thesis xiaodong li
Post on 24-Nov-2015
124 views
DESCRIPTION
Paenibacillus strains 32O-W and 32O-Y were attempted to be transformed by electroporation with constructed plasmid pNW33N-vgb, modified to contain the vgb gene which can be expressed as Vitreoscilla hemoglobin. Only attempts with 32O-Y were successful. Transformed 32O-Y/pNW33N-vgb was grown in CDM medium with dibenzothiophene (DBT) as the sole source of sulfur at different temperatures. Dramatic variability was observed in culture at different temperatures, so only the data at 45 °C was analyzed. The growth assay showed that the 32O-Y/pNW33N-vgb strain grew slower than untransformed 32O-Y, although Gibbs assay showed improvements in utilizing ability of DBT of 32O-Y/pNW33N-vgb compared to untransformed 32O-Y. This finding indicated that genetic engineering of introducing vgb into 32O-Y may cause deterioration in cell growth rate but improvement in desulfurization activities.Plasmid pUC-vgb-M2 was transformed into E. coli DH5α. The transformed DH5α/M2-vgb was cultured along with DH5α/pUC8:16, bearing plasmid pUC8:16 that was previously constructed in our lab and can be expressed to produce wild type VHb, and untransformed DH5α. CO-difference spectra were performed with the lysed cultures for the detection of VHb expression. As a result, DH5α/M2-vgb was confirmed to lack the ability to express functional VHb.TRANSCRIPT
-
VITREOSCILLA HEMOGLOBIN: STRUCTURE-FUNCTION AND GENETIC
ENGINEERING STUDIES
BY
XIAODONG LI
DEPARTMENT OF BIOLOGICAL AND CHEMICAL SCIENCES
Submitted in partial fulfillment of the
requirements for the degree of
Master of Science in Biology
in the Graduate College of the
Illinois Institute of Technology
Approved _________________________
Adviser
Chicago, Illinois
May 2014
-
iii
ACKNOWLEDGEMENTS
My deepest gratitude goes to Dr. Benjamin Stark for his patience, advice and
support through my study. Dr. Stark is the best teacher Ive ever met, he helped me out
during my darkest time and gave me so much confidence in order to finish my graduate
study at IIT.
My appreciation extends to my labmates, especially Yang Chen, Nan Bai and
Stephanie Kunkel for their help both in lab and life. They contributed a lot in my thesis
work and helped me solve a lot of problems. Im also grateful for Jia Wangs help in my
writing.
-
iv
TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS ...................................................................................... iii
LIST OF TABLES ................................................................................................... vi
LIST OF FIGURES ................................................................................................. vii
LIST OF SYMBOLS ............................................................................................... viii
ABSTRACT ............................................................................................................. ix
CHAPTER
1. INTRODUCTION .............................................................................. 1
1.1 Biodesulfurization and 32O modification .............................. 1
1.2 Validating the expression of mutated VHb ................................. 5
2. MATERIALS AND METHODS ........................................................ 5
2.1 Chemicals, buffers, enzymes and ladders ................................... 7
2.2 Bacterial strains, plasmids and medium ..................................... 7
2.3 Construction of pNW33N-vgb .................................................... 8
2.4 Transformation of plasmid pNW33N-vgb .................................. 10
2.5 32O-Y/pNW33N-vgb growth assay at different temperatures ... 11
2.6 Gibbs Assay ................................................................................ 12
2.7 Transformation of M2-vgb .......................................................... 12
2.8 CO-difference spectra ................................................................. 13
3. RESULTS ................................................................................................ 15
3.1 Construction of pNW33N-vgb .................................................... 15
3.2 Transformation of plasmid pNW33N-vgb .................................. 15
3.3 32O-Y/pNW33N-vgb growth rates ............................................. 15
3.4 Gibbs Assay ................................................................................ 15
3.5 Transformation of M2-vgb .......................................................... 16
3.6 CO-difference spectra ................................................................. 16
-
v
4. DISCUSSION .......................................................................................... 17
4.1 Genetic Engineering of 32O-W and 32O-Y ............................... 17
4.2 Growth Assay of 32O-Y/pNW33N-vgb .................................... 18
4.3 Problems in Growth Assay ......................................................... 18
4.4 Gibbs Assay ................................................................................ 19
4.5 Structure-function study of M2-vgb ........................................... 19
5. FIGURES AND TABLES ....................................................................... 21
APPENDIX
A. SEQUENCE OF VGB GENE ................................................................. 33
BIBLIOGRAPHY .................................................................................................... 35
-
vi
LIST OF TABLES
Table Page
5.1 Growth Assay Data of 32O-Y/pNW33N-vgb at 45C ...................................... 30
