the transcription of dna in chicken mitochondria initiates from one

THE JOURNAL OF BIOLOGICAL CHEMISTRY (c) 1991 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 266, No. 17, Issue of June 15, pp. 10844-10850,1991 Printed in U.S.A.

The Transcription of DNA in Chicken Mitochondria Initiates from One Major Bidirectional Promoter*

(Received for publication, November 26, 1990)

Denis L’AbbeS, Jean-Frangois Duhaime, B. Franz Lang, and Rejean MoraisQ From the Departement de Biochimie, Faculte de Medecine, Uniuersite de Montreal, C. P. 6128, Succursale A, Montreal, Quibec, Canada H3C3J7

Transcription start sites of chicken mitochondrial DNA have been mapped in the control region by direct sequencing of in vitro capped mitochondrial RNA species, by primer extension and by S 1 nuclease protection analysis. Transcription of the heavy strand initiates predominantly at a site 156 nucleotides upstream of the tRNAPhe gene, i.e. about 135 nucleotides further upstream than the corresponding sites in amphibia and mammals. On the opposite strand, transcription starts predominantly one nucleotide removed from the site in the heavy strand. The L-strand position start site is similar to that found in other vertebrates. The chicken mitochondrial DNA control region thus contains one major transcriptional promoter, whose bidirectional capacity is similar to the situation in amphibia but which contrasts to the mainly unidirectional capacity of mammalian promoters. In chicken mitochondria, the sequence comprising the start sites is A+T rich and contains an almost perfect inverted repeat which can be folded into a cruciform structure. The heavy and light strand initiation sites are flanked on their respec- tive 3‘ ends by an octanucleotide sequence matching those surrounding the start sites in Xenopus laevis (5’- ACPuTTATA-3’). This motif is found associated with the H-strand start sites in mouse but is not present in human nor bovine mitochondrial DNA promoters.

The mitochondrial genome (mtDNA)’ of vertebrates is a small, compact, closed circular molecule of about 16 kilobases containing an identical set of 37 genes specifying 13 proteins, two rRNAs and 22 tRNAs encoded in both the heavy (H) and light (L) DNA strands (see Ref. 1 for review). The gene organization is the same in all vertebrate mtDNAs sequenced thus far, except for birds (2). Size variation among vertebrate mtDNAs is mainly due to the number of nucleotides in the control region of each species. This region, the major noncod- ing segment of vertebrate mtDNAs, spans the area between the genes for tRNAPr” (tRNAG’” in birds) and tRNAPhe, and contains the H-strand replication origin and the promoters

* This work was supported by grants from the Medical Research Council of Canada (to R. M. and B. F. L. ) and the FCAR of QuCbec (to B. F. L.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Recipient of a Fellowship from the Cancer Research Society Inc., Montreal.

3 To whom correspondence should be addressed. I The abbreviations used are: mtDNA, mitochondrial DNA;

mtRNA, mitochondrial R N A D-loop, control region; H- and L- strand, heavy- and light-strand CSB1, conserved sequence block 1; D-stem, dihydrouridine stem; PIPES, 1,4-piperazinediethanesulfonic acid.

for both the H- and L-strands (see Ref. 3 for a review). In mammalian and amphibian mtDNAs (4-9), the H-strand transcriptional initiation site is located within 35 nucleotides upstream of the gene for tRNAPhe, and -70-120 base pairs downstream of the L-strand start site. Both human and mouse mtDNAs have independent, predominantly unidirectional promoters for transcription of the individual strands (10-12). Important bidirectional transcription in these species is observed only in vitro, whereas i n vivo the opposite strand is transcribed at a much lower rate (13). In contrast, the major promoter identified in Xenopus laeuis has been shown to be fully bidirectional i n vivo, while a minor one gives predominantly rise to L-strand transcripts and only exerts weak bidirectionality i n vitro (9, 14, 15). Bidirectional transcription in X . laevis mtDNA appears to result from the symmetrical arrangement of a consensus sequence within the promoter region (9).

