy of gene informationto the ribosome to make protein

anticodon

Ribosomal RNA (rRNA)

Part of the structure ofthe ribosome; key component in aminoacid linking machinery

CUG

C U G

Transfer RNA (tRNA)

Carries amino acids to the ribosome for linking; identified by anticodon “sign”


• RNA Polymerase





• Ribosomes




Figure 10.17

Anatomy of a Messenger RNA

Leader

Trailer

How Gene Instructions are Communicated

mRNA Codon Dictionary of the Genetic Code

DNA template strand:

CGTTTACGACCGGCCTTAGATCCTGACG

Central Dogma: DNARNAProtein

mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC

Transcription by RNA polymerase

Translation by ribosome

Protein: Met -

Leu -Ala -

Gly -Ile

Figure 10.16a

Figure 10.16b


• RNA Polymerase





• Ribosomes




Translation: The Process

• Translation is divided into three phases:

– Initiation

– Elongation

– Termination

Translation: Initiation

• Events of Initiation

1. The messenger RNA binds to the small ribosomal subunit

2. The two subunits of the ribosome come together

3. The first amino acid with its attached tRNA

Translation: Elongation

• Events of Elongation

– 1. The anticodon of an incoming tRNA pairs with the mRNA codon.

2. The ribosome catalyzes a peptide bond to form between amino acids

3. A tRNA leaves the P site of the ribosome

4. The ribosome moves down the mRNA (translocation)

Translation: Termination

• Events of Termination

1. Elongation continues until the ribosome reaches a stop codon.

2. The two subunits of the ribosome separate

3. The mRNA is released to be used again

4. The finished polypeptide (protein) folds up and begins functioning

Figure 10.10

Review: DNA RNA Protein

• The flow of genetic information in a cell


• RNA Polymerase





• Ribosomes


• Mutation

• Viruses: Genes in Small Packages

Mutations

• A mutation

– Is any change in the nucleotide sequence of DNA

– Is a permanent, heritable change

• Mutations may result from

– Errors in DNA replication.

– Physical or chemical agents called mutagens.

• Although mutations are usually lethal,

– They are the source of the rich diversity of genes in the living world.

– They contribute to the process of evolution by natural selection.

Figure 10.21

Base Substitution (Point Mutation)

DNA base substitutions can cause: missense, run-on, nonsense, and silent mutations in the resultant protein

Figure 10.22b

Insertions or Deletions of DNA nucleotides

Insertion/Deletions cause frameshift mutations in the protein (and often run-on mutations too)

Types of Mutation


• RNA Polymerase





• Ribosomes




Viruses: Genes in Packages

• Properties of Viruses

– They exhibit some, but not all, characteristics of living organisms

– They are made of DNA or RNA surrounded by a protein coating. Some also have envelopes outside their protein coat

– They are incredibly small (< 1 um)

– They are obligate intracellular parasites

– They they can only attack a small range of cell types (host specificity)

Viruses Come in Many Shapes

QuickTime™ and a decompressor

are needed to see this picture.

Helical Polyhedral Enveloped Complex

Figure 10.26

Bacterial Viruses Can Either Reproduce Immediately

or Hide Within The Host Cell and Emerge When the Host is Dying

Animal Viruses Often Have a Membranous Envelope with Protein Spikes

QuickTime™ and a decompressor

are needed to see this picture.

The influenza virus carries specific “spikes” that make them infective

Spikes are classified by Hemagglutinin (H) and Neuraminidase (N) types

e.g. H1N1

Figure 10.29

Simplified Viral Reproductive Cycle

Animal Virus Lifecycle

HIV, the AIDS Virus

• HIV is a retrovirus.

– A retrovirus is an RNA virus that reproduces by means of a DNA molecule.

– It copies its RNA to DNA using reverse transcriptase.

HIV Reproductive Cycle

Figure 10.30b

How Human Immunodeficiency Virus Attacks T White Blood Cells


• RNA Polymerase





• Ribosomes


•Mutation


the structure and function of dna chapter 10 transcription (dna rna) rna polymerase processing of...

Documents

rna polymerase translation

dna rna protein mrna

rna molecule

transcription slide

types of rna codons

dna genes

genetic code slide

mrna translocation slide