5.2 Gibbs Assay Data for Untransformed 32O-Y and 32O-Y/pNW33N-vgb ........ 31
5.3 VHb levels in DH5, DH5/pUC8:16 and DH5/M2-vgb .............................. 32
-
vii
LIST OF FIGURES
Figure Page
1.1 Structure of DBT............................................................................................... 2
1.2 The Dsz Metabolic Pathway for DBT Desulfurization ..................................... 3
5.1 Gel Picture of Plasmid pNW33N and RE Digestion of pNW33N-vgb. ........... 22
5.2 Gel Picture of Colony PCR for 32O-Y/pNW33N-vgb and DH5/M2-vgb ...... 23
5.3 Plasmid Map of Constructed pNW33N-vgb ..................................................... 24
5.4 Growth Curve of Untransformed 32O-Y and 32O-Y/pNW33N-vgb at 45C .. 25
5.5 Standard Curve for Gibbs Assay....................................................................... 26
5.6 Comparison of 2-HBP Production by 32O-Y and 32O-Y/pNW33N-vgb ........ 27
5.7 Sequence of vgb Mutant 2................................................................................. 28
5.8 CO-Difference Spectra of DH5/M2-vgb, DH5/pUC8:16 and DH5 ........... 29
-
viii
LIST OF SYMBOLS
Symbol Definition
2-HBP 2-hydroxybiphenyl
32O-W Paenibacillus apiaries
32O-Y Paenibacillus naphthalenovorans
Amp ampicillin
BDS biodesulfurization
bp base pair
CDM chemical defined medium
Chl chloramphenicol
DBT dibenzothiophene
DCW dry cell weight
dH2O deionized water
FCC fluid catalytic cracking
g gram
Hbs hemoglobins
HDS hydrodesulfurization
IGTS8 Rhodococcus erythropolis IGTS8
kbp kilo base pairs
Km kanamycin
LB Luria broth
M molar
min minute
ml milliliter
mM millimolar
mm millimeter
ms millisecond
nm nanometer
OD optical density
-
ix
PCR polymerase chain reaction
ppm parts per million
PPP pentose phosphate pathway
rpm revolutions per minute
sec second
V volt
vgb Vitreoscilla hemoglobin gene
VHb Vitreoscilla hemoglobin
g microgram
M micromolar
mol micromoles
s microsecond
-
x
ABSTRACT
Paenibacillus strains 32O-W and 32O-Y were attempted to be transformed by
electroporation with constructed plasmid pNW33N-vgb, modified to contain the vgb gene
which can be expressed as Vitreoscilla hemoglobin. Only attempts with 32O-Y were
successful. Transformed 32O-Y/pNW33N-vgb was grown in CDM medium with
dibenzothiophene (DBT) as the sole source of sulfur at different temperatures. Dramatic
variability was observed in culture at different temperatures, so only the data at 45 C
was analyzed. The growth assay showed that the 32O-Y/pNW33N-vgb strain grew
slower than untransformed 32O-Y, although Gibbs assay showed improvements in
utilizing ability of DBT of 32O-Y/pNW33N-vgb compared to untransformed 32O-Y.
This finding indicated that genetic engineering of introducing vgb into 32O-Y may cause
deterioration in cell growth rate but improvement in desulfurization activities.
Plasmid pUC-vgb-M2 was transformed into E. coli DH5. The transformed
DH5/M2-vgb was cultured along with DH5/pUC8:16, bearing plasmid pUC8:16 that
was previously constructed in our lab and can be expressed to produce wild type VHb,
and untransformed DH5. CO-difference spectra were performed with the lysed cultures
for the detection of VHb expression. As a result, DH5/M2-vgb was confirmed to lack
the ability to express functional VHb.
-
1
CHAPTER 1
INTRODUCTION
1.1 Biodesulfurization and 32O modification
Petroleum is a naturally occurring liquid found in geologic formations beneath the
Earths surface, which is now commonly refined into various types of fuels, non-fuel
products such as greases, petroleum wax, and chemical industry feed stocks including
propane, butane, benzene and xylene. The petroleum used today is light oil, which has
a relatively low sulfur content. The sulfur content is important as combustion of sulfur in
refined petroleum products produces sulfur oxides (see below). The increasing demand
for oil and the limited resource of light oil has shifted the focus of the petroleum industry
into refining heavy oil which has a higher sulfur content.
One of the major concerns in oil refining is the removal of contaminants existing
in crude oil, such as sulfur, nitrogen and oxygen, which may contribute greatly to air
pollution. For instance, sulfur and nitrogen will form sulfur dioxides and nitrogen oxides
after combustion of the fuels (M. Kampa et al., 2008). They are the main compound
causing air pollution, as well as contributing to global warming and acid rain (K. G.
Kropp et al., 1998). In order to minimize the problems, governments have required fuel
refiners to produce high quality fuels, namely with less contaminants. For example, the
limit of sulfur content in diesel fuel has been greatly reduced from 500 ppm to 15 ppm (S.
L. Borgne et al., 2003).
Various physical and chemical processes have been applied for the removal of
sulfur from petroleum (desulfurization) such as hydrodesulfurization (HDS) and fluid
catalytic cracking (FCC) (A.Byrns et al., 1943; H.Topsoe et al., 1996). Both of them
-
2
require high temperature and pressure operation, which is energetically costly. For
decades scientists in biotechnologies have tried to involve organisms, especially bacteria,
in the desulfurization process. This is called biodesulfurization (BDS). Biocatalysts can
often mediate processes more efficiently and environmentally-friendly with less by-
products than conventional chemical methods. The most common organosulfur
compound in oil fractions used for diesel fuel is dibenzothiophene (DBT; Figure 1.1),
which is now the model compound for studying BDS applied to petroleum (B. L.