As mitochondrial transcription initiation revealed important differences between amphibia and mammals, we inves- tigated which type of mitochondrial promoters prevails in chicken. The localization of H- and L-strand initiation sites was assessed by S1 nuclease protection and primer extension analysis and by the sequencing of mtRNA transcripts capped i n vitro by the vaccinia virus guanylyl transferase. The results obtained indicate that transcription of both mtDNA strands initiates from one major bidirectional promoter, reminiscent of the situation in amphibia.

MATERIALS AND METHODS

Isolation of Liver Mitochondria-Liver mitochondria from white Leghorn chickens were obtained by differential centrifugation as described previously (16), and further purified on a discontinuous sucrose gradient according to Bogenhagen and Clayton (17). The mitochondrial fraction collected from the gradient was diluted with two volumes of water and centrifuged. The pellet was resuspended in homogenizing buffer, quick-frozen on dry ice and kept at -70 “C until used.

Preparation and Capping of mtRNA-Mitochondria were lysed by the addition of 2% Sarkosyl and nucleic acids were isolated by repeated phenol-chloroform extractions. Following ethanol precipi- tation, the preparations were enriched in high molecular weight mtRNAs by LiCl treatment (18). RNA was then ethanol-precipitated repeatedly, dissolved in water and stored at -70 “C.

MtRNA (300 pg) was lyophilized and resuspended in 11 pl of 5 mM methylmercuric hydroxyde (19). It was capped in vitro using 230 pCi of [a-’”P]GTP (Amersham Corp., 3000 Ci/mmol) and 20 units of guanylyl transferase (Bethesda Research Laboratories) according to the supplier’s recommendations. The reaction was stopped by the addition of 0.2% sodium dodecyl sulfate, followed by a phenol-chloroform extraction. The capped mtRNA preparation was ethanol- precipitated three times, resuspended in 30 p1 of RNase TI digestion buffer (6.7 M urea, 20 mM sodium citrate, pH 5.0, 1 mM EDTA, 0.04% xylene cyanol, 0.04% bromphenol blue), and partially digested at 50 “C for 10 min with 10 units of RNase TI (Pharmacia LKB Biotechnology Inc.).

For filter hybridization, 30 pg of mtRNA were capped with 60 pCi

10844

Transcription in the Chicken Mitochondria 10845

nltl)NA I ' ragmrnt o f t h ( ~ w n t rol rc$on. pritnwi \ v i t l l thr. olicot111rIw otitlrs ~ t s ( ~ 1 in tht. prin1c.r ext(Lnsiot1 rwc t i on .

HESOLTS

Chppcd Transcripts of ('hickm rn!l).VA J f u p I'rIn~rtrIl~, / ( J

thc ( 'ontrol R~~~ion-Transcription initiation sitw o f chickon mtDNA were mapped hy met hods s ~ ~ c c w s f r ~ l l y r lscd i n yeast and a numher ofvertehrate species ( 4 , 5. 9. 1 9 . 221. \ltl)SA primary transcripts which are not capped i n l i l w (21 can he capped in t?itro hy the vaccinia kqlanylyl fransferase ant1 [(Y-""I']GTP. 1,aheled transcripts were r~sed as a prol)r* i n hyhridizations with filter-hound rest rict ion fragnwnt s o f ' mtDNA. Fig. 1 shows that in chicken-capped mtltS.4 transcripts hyhridize primarily to the control region. Faint hybridization t o fragments not containing the control rryion was also detected indicating the presence o f some o t hear cappahle RNA species in the mt IINA preparations. A s ;lIrrntly suggested for X . Inc~lis ( 9 ) . these faint hands may reflect cit hc.r hyhridization of long stahle precursor transcripts initiated within the control region or transcripts initiated in othrr regions of the chicken mitochondrial genome. Altc*rmtively. mtliNA species with cappahle 5' ends could he generated through the maturation process of H - o r I,-strand transcripts. as documented for chicken mitochondrial tRNA"" ( 1 6 ) .

