the trans-nih rnai initiative: informatics
TRANSCRIPT
![Page 1: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/1.jpg)
The Trans‐NIH RNAi Ini0a0ve Informa(cs
Rajarshi Guha
![Page 2: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/2.jpg)
Mission
• Gene func0on • Pathway analysis • Target ID • Compound MoA • Drug antagonist/agonist
To establish a state of the art RNAi screening facility to perform genome-wide RNAi screens with investigators in the intramural NIH community.
![Page 3: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/3.jpg)
RNAi Informa0cs Infrastructure
![Page 4: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/4.jpg)
• Summary sta0s0cs
• Correc0ons
QC
• Median • Quar0le • Background
Normaliza0on • Thresholding • Hypothesis tes0ng
• Sum of ranks
Hit Selec0on
• GO seman0c similarity
• Pathways • Interac0ons
Hit Triage
RNAi Analysis Workflow
Raw and Processed
Data
GO annota0ons Pathways Interac0ons
Hit List Follow‐up
![Page 5: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/5.jpg)
RNAi Informa0cs Toolset
• Local databases (screen data, pathways, interac0ons, etc).
• Commercial pathway tools.
• Custom soUware for loading, analysis and visualiza0on.
![Page 6: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/6.jpg)
Back End Services
• Currently all computa0onal analysis performed on the backend
• R & Bioconductor code • Custom R package (ncgcrnai) to support NCGC infrastructure – Partly derived from cellHTS2 – Supports QC metrics, normaliza0on, adjustments, selec0ons, triage, (sta0c) visualiza0on, reports
• Some Java tools for – Data loading – Library and plate registra0on
![Page 7: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/7.jpg)
User Accessible Tools
![Page 8: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/8.jpg)
User Accessible Tools
![Page 9: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/9.jpg)
Challenge – siRNA Design & Valida5on
• We mostly depend on quality controls implemented by vendor – siRNA design algorithms not a high priority
• Always interested in extra filters that help us get a reliable hit list
• Would like to have measures of – Off‐target effects – Protein half lives
![Page 10: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/10.jpg)
Challenge ‐ miRNA Target ID
• Screened a set of 885 human miRNA’s for CPT sensi0za0on
• Iden0fied 23 sensi0zing miRNA’s • But, we don’t have target informa0on
– Predic0ons aren’t par0cularly helpful – Poor overlap with siRNA hits
• Link pathogenic miRNA’s to human targets
miRAnda TargetScan
![Page 11: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/11.jpg)
Challenge ‐ RNAi & Small Molecule Screens
Goal: Develop systems level view of small molecule activity
• Reuse pre-existing MLI data • Develop new annotated libraries
TACGGGAACTACCATAATTTA
CAGCATGAGTACTACAGGCCA
• Run parallel RNAi screen
What targets mediate activity of siRNA and compound
Given a set of siRNA hits and their targets, is there a compound showing similar inhibition
Target ID and validation
Link RNAi generated pathway peturbations to small molecule activities. Could provide insight into polypharmacology
![Page 12: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/12.jpg)
Challenge – RNAi Meta Analyses
• Building up a collec0on of screens – Across cell lines, species, … – Not necessarily “designed”
• What do we do with this? – Iden0fy consistent markers – Characterize differences between cell lines
– Extrapolate from gene knockdown to pathway and higher level differences
– Merge with gene expression data
![Page 13: The Trans-NIH RNAi Initiative: Informatics](https://reader034.vdocuments.net/reader034/viewer/2022052321/554e9b65b4c905fc368b526c/html5/thumbnails/13.jpg)
The People
• Scoh Mar0n • Pinar Tuzmen
• Dac Trung Nguyen • Yuhong Wang
RNAi
Small Molecules