McFarland et al., 1998).
Figure 1.1 Structure of DBT.
The model biocatalyst for DBT metabolism is Rhodococcus strain IGTS8 which
enzymatically converts DBT to the non-sulfur containing compound 2-hydroxy-biphenyl
(2-HBP) and sulfite. This pathway is known as the Dsz pathway (Figure 1.2).
Variations of the Dsz pathway have been found in a number of other bacteria including
thermophiles.
-
3
Figure 1.2 The Dsz Metabolic Pathway for DBT desulfurization (J. Kilbane et al., 2004).
-
4
One of the major concerns in BDS research is to improve the activity of
biocatalysts. With DBT as the model compound, it is assumed that bacteria with better
growth on DBT medium can desulfurize DBT more efficiently. Culture 32O, isolated by
Joelle Salazar and Batzaya Davaadelgar of our lab from the environment near the Field
Museum in Chicago, contains the bacteria being studied in the following thesis. 32O can
grow in CDM minimal medium with DBT as the sole sulfur source. Two uniform
species, 32O-W and 32O-Y, were obtained from culture 32O by Jia Wang through a
series of passages and purifications. A phylogenetic study based on 16S rRNA sequence
analysis showed that both of them are identified as Paenibacillus species. Both 32O-W
and 32O-Y are thermophilic and can grow in rich medium up to 56 C (32O-Y) and 63C
(32O-W). Only 32O-Y can utilize DBT as sole sulfur source. Coculturing of 32O-W with
32O-Y enhances the ability of 32O-Y to utilize DBT. 32O-Y can utilize DBT up to a
temperature of at least 50C with an optimum of 40-45C. Like Rhodococcus IGTS8,
32O-Y converts DBT to 2-HBP. The further concern of the work in this thesis is the
improvement of 32O-W and 32O-Y as biocatalysts, particularly since they may be able to
be used at somewhat elevated temperatures, at which petroleum is more easily mixed.
Vitreoscilla is a genus of Gram-negative aerobic bacteria. Bacterial hemoglobins
(in the case of Vitreoscilla known as VHb) were first discovered in Vitreoscilla; the
cloning of its gene (vgb) and expression of vgb in heterologous hosts has demonstrated its
value in a wide range of biotechnological applications including promotion of cell
growth, protein synthesis, respiration and metabolite productivity (D. Webster et al.,
1996; Stark, et al., 2012). We found one report on the enhancement of the Dsz pathway
by expression of VHb (H. Liu et al., 2007). In this thesis we tried to clone the VHb gene
-
5
(vgb) into 32O-W and 32O-Y to see whether VHb expression could enhance their ability
to metabolize DBT. Plasmid pNW33N was used as shuttle cloning vector for this work.
pNW33N is a fifth generation vector that stably replicates in both thermophilic Bacillus
species and E. coli. We thus hoped that pNW33N would be a suitable vector for the two
Paenibacillus species 32O-Y and 32O-W.
As thermophilic BDS activity depends greatly on temperature, it is necessary to
research into different thermophilic environments, namely different temperatures. As the
stability of hemoglobin in higher temperatures remains unknown, in the work described
here we compared the ability of these species expressing VHb with the nontransformed
controls for both growth in medium with DBT as the sole sulfur source, and ability to
produce 2-HBP. Our overall goal was to determine whether we could confirm the
previous report that engineering with VHb can enhance DBT metabolism, and provide
further guidance on ways to improve this enhancement.
1.2 Validating the expression of mutated VHb
Another part of this thesis contains the validation of VHb expression for vgb gene
mutant vgb-M2. The vgb-M2 gene was obtained from the lab of Professor David Ollis of
the Australian National University in Canberra, Australia. Members of the Ollis group
constructed a library of mutated vgb genes in vitro using error prone PCR. Following this
the mutant library was cloned en masse into a pUC plasmid and the resulting clones
transformed into E. coli DH5. The resulting library of transformants was grown in a
mixed culture through many passages to enrich for the fastest growing transformants.
Individual transformants were then isolated from this enrichment culture and rechecked
individually for growth rate compared to that of DH5 bearing wild type vgb. Those
-
6
purified clones with significantly faster growth than the wild type vgb bearing strain were
isolated; one of them is designated vgb-M2. Vgb-M2 contains 6 point mutations; one of
them is a non-sense mutation (TAG/UAG), which will prevent the synthesis of the
complete VHb amino acid chain. However, as a UAG nonsense suppressing tRNA exists
in E. coli DH5, it became hard to know for certain whether the vgb-M2 gene can be
expressed efficiently in this strain and whether the expressed VHb is functional (that is
can bind ligands such as O2 and CO). In this thesis, our work was to check the existence
of VHb in a vgb-M2 culture compared with a positive control of the same bacterial strain
bearing pUC-8:16, a plasmid that was previously constructed in our lab and can be
expressed to produce wild type VHb. A negative control of an untransformed DH5
culture was also included. The technique used to assay for functional VHb was the CO-
difference spectrum.