To determine more precisely from which part o f t he r o n t rol region the capped RNA species are derived, we hyhridizerl

A 1 2 3 4 5 6 7 8 Kb

4.4 - 0

2.7 - 2.1 -

1.6 -

0.7 -

10846 Transcription in the Chicken Mitochondria

capped RNA to single-stranded DNA prepared from M13 subclones covering that region (Fig. 2). Strong signals appeared only with the H-strand mtDNA (Fig. 2 A ) , suggesting a significantly higher steady-state level of primary H-strand transcripts than that of the L-strand. No hybridization was found with H-strand subclone 10, which contains a par t of t,he 12 S rRNA gene exclusively. The signal intensity obtained with subclone 9, which does not contain any control region sequence either, was substantially weaker than that for subclone 8, suggesting that transcription starts on the H-strand sequence in a 200-hase pairs long stretch between the 3' ends of mtDNA fragments 8 and 9. For the I,-strand, weak hybridization was detected in lanes 11 to 14 suggesting that transcription starts on the L-strand between the 3' ends of the mtDNA inserts 14 and 15. These observations indicate that in chicken as well as in other vertebrates, the transcriptional initiation sites for both mtDNA strands are located close to the gene for tRNA"'"' (Fig. 2C).

Prwisc. 5' End Mapping of H-strand Transcripts-In order

A 1 2 3 4 5 6 7 8 9 10 1 1 12 13 14 15 16 17 18

" *

C IO ~

9 H- STRAND 8 7 6 5 4

1 0 0 b H

3 5' 3' 125 rRNA F ti- STRAND E ND6.w

I I 1772 1228 1-STRAND I 16476

3 (16775) 5' 11 I2 13 14 IS 16 17

- 18 1-STRAND

FIG. 2. Hybridization of capped mtRNA to DNA fragments in the control region. A tlnd I < , single-stranded phage 1)NAs ~ ~ ~ l : ~ n ~ ~ ~ H o r t n p I I ~ ~ c r ~ n t a i n i n g t h r e n t i r e o r p a r t o f t l ~ e r o n t r o l r e g i o n . were hvhridized t o in r'itro c;lpped mtIIN.4. In A , Innrs .7-10 correspond to phage D N A s containing mtI)NA H-strand sequences. /,ants I and 2 correspond to the Ml:<rnp19 and M1:lmpH vector I)NA respect ivelv serving as ront rols. In H , lnncs 1 l-lr(corrcspond to phage I)NAs containing mtl)NA I,-strand sequences. The leng-th, position, ; ~ n d orientation o f thr mtI)NA inserts o f the phages are outlined in ('. T h e hold middle line represents t he control region contained within mtI)NA fragment X (Fig. 113). tIINA"'"' (1:) and tIINA'"" (fi;) genes, and part of the 12 S rRNA and N I K genes are included. Nucleotide 1 marks the 5' end ofthc, control region, immediately adjacent to the :<' end of the tRNA'"" gene at nucleotitle 16,775 (2) . 12 S rRNA and t IINA"'"' genes arc H-st r;lnd-enrotletl, where.as t IINA'"" antl ND6 genes are I,-strand-encodrd. The nrrorcs indicate the direction of transcript ion o f the H - and I.-strands, respectively. Numbers on each side ofpnncl (' refer t o the phage I)NAs in A and H . Each horizontnl linr represrnts the Ienkeh (to scale) o f t h e H - o r I,-strand rntI)NA srquenre ront;linrtl within the respect ive phage 1)NA.

to exactly define the number and the position of the initiation sites in the control region, we have isolated and sequenced in oitro capped mtRNA species. When in vitro capped chicken mtRNA is fractionated on polyacrylamide gels, three abun- dantly labeled products of approximately 3 0 0 . 125, antl 75 nucleotides are seen, together with some weakly labeled RNA species (16). The 300 and 125 nucleotide products are contam- inations of cytoplasmic 7SL RNA and 5 S R S A , respectively. and the 75 nucleotide product is mitochondrial tRNA"" (16). Since the minor products of variable size might be difficult to sequence because of their weak radiolabel, capped mtRNA preparations were first submitted to par t ia l RSase T, digestion and gel fractionation. Selected fragments were then sequenced, as has been carried out to map transcription start sites in $9. cmwisiae mtDNA (22). Figs. 3 and 7 show that the sequence of a 32-nucleotide long fragment transcribed from the H-strand has a 5' end which maps at nucleotide 1072, 156 bases upstream from the tRNA"'"' gene. Another 1 I-nucleotide long fragment is transcribed from the same strand and st,arts at nucleotide 1074. We failed to find any I,-strand transcript using this method, either due to the low steady- s ta te level of L-strand transcripts (Fig. 2 R ) or to their ability to be labeled.

The sensitive primer extension and S1 nuclease protection methods were used to search for other initiation sites in the control region. Using primer H1 (see Table I and Fig. 7) to prime the extension reaction, a product was detected which has a migration consistent with the RNA sequencing data (Fig. 4.4, l a m 2, hand a ) . A longer migration (Fig. 4N) per- mitted the resolution of three major bands located at nucleotides 1071, 1072, and 1074, and a minor one at nucleotide 1076. T h e 5' end of the primary transcripts was precisely

PhY 11 UI 1 M B.c.

""

G-

U-

A- U-

U- U- A-

C - A -

U- A-

U-

A-


" Nucleotide numhers refer to Fig. 7. " All prohes and primers are "'1' laheled at their 5' end.

A I Z G A T C

I

Fig. 7) . These results confirm those obtained with primer HI. Upstream of the 5' end of the tRNA"'"' gene (hand h in Fig. S A ) , a series of extended products are detected at positions which correspond to those seen in Fig. 4.4. T h e most intense one has a 5' terminus at nucleotide 1072 k :1 (hand c ) . SI nuclease assays using 5' end-labeled prohe A (see Tatde I ) confirmed these results. Two protected fragments are seen. one ending at the 5' terminus of tRNA"'"', at nucleotide I229 & 3 (Fig. 5H, hand h ) , the other at nucleotide 1072 k :3 (hand c). In addition to the latter band, other closely spaced hands are detected in this region of the gel and may represent SI nuclease nibbling at the A+T-rich end of the RNA-DNA hybrids (23). After prolonged exposure of the filters. very h i n t hands are detected upstream of the gene for t RXA"''", at positions that coincide with those seen with primers HI and H2. These observations suggest that a H-strand transcript is initiated at nucleotide 1072 f 4 on chicken mtl)NA and extends into tRNA"'"' and likely into 12 S rRNA as well. This primary transcript is processed at the 5' terminus of tRNA"'"', and possibly at other positions between tRNA"'"' and the initiation site of the transcript.

A few extended products migrate between primer H2 and band b (Fig. SA) . The most intense one, designated a. maps at posit ion 1238, which correspond to the first nucleotide of the tRNA"'"' D-stem. Protected fragments are seen at those positions in S1 nuclease assays, the most intense of which maps a t nucleotide 1238 (Fig. 5H, hand a ) . These ohservations suggest the possibility that an additional transcription initiation sites resides in the H-strand. Alternatively, small, proc-

C - 4 primer

C-

FIG. 4. Primer rxtension mapping of 5' ends of H-strand transcripts using prohe H I . A , the 5' end-lnheletl single-stranded primer HI (see T n I ) l e 1) was annealed to DNase-treated mtRNA and extended using avian m.velol)lastosis virus reverse transcriptase. Lanes: I , no mt RNA; 2, 10 pg 0 1 mt RNA; (;, A , '/', and C,', a dideoxv- nurleotidr sequence ohninetl t)v extending prohe H1 on M I 8 phage I)NA subclone 1 1 (Fig. 2('). Positions ofthe unextended primer and t hat nl t he major extension product n are shown bv arrowhmds. H , longer migration of' the samples in A , for a more precise mapping of the major extension product n. Lane description is as in A.

identified by the use of a sequence ladder run in parallel and obtained by extension of primer H1 on M13 subclone 11 (see Fig. 2C). Multiple origins at. H-strand transcription sites have also been reported for human (5) and bovine (8) mtDNAs, although, in all cases, the heterogeneity observed could be due to incomplete primer extension near the 5' end of the RNA template.