-
7
CHAPTER 2
MATERIALS AND METHODS
2.1 Chemicals, buffers, enzymes and ladders
Chemicals and buffers used are as follows: Na2CO3 (10% w/v), dibenzothiophene
(DBT), Gibbs reagent (2,6-dichloroquinone-4-chloroimide), 2-hydroxybiphenyl (2-HBP),
NaOH and HCl for pH adjustment, phosphate buffer (0.05 M, pH 7.2) (Na2HPO4 (4.33
g/L) and KH2PO4 (2.65 g/L)) and Na2S2O3.
Enzymes used in this thesis were: PstI, HindIII, Taq polymerase master-mix (5X),
T4 DNA ligase and appropriate buffers (all from New England Biolabs). QIAprep
miniprep kits and QIAEX II gel extraction kit (Qiagen) were also used.
DNA ladders used in this thesis were: HindIII digested lambda DNA and 2 log
ladder (NEB).
2.2 Bacterial strains, plasmids and medium
Escherichia coli strain DH5 competent cells (NEB) were used for plasmid
construction, replication and expression of pNW33N-vgb. Pure cultures of 32O-W and
32O-Y plate stocks (from Jia Wang) were also used in this thesis. Plasmid pNW33N (De
Rossi et al., 1994) was obtained from the Bacillus stock center at Ohio State University.
Medium used in this thesis included: LB medium (pH 7.0): tryptone (10 g/L),
yeast extract (5 g/L), NaCl (10 g/L), adjusted pH to 7.0 with 5M NaOH and CDM
(Chemically Defined Medium): phosphate buffer (1 M, 20X, pH 7.2) (Na2HPO4 (86.6
g/L) and KH2PO4 (53 g/L)), NH4Cl (1M, 100X) (54 g/L), MgCl2 (1M, 1000X) (204 g/L),
CaCl2 (0.3 M, 1000X) (44 g/L), trace elements (1000X, pH 6.7) containing FeCl3 (2.04
g/L), ZnCl2 (70 mg/L), MnCl2 (100 mg/L), CuCl2 (20 mg/L), NiCl2 (20 mg/L), Na2MoO4
-
8
(40 mg/L), H3BO4 (20 mg/L) and glucose solution (1M). Phosphate buffer, NH4Cl,
MgCl2 and CaCl2 and glucose were separately prepared, sterilized and stored. Trance
element solution was sterilized by filtration. The ingredients of 1L working CDM
medium were: 50 mL of 20X phosphate buffer, 10 mL of 100X NH4Cl, 1 ml of 1000X
MgCl2, 1 mL of 1000X CaCl2, 1 mL of 1000X trace elements and 30 mL of 1 M glucose
solution.
2.3 Construction of pNW33N-vgb
Preparation of insert fragments (vgb). Vgb was amplified from pUC8:16 (which
contains vgb cloned into pUC8) by PCR with forward primer (5-CAT GAT AAG CTT
AGG AGG CTA GAT GTT AGA CCA GCA AA-3) and reverse primer (5-CAT GAT
CTG CAG TTA TTC AAC CGC TTG AG-3). The PCR system was designed as 1 L
for each primer (final primer concentration of 0.2M), 1 L plasmid pUC8:16, 10 L 5X
Taq mastermix, 37 L milliQ H2O (with a total volume of 50 L). The PCR reaction was
performed in the following conditions: initial denaturation at 94 C for 6 min,
denaturation at 94 C for 1 min, annealing at 48 C for 30 sec and extension at 68 C for
30 sec. 30 cycles were performed in those PCR steps, with a final extension at 68 C for
10 min.
Gel extraction of the fragments (vgb). The amplified fragments were extracted by
gel extraction. The expected DNA band was excised from the agarose gel with a clean,
sharp scalpel. Buffer QX1 was added and QIAEX beads were resuspended in the
solution, followed by incubation at 50C for 10 min until the color of the mixture became
yellow. The sample was then centrifuged down, washed by Buffer QX1 three times and
-
9
eluted with 20 L of TE. Finally the mixture was centrifuged and the supernatant was
harvested into a clean tube as the clean vgb fragment.
Miniprep of pNW33N. The pNW33N plasmid was originally stored as
DH5/pNW33N in a glycerol stock. A fresh plate stock was made from the glycerol
stock and then a fresh liquid culture in LB-ampicillin (25g/mL) was grown from a
colony on the plate. A mini-preparation was conducted to extract the pNW33N plasmid.
Restriction Digestion. The sample fragments and vector plasmid pNW33N were
both digested with PstI and HindIII. Plasmid pNW33N was digested in the system of 2
L vector, 2 L buffer 2, 1 L PstI, 1 L HindIII and 14 L milliQ H2O. The vgb
fragments were digested in the system of 16 L fragments, 2 L buffer 2 and 1 L for
each enzyme. Both systems were 20 L total volume. The mixtures were incubated at
37C for 2 hours followed by 20 min in 80C for the inactivation of the enzymes.
Ligation of pNW33N and vgb fragment. After the preparation of both of the
plasmid vector pNW33N and vgb fragment, their concentrations were measured
(pNW33N: 65.9 ng/L; vgb: 16.2ng/ L) using a nanodrop spectrophotometer. The
ligation system was determined using a molar ratio of 3:1 (insert : vector), namely 1.25
L of fragments, 0.77 L of vector, 2 L 10X Buffer, 15 L of milliQ H2O and 1 L of
T4 ligase. The mixtures were incubated at 4C overnight.