Resides the major extension products, multiple weakly labeled pr0duct.s are seen which run faster than band a (Fig. 4A, / a m 2) . T h e large number of these pr0duct.s suggests that t,hey arose from site-specific pausing of the reverse transcriptase or from extension of RNA templates from degraded primary transcripts. A furt.her extension experiment was performed using primer H2 whose sequence spans the segment between the 5' end region of the 12 S rRNA gene and the adjacent 3' end region of the tRNA"'"' gene (see Table I and

b- a-

. - . -


essed tRNA”’“’ transcripts could account for the results ohtained.

.5’ End Mapping of L-strand Transcripts-Results from the hybridization of capped RNAs to single-stranded mtDNA fragments (Fig. 2H) showed that the L-strand transcriptional origin is located in the same region as tha t of the H-strand. Primer extension assays further delimited this region to a few nucleotides on t,he L-strand DNA segment facing the H- strand transcriptional origin. Using primer L1 (see Table I and Fig. 7) to prime the extension reaction, a major product is detected, the 5’ end of which maps at nucleotide 1071 & 1 (Fig. 6A, band a ) . A few minor products appeared as well which are a few bases longer than the major one. Similar results were obtained using primer L2 (data not shown) whose sequence is complementary to part of t,he putative CSRl (see Table I and Fig. 7). Ot.her faint bands are seen above those at 1071-1076, hut these products are not detected upon S1 nuclease digestion (Fig. 6!3) using probe R (see Table I) . Protected fragment,s of -70 nucleotides long are seen (band a ) and represent protection by transcripts which end at nucleotide 1071 & 2, at the same posit ion as tha t of the major product extended from primers L1 and L2.

DISCUSSION

Our data show that in chicken the major sites for transcription initiation of both the H- and L-strands reside in the control region of t.he molecule. The s t a r t sites are located upstream of the gene for tRNA”’”’, similar to the situation in amphibia and mammals. Hybridization of capped mtRNA to filter-bound H- and L-strand DNA suggests that the steady-

A G A 1 T C 2

:

p,im.r, 4c-L Flc. 6. Mapping of I , -str;~nd transcripts by primer exten-

sion and SI nuclease protection methods. A , primer extension was performed with the 5’ entl-l;llwled single-stranded primer I,l (see ‘I*d)le I). I,nnc.s: 1, 10 pg of mtI<NA; 2, no mt RNA; (;, A , 7: and C , dideoxynucleotide sequence ohtained hy extending prohe I,1 on MI.? phage DNA sulx-lone 3 (Fig. 2 ( ’ ) . I’ositions oft he unextended primer and that of the major extension product n are shown Ily orrrm~l~mds. H , SI nuclease protection w i n g prohe R (see Tahle I ) . h n c s : (;, A , ‘/’, and c‘, same as in A ; I , I O pg o f mtRNA: 2, mock reaction; .‘I, untreated prohe. The pnsition o f the major protected product n is shown by an orrorc~hc.nd.

721 GCCTGGACTACACCTGCGTTGCGTCCTATCCTAGTCCTCTCGTGTCC~CGATCACAC~~

781 TTTGCGTGTATGGGGMTCATCTTGICICTGATGCACA~GATCCA~GGATCCCATTTCCTTATCCT c s e 1

8 4 1 TCTTCCACCCCCCCGGTAMTGGTG A ~ A G T G M T ~ ; C X C T C C G A C A T A ~ T A T C F p r o b e L2 ,

901 M m T C A C T T C C T C T A T T T T C C A C ~ f f A G G M T T C A C C A C M ~ T - C - T G

9 6 1 T T A T T T T T T M T T T T T T m T A ~ T T ~ C A ~ ~ ~ ~ ~ A C A ~ A C -

prohr L!

102 1 A A A C T A C C G C A T - T C C c T c M C T A T A c ~ c ~ ~ ~ T ~ T A T ~ T ~ ~ ., I~

1 0 8 1 A T TTTATTCTATCATTATTAGAGMCTCCACTACCAAMCCATCATTAAAACMAAA 3 1 1 4 1 TTTACATGCCACTTMCTCCCCTCACMCMTCGTTATTTATA~GTTMTTAGCA~C

c 4 t R N A Phe 1201 ACAAAACCCCCCTTCTACCACTATAAACCCCCCATAGCTTMCCCACAAAGCAT~~CAC~

probe H i

1261 C M G A T G C C A A G A T G G T A C C T A C T A T A C C T C T C C G C ~ G A C ~ A G T C C T ~ C C T ~ ~ C ~ * * 12s r R N A

probe H2

1 3 2 1 ATTGGTTTTTGCTACACATATACATGCAACTATCCCCITCCGCATCCCAGTC-TCCCCCCMA

FIG. 7. Nucleotide sequence of a mtDNA segment containing the transcriptional start s i tes . ‘ I ’ h e I,-str;lntl sc.qwnrr ol chicken mt1)NA is nurnhvrcd 21s reported ( 2 ) . The enccdc4 I RSA”’“ antl I 2 S rRNA genes are delimited hy nslcrishs t o intliwtr. the putative 5’- antl :l’-enroded nucleotides. ’The putative (‘Sl(l rlnd t t w octamers flanking the start sites arc h o x r d . I’osition o f thr extension primers H1, H2, L 1 , and 1 2 are undcrlincd and thfair Iwlarity indicated hy nrrows. H/nc/; and u , h i f c , lings identify 11. and I,.str:~nd transcriptional initiation sites, respectively. l’nlarity 01 t h c . protws used for primer extension are given by the nrrows.

state level of the H-strand transcripts in chicken mitochondria is higher than that of the L-strand. This view is also supported by primer extension experiments using H- and 1,- strand-specific oligonucleotides as primer. These results are in contrast to those reported for amphibia and mammals where cappahle L-strand primary transcripts are more ahun- dant than those of the H-strand ( 7 , 9). T h e different levels of primary H- and L-strand transcripts in chicken can he due to differences in the promoter strength or in the processing rate of the nascent transcripts.

In amphibia and mammals, the major H-strand initiation site resides within a 35-nucleotide stretch immediately pre- ceding the tRNA”h” gene. This location contrasts to that in chicken where this site maps 156 bases upstream of the

presence of a potential open reading frame coding for a polypeptide 26 amino acids long using ATG as the initiation codon. Furthermore, there are two stretches of 11 nucleotides each upstream of the open reading frame with a 10 out of 11 match to two complementary sequences in the 3‘ end region of chicken 12 S rRNA (Fig. 8 A ) . These sequences are not found elsewhere in the chicken mitochondrial genome. The corresponding RNA is 155 nucleotides long, contains a universal stop codon encoded in mtDNA, and is relatively ahun- dant as judged by primer extension analysis. A similar RNA is found in human HeLa cell mitochondria and has been termed“7 S RNA” on the basis of its sedimentation coefficient (24). The 7 S RNA, which also contains a universal stop codon encoded in mtDNA, is polyadenylated and is the most abundant poly(A)-containing mtRNA in HeLa cells. I t also contains an open reading frame for a potential protein of 23 or 24 amino acids and an 11-nucleotide sequence is present near its 5’ end that is complementary to the 3 ’ end of human 12 S rRNA. A portion of the 7 S RNA is found associated with the mitorihosomes, hut it is not known whether the 7 S RNA is translated. On the other hand, the non-polyadenylated 7 S RNA in human as well as related sequences in other vertebrates (25, 26) are believed to prime both the replication

t ~ ~ ~ l ’ l ~ ~ gene. Sequence analysis of this interval reveals the


A 2056 2046

1072 Putative “?sRNA” 5‘ A T A T A C A T T A T T G T T T A T T C T A T C A T T A T T ... 3‘

12s rRNA 3’ ... C A A A C A A G A T A... 5’ 1101 I l l 1 I I I I I I

12s rRNA 3‘ ... A A G A A A G T A A T... 5‘ I I I I I I I I I I

FIG. 8. Sequences implicated in potential physiological activities. A, sequence complementarity between the 12 S rRNA and the presumptive 7 S RNA of chicken. Two 11-nucleotide long B regions of the 12 S rRNA are indicated, along with the possible base-pairing to the primary H-strand transcript. Nu- cleotide numbering is as reported (2). B, sequence of the inverted repeat at the transcriptional initiation region of the chicken mtDNA (nucleotides 1065-1082, see Fig. 7). C , putative cruciform second- C ary structure of the sequence shown in R. A few flanking nucleotides are also included. The L-strand (I,,) and H- strand (I,) transcriptional start site regions are indicated; asterisks mark the 5’ ends of in vitro capped and sequenced H-strand transcripts. The octamers flanking the start sites are ouerlined. Pu, purine; Py, pyrimidine.