Transformation of constructed pNW33N-vgb plasmid. The DH5 competent cells
were thawed on ice and mixed with 100 ng ligation mixture. The mixture was incubated
on ice for 30 min, heat-shocked at 42C for 45 seconds and immediately placed on ice for
2 min. The competent cells were transferred to LB medium and cultured for 2 hours at
37C. The culture was centrifuged and resuspended with 100 L LB medium, then spread
-
10
on an LB-Chl (25g/mL) plate for the selection of the transformants. The plates were
incubated at 37C overnight.
Validation of constructed pNW33N-vgb plasmid. After the colonies on the LB-Chl
plate grew, a single colony was picked from the plate and transferred to 5mL liquid LB-
Chl medium for an hour culture (at 37C). A mini-prep was conducted on the culture to
extract the amplified plasmid pNW33N-vgb. The plasmid pNW33N-vgb was then
verified by restriction enzyme digestion with PstI and HindIII, along with agarose gel
electrophoresis. After the bands on the gel were verified, 5 L of the plasmids were sent
for sequencing to fully validate the correctly constructed pNW33N-vgb.
2.4 Transformation of plasmid pNW33N-vgb into 32O-W and 32O-Y
Preparation of 32O-W and 32O-Y electrocompetent cells. Single colonies of 32O-
W and 32O-Y were both picked from previous plate stocks and transferred to liquid LB
medium and cultured for 16-20 hours at 50C. Then 1 ml of each culture was diluted into
100 ml of LB medium with an initial OD600nm of 0.05. The cells were grown at 50C, 200
rpm until the OD600nm reached 0.6. Ampicillin was added to the culture with a final
concentration of 200 g/mL and the culture continued at 50C for another 2 hours. The
cells were harvested by centrifugation at 4C, 5000 rpm in the Sorvall SS34 rotor for 10
min and washed 4 times, each time with 1.0 ml 0.3 M sucrose. Then the pelleted cells
were resuspended in 1 ml of ice cold 0.5 M sucrose and stored at -40C.
Electroporation. 500 ng plasmid and 30 L competent cells were added together
into a sterile and ice-cold 1.5 mL microcentrifuge tube and gently mixed by pipetting.
The mixture was then transferred to a sterile ice-cold electroporation cuvette. The cuvette
was covered and placed into the electroporation apparatus (BTX model ECM 830) and
-
11
given a pulse at 1500 V for 200 s. The mixture was immediately transferred to 1 mL
SOC medium in a 5 mL tube and cultured at 37 C, 200 rpm for 6 hours for recovery.
After the recovery, cells were harvested by centrifugation at 5000 rpm in the Sorvall
SS34 rotor for 1 min. Most of the medium was discarded, with a little amount left to
resuspend the pellets and spread on an LB-Chl (25 g/mL) plate. Those plates were
incubated at 37 C overnight.
Validation of electroporation. After colonies were grown on the selective plates,
random colonies were picked up for colony PCR using the primers previously mentioned.
In this thesis, only the transformed 32O-Y colony grew on the selective plates, so an
original untransformed 32O-Y colony was used as the negative control. A
DH5/pNW33N-vgb colony was used as the positive control. The PCR reaction was
performed in the following conditions: initial denaturation at 94 C for 6 min,
denaturation at 94 C for 1 min, annealing at 48 C for 30 sec and extension at 68 C for
30 sec. 30 cycles were performed in those PCR steps, with a final extension at 68 C for
10 min. The PCR products were transferred to an agarose gel for electrophoresis analysis.
2.5 32O-Y/pNW33N-vgb growth assay at different temperatures
Preculture. In order to standardize the starting culture for growth at different
temperatures, each time the 32O-Y/pNW33N-vgb cells were freshly cultured in LB-Chl
(25 g/mL) medium. After this preculture reached OD600nm 0.5, 500 L of preculture
was transferred to CDM-DBT-Chl (25 g/mL) medium for culturing at different
temperatures.
Growth rates at different temperatures. 32O-Y/pNW33N-vgb was cultured in 50
mL CDM-DBT-Chl (25 g/mL) medium at various temperatures including: 40 C, 42 C,
-
12
45 C, 47 C and 50 C along with the negative control of untransformed 32O-Y at the
corresponding temperatures. The OD600nm of each culture was recorded every day until
the cultures reached their maximum OD600nm.
2.6 Gibbs Assay
Standard Curve. Standard samples of 2-HBP were prepared in a series of
concentrations: 0 g/mL, 1 g/mL, 2 g/mL, 4 g/mL, 8 g/mL, 16 g/mL, 32 g/mL
and 50 g/mL. The Gibbs Assay was performed on each sample to create a standard
curve for converting the OD610nm results to 2-HBP concentrations in mol/mL.
Gibbs Assay. After the OD600nm of each culture of 320-Y/pNW33N reached
maximum, 1 mL of culture was transferred to a new centrifuge tube. The samples were
adjusted to pH 8.0 with 10% (w/v) Na2CO3. 10L of Gibbs reagent was added to each
sample, mixed in by vortexing and the sample incubated at room temperature for 1 hour.