1960 1950

1, I * * ‘

5‘ A T A A T P u T A T A T A P y A T T A T 3’

L-strand 5‘ H-strand 3‘

of the H-strand and transcription of the L-strand. This would likely not be the case for the putative chicken H-strand 7 S RNA-like sequence.

In human mitochondria, a capped H-strand transcript species has been mapped about 30 nucleotides upstream from the 3’ end of the structural tRNAPh“ gene (4). In uitro studies of transcription kinetics in human HeLa cells have added to this finding suggesting the presence of an additional H-strand promoter in the tRNAPhe gene (27). This promoter is believed to initiate the transcription of almost the entire H-strand. The other, more active promoter, located just upstream of the tRNA’Ihe gene would initiate the transcription of a polycis- tronic molecule that terminates at or near the 3‘ end of the 16 S rRNA. In bovine and X. laeuis mitochondria, primer extension experiments have indicated the presence of an additional transcription initiation site in the structural gene for tRNA’h‘ (8, 9). However, S1 nuclease assays failed to confirm these results and suggested that the extended products arose through site-specific pausing of the reverse transcriptase in the RNA templates. In chicken, both primer extension and S1 nuclease protection give bands which map within the structural gene for tRNAPh‘ at the same positions as in bovine and X . laeuis. As no chicken-capped RNA species mapping in this region has been sequenced, it is difficult to conclude that an additional H-strand transcription start site is present in the gene for tRNAPh‘.

The major L-strand transcriptional initiation site maps 1 base pair from that of the H-strand. As in the case of the H- strand, initiation occurs within the space of a few nucleotides, but there is no evidence that L-strand transcription initiates at an alternate position in the control region. It has been shown in other vertebrates that the L-strand start site serves both for the transcription of the L-strand, and for the replication of the H-strand. The origin of the H-strand in chicken is located in the immediate vicinity of CSBl at nucleotides 870-892 (2), a distance from the L-strand start site about the

U

1,

A

:AT T A* :*I In : :IL G C

CGTTTATC ATTATTGT 3’ GCAAATAG TAATAACA 5‘

1: ; T A A T T A

T T

A T

same as that seen in other vertebrates (-170 nucleotides). Contrary to the situation in human mitochondria, no open reading frame is found within this sequence.

The sequence encompassing the bidirectional promoter in chicken mitochondria contains an almost perfect inverted repeat with a 16 out of 18 match (Fig. 8B). We suggest that the bidirectional character of the chicken mitochondrial promoter results from the symmetrical arrangement of this sequence which can be folded into a cruciform structure (Fig. 8C), with the major H- and L-strand initiation sites posi- tioned into the loops. In X. laeuis, bidirectional transcription appears also to result from the symmetrical arrangement of a consensus sequence within the promoter region (9). The sequence is eight nucleotides long (5’-ACPuTTATA-3’), sur- rounds the start site, and is an essential promoter element (15). This octanucleotide presents a six or seven out of eight match with two sequences comprised within the chicken inverted repeat. One of the octanucleotide (5’-ACATTATT-3’) flanks the 3‘ end of the H-strand initiation site and the other (5’-ACGATAAA-3’) that of the L-strand. A similar motif is found in the H-strand promoter region in mouse. Computer searches for matches to the octanucleotide at other sites within the chicken mtDNA sequence revealed three locations. However, none of these sites are flanked by an A + T-rich sequence similar to that found in the control region inverted repeat.

Chicken mtDNA is thus far unique in having one major bidirectional promoter. Other vertebrates have either several bidirectional ( X . laeuis) or two, mainly unidirectional (mouse, cow, human), promoters. Mitochondrial transcription studies of further bird species as well as reptilia will be needed to determine whether this arrangement has occurred in the vertebrate lineage giving rise to birds or whether it is more ancient.