The cells were centrifuged down at 12000 rpm for 1 min in a microfuge and the
absorbance of the supernatant was measured at 610 nm. The absorbance values were then
converted to the concentration of 2-HBP using the standard curve.
2.7 Transformation of M2-vgb
The DH5 competent cells were thawed on ice and mixed with 100 ng pUC-M2-
vgb plasmid mixture. The mixture was incubated on ice for 30 min, heat-shocked at 42C
for 45 seconds and immediately placed on ice for 2 min. The competent cells were
transferred to LB medium and cultured for 2 hours at 37C. The culture was centrifuged
and resuspended with 100 L LB medium, then spread on an LB-Amp (25g/mL) plate
for the selection of the transformants. The plates were incubated at 37C overnight. The
-
13
miniprepped plasmid pUC-M2-vgb from transformed DH5/M2-vgb was sent for
sequencing.
2.8 CO-difference spectra
DH5/M2-vgb, DH5/pUC8:16 and DH5 were cultured in 50mL LB medium at
37 C for 24-36 hours at 200 rpm with corresponding antibiotics (DH5/M2-vgb,
ampicillin (25 g/mL); DH5/pUC8:16-vgb, ampicillin (25 g/mL); DH5, none) until
the OD600nm reached 1.0. Cells were harvested in empty pre-weighed sterile tubes and
centrifuged down at 5000 rpm for 15 min at 4 C in the Sorvall SS34 rotor, followed by
resuspension and washing with 0.05M Tris-HCl buffer (pH 7.5). The supernatants were
discarded and the tubes were reweighed. The actual cell weight was determined as the
weight of cells plus the tube minus the empty tube weight. The pellets were resuspended
with 0.01 M Tris-HCl buffer, lysozyme (4mg/g of cell weight), DNase I (0.05mg/g of cell
weight) and RNase A (0.05 mg/g of cell weight). The mixtures were then incubated at 4
C for 24 hours on a magnetic stirrer at a low speed. The cell debris were harvested by
centrifugation at 10,000 rpm for an hour at 4 C in the Sorvall SS34 rotor. The
supernatants were transferred to new tubes for scanning spectrophotometry analysis. A
small amount of Na2S2O3 was added to each tube for the reduction of the heme iron to the
Fe+2 valence. Each sample was tested as a set of two. The spectrophotometer took the
difference between the two samples at each wavelength between 400 nm to 600 nm.
Baseline correction was performed to ensure the absorbance of the two samples were the
same. After the baseline correction, one of the samples was saturated with CO for the
covalent bonding of hemoglobin and CO. After 1 min of saturation (about 1 bubble of
CO per second), the samples were again compared in the spectrophotometer and the
-
14
differences at each wavelength between 400 nm to 600 nm were captured. A graph of the
resulting CO-difference spectrum was automatically outputted by the software
controlling the spectrometer.
-
15
CHAPTER 3
RESULTS
3.1 Construction of pNW33N-vgb
The vector pNW33N and plasmid pUC8:16 which contains the wild type vgb
gene were identified by electrophoresis (Figure 5.1). The vgb sequence was amplified by
PCR from plasmid pUC8:16. Both the vgb amplicon and the vector pNW33N were
digested by restriction enzymes PstI and HindIII. Ligation was performed and the
products were transformed into E. coli DH5. A miniprep was performed to extract the
plasmid pNW33N-vgb. Restriction enzyme digestion was used on extracted pNW33N-
vgb for validation (Figure 5.1). The plasmid map of pNW33N-vgb is shown in Figure 5.3.
3.2 Transformation of plasmid pNW33N-vgb into 32O-W and 32O-Y
Plasmid pNW33N-vgb was transformed into 32O-W and 32O-Y by
electroporation. The transformation with 32O-Y was successful. The transformed 32O-Y
was cultured and tested for growth on an LB-Chl (25 g/mL) plate. Colony PCR on 32O-
Y/pNW33N-vgb was used for further validation. The PCR results were run on an agarose
gel (Figure 5.2).
3.3 32O-Y/pNW33N-vgb growth rates
32O-Y/pNW33N-vgb and untransformed 32O-Y were cultured in CDM-DBT
medium at 45 C. The growth curve is shown in Figure 5.4. All the growth data are
summarized in Table 5.1.
3.4 Gibbs Assay
After the growth of 32O-Y/pNW33N-vgb and untransformed 32O-Y reached the
maximum, Gibbs Assay was performed on them to measure their abilities regarding
-
16
conversion of DBT to 2-HBP (Table 5.2). The Gibbs Assay results of both 32O-
Y/pNW33N-vgb and untransformed 32O-Y were compared and are shown in Figure 5.6.
The Gibbs Assay standard curve is shown in Figure 5.5.
3.5 Transformation of M2-vgb
Plasmid M2-vgb was transformed into E. coli DH5 and cultured on an LB-Amp
(25 g/mL) plate. Colony PCR was performed on the transformed DH5 for validation.
The PCR results are shown in Figure 5.2. The sequencing result of M2-vgb is shown in
Figure 5.7. For comparison, the sequence of wild type vgb is shown in the Appendix.
3.6 CO-difference spectra
DH5/M2-vgb, DH5/pUC8:16 and DH5 were cultured in LB medium. The
cells were collected and lysed. The supernatants were used for CO-difference spectra
determination. The spectra were automatically outputted (Figure 5.8). All the absorbance
data from the spectra were converted to the concentration of VHb and normalized to the
concentration of cells used to make the cell lysate as described by Dikshit and Webster
(Dikshit and Webster, 1988) (Table 5.3).
-
17
CHAPTER 4
DISCUSSION
4.1 Genetic engineering of 32O-W and 32O-Y
Plasmid Construction. The genetic engineering of 32O-W and 32O-Y is one of
the main goals of this thesis. Originally, we chose plasmid pRESX-vgb which was
obtained from Jia, another member in our lab, for the transformation. However, none of
the transformation attempts were successful. The main reason that came into concern in
this regard is that 32O-W and 32O-Y are both Paenibacillus species, while plasmid
pRESX is a shuttle vector used for transformation between Escherichia and Rhodococcus
species (R. van der Geize, et al. 2008). So we introduced shuttle vector pNW33N into
this transformation process. pNW33N was confirmed to be able to replicate in both
Bacillus and Escherichia species. Plasmid pNW33N features a large multiple cloning site
and encodes a chloramphenicol acetyltransferase that is expressed in both gram-positives
and gram-negatives, so chloramphenicol was used as the antibiotic in the transformation.
Electroporation. Both 32O-W and 32O-Y were tried regarding transformation
with pNW33N-vgb. The attempt with 32O-Y was successful, which was validated by
colony PCR. Only a few colonies were grown on the selective plate for 32O-W
transformation and they grew relatively slowly and showed different morphology
compared to untransformed 32O-W colonies. That suggested those transformants may
have been false positives or even contaminants. Further colony PCR confirmed that the
transformants did not contain the vgb gene. Various reason may have caused the failure
in transformation, so we shifted our focus of genetic engineering of both 32O-W and
32O-Y into 32O-Y alone.
-
18
4.2 Growth Assay of 32O-Y/pNW33N-vgb at different temperatures
32O-Y/pNW33N-vgb was cultured at 45 C at first. The culture grew slowly
directly from colonies to CDM-DBT medium so pre-culturing in LB medium was used.
Compared with the untransformed 32O-Y culture which has a light yellow color, the
32O-Y/pNW33N-vgb culture has a red color which indicates the expression of VHb.
Surprisingly, untransformed 32O-Y grows much faster than the 32O-Y-transformant. The
original hypothesis is that the introduction of vgb into 32O-Y will help with the growth,
but the growth assay suggests that the expression of VHb may interrupt the metabolism
of 32O-Y. One possible reason is that 32O-Y may not be able to form the correct
structure of VHb and that is harmful for their growth. As the temperatures went up, this
phenomenon became more obvious because VHb is less stable at higher temperature.
4.3 Problems with the Growth Assay
The major problem with the growth assay is the culture of untransformed 32O-Y.
32O-Y has no antibiotic resistance and grows relatively slowly directly in CDM-DBT
medium. This makes the culture easy to contaminate. Another problem lies in repeated
passages during growth in different temperatures. Both 32O-Y/pNW33N-vgb and
untransformed 32O-Y strains were transferred from cultures at one temperature to
cultures at the next temperature. It is possible due to the repeated passages that the
variability becomes a lot greater than we expect from normal experiment. At the late
stage of the repeated passages, the growth rates of both strains changed dramatically.
Colony PCR was tested on the late cultures and no vgb gene was detected. The reason
may lie in both mutations in the bacteria and plasmid elimination, which were difficult to
document in this thesis. So only the growth data at 45 C have been analyzed.
-
19
4.4 Gibbs Assay
The Gibbs Assay was performed on the 45 C cultures of both 32O-Y/pNW33N-
vgb and untransformed 32O-Y at the point at which cell densities in the cultures had
become maximum. The result for 32O-Y/pNW33N-vgb is almost 10% higher than that of
untransformed 32O-Y. This indicates that 32O-Y/pNW33N-vgb can convert it to 2-HBP
more effectively than untransformed 32O-Y. As we already found out that the
untransformed 32O-Y grows faster than 32O-Y/pNW33N-vgb, the advantage of 32O-
Y/pNW33N-vgb in sulfur metabolism on a per cell mass basis is more obvious. The
results suggest that introducing hemoglobin cannot enhance the growth rate of 32O-Y,
however, it can greatly enhance its ability utilize DBT. The principle is that hemoglobin
can help deliver oxygen to the monoxygenase (P. A. Fish, et al. 2000; J. M. Lin, et al.
2003), which is crucial in the 4 S metabolizing pathway.