Acknowledgments-We are indebted to P. Desjardins for providing the chicken mtDNA plasmids and phages and Y. Villeneuve for the


illustrations. We also thank K. Nicoghosian for helpful hints in RNA sequencing, and G. Burger and Robert Cedergren for critical reading of the manuscript.

REFERENCES

1. Attardi, G. (1985) Int. Reu. Cytol. 93, 93-145 2. Desjardins, P., and Morais, R. (1990) J. Mol. Bid. 212, 599-634 3. Clayton, D. A. (1984) Annu. Reu. Biochem. 53, 573-594 4. Montoya, J., Christianson, T., Levens, D., Rabinowitz, M., and

Attardi, G. (1982) Proc. Natl. Acad. Sci. U. S. A . 79, 7195- 7199

5. Yoza, B. K., and Bogenhagen, D. F. (1984) J. Biol. Chem. 259,

6. Chang, D. D., and Clayton, D. A. (1986) Mol. Cell. Biol. 6, 1446-

7. Bhat, K. S., Avdalovic, N., and Avadhani, N. G. (1989) Biochem-

8. King, T. C., and Low, R. L. (1987) J. Biol. Chem. 262, 6204-

9. Bogenhagen, D. F., Yoza, B. K., and Cairns, S. S. (1986) J. Biol.

3909-3915

1453

istry 28, 763-769

6213

Chem. 261,8488-8494 10. Chang, D. D., and Clayton, D. A. (1984) Cell 36, 635-643 11. Chang, D. D., and Clayton, D. A. (1986) Mol. Cell. Biol. 6,3253-

12. Chang, D. D., and Clayton, D. A. (1986) Mol. Cell. Biol. 6, 3262-

13. Chang, D. D., Hixson, J. E., and Clayton, D. A. (1986) Mol. Cell.

3261

3267

Biol. 6, 294-301

14. Bogenhagen, D. F., and Yoza, B. K. (1986) Mol. Cell. Biol. 6,

15. Bogenhagen, D. F., and Romanelli, M. F. (1988) Mol. Cell. Bid.

16. L’Abbe, D., Lang, B. F., Desjardins, P., and Morais, R. (1990) J.

17. Bogenhagen, D., and Clayton, D. A. (1974) J. Biol. Chem. 249,

18. Nagley, P., and Clayton, D. A. (1980) Nucleic Acids Res. 8,2947-

2543-2550

8,2917-2924

Biol. Chem. 265, 2988-2992

7991-7995

2965 19. Levens, D., Ticho, B., Ackerman, E., and Rabinowitz, M. (1981)

20. Donis-Keller. H.. Maxam. H.. and Gilbert. W. (1977) Nucleic J . Biol. Chem. 256,5226-5232

, ,

Acids Res. 4, 2527-2538

Nucleic Acids Res. 5, 637-651

Rabinowitz, M. (1982) J. Bid. Chem. 257, 6494-6500

21. Grohmann, K., Almaric, F., Crews, S., and Attardi, G. (1978)

22. Christianson, T., Edwards, J., Levens, D., Locker, J., and

23. Weaver, R. F., and Weissmann, C. (1979) Nucleic Acids Res. 7,

24. Ojala, D., Crews, S., Montoya, J., Gelfand, R., and Attardi, G.

25. Chang, D. D., Hauswirth, W. W., and Clayton, D. A. (1985)

26. Cantatore, P., Loguercio-Polosa, P., Mustich, A., Petruzella, V., and Gadaleta, M. N. (1988) Curr. Genet. 14, 477-482

27. Montoya, J., Gaines, G. L., and Attardi, G. (1983) Cell 34, 151- 159

28. Glaus, K. R., Zassenhaus, H. P., Fechheimer, N. S., and Perlman, P. S. (1980) in The Organization and Expression of the Mito- chondrial Genome (Kroon, A. M., and Saccone, C., eds) Vol. 2, pp. 131-135, Elsevier Scientific Publishing Co., New York

1175-1193

(1981) J. Mol. Biol. 150, 303-314

EMBO J. 4, 1559-1567

the transcription of dna in chicken mitochondria initiates from one

Documents