4.5 Structure-function study of M2-vgb
Plasmid M2-vgb was transformed into DH5 successfully. The plasmid obtained
from miniprep of the transformed DH5 was sent for sequencing. The sequencing result
matched the record we got from Professor David Ollis and showed that there are 6 point
mutations in the vgb-M2 mutant gene, 3 of these are neutral mutations, 2 result in amino
acid substitutions and one is an amber (UAG) mutation. The amber mutation is expected
to be suppressed to some degree by the amber suppressor tRNA encoded in the genome
of DH5. DH5/M2-vgb, DH5/pUC8:16 and untransformed DH5 were cultured and
lysed for the CO-difference spectrum study. As the positive control, DH5/pUC8:16,
which expresses wild type VHb showed peak in the spectrum, 0.87 A units, at 420 nm
and trough in the spectrum (-0.51 A units) at 437 nm, and two minor peaks at 572 nm and
-
20
557 nm. All of these features are characteristic of CO-difference spectra of wild type
VHb. The spectrum of untransformed DH5 only has two minor peaks, 0.084 at 423 nm
and 0.045 at 446 nm, neither of which is characteristic of VHb. Compared to
DH5/pUC8:16, the peak wavelength shifts from 420 nm to 423 nm and the trough
wavelength from 437 nm to 446 nm. The reason is that although untransformed DH5
will not synthesize VHb, bacteria will still produce heme proteins (particularly
cytochromes in their membrane) which will also bind with CO and cause the peaks to
show. For the spectrum of DH5/M2-vgb, the graph is similar to that of untransformed
DH5. All the data were converted to the concentration of VHb and normalized to the
concentration of cells (0.25g/mL) used to make the cell lysate in each case.
DH5/pUC8:16 can synthesize 19.7 nMol/g VHb, while DH5/M2-vgb and
untransformed DH5 can only synthesize 0.12 nMol/g and 0.35 nMol/g of heme proteins
that are not VHb.
This result indicates that the DH5/M2-vgb strain is not able to synthesize
functional VHb. This is unexpected, since the Ollis group had selected the vgb-M2
bearing strain because it grows faster than matched strain bearing wild type VHb. It now
appears that that growth advantage may not be due to hemoglobin produced from the
vgb-M2 gene. In contrast, either one or more of the missense mutations in vgb-M2 results
in a non-functioning VHb, or perhaps the amber mutation in vgb-M2 is not efficiently
suppressed, leading to production of a truncated, and also non-functional, VHb.
-
21
CHAPTER 5
FIGURES AND TABLES
-
22
Figure 5.1. Gel picture of plasmid pNW33N and RE digestion of pNW33N-vgb. Lanes 1
and Lane 6, HindIII digested lambda DNA marker; lanes 2 and 3, PstI and HindIII
digested pNW33N-vgb (4.6 kbp), two bands in each lane, pNW33N (4.2 kbp) and vgb
fragment (~460 bp); lanes 4 and 5, vector pNW33N (4.2 kbp).
0.46
-
23
Figure 5.2. Gel picture of colony PCR results for 32O-Y/pNW33N-vgb and DH5/M2-vgb. Lanes 1 and 2, colony PCR results for 32O-Y/pNW33N-vgb (~460 bp); lanes 3 and
4, colony PCR results for DH5/M2-vgb (~460 bp); lane 5, HindIII digested lambda DNA marker.
-
24
Figure 5.3. Plasmid map of constructed pNW33N-vgb.
-
25
Figure 5.4. Growth Curve of untransformed 32O-Y (ori) and 32O-Y/pNW33N-vgb at 45C. Values are averages of three independent measurements. Error bars indicate
standard deviations.
0
0.5
1
1.5
2
2.5
0 1 2 3 4 5 6 7
Ab
sorb
ance
Days
Growth Curve of 32O-Y ori and vgb at 45C
ori
vgb
-
26
Figure 5.5. Standard Curve for Gibbs Assay.
0
1
2
3
4
5
6
7
0 10 20 30 40 50 60
Ab
sorb
ance
[2-HBP] (ug/ml)
Gibbs Assay Standard Curve
-
27
Figure 5.6. Comparison of 2-HBP productions by untransformed 32O-Y and 32O-
Y/pNW33N-vgb. 32O-Y/pNW33N-vgb produced 10% more HBP than untransformed
32O-Y (1 mL of culture was taken from each culture after maximum growth was
reached).
10
11
12
13
14
15
16
untransformed 32O-Y 32O-Y/pNW33N-vgb
[2-H
BP
] (u
g/m
l)
Strains
2-HBP Production
-
28
Figure 5.7. Sequence of vgb Mutant 2. The promoter region is highlighted in magenta. The
coding sequence is highlighted in yellow. All six point mutations (changes from wild
type vgb) are indicated in red. The nonsense mutation is indicated in blue.
-
29
Figure 5.8. CO-Difference Spectra of DH5/M2-vgb, DH5/pUC8:16 and untransformed DH5. Green, DH5/pUC8:16; orange, DH5/M2-vgb; red, untransformed DH5.
DH5/pUC8:16 -- Green
DH5/M2-vgb -- Orange
DH5 -- Red
-
30
Table 5.1. Growth Assay data of 32O-Y/pNW33N-vgb at 45C. Samples for the Gibbs
assay were taken from the 32O-Y culture during day 6 and from the 32O-Y/pNW33N-
vgb culture during day 4.
Days
A32O-Y A32O-Y/pNW33N-vgb
Triplicate Triplicate
Start 0.030 0.043 0.037 0.030 0.028 0.028
Day 1 0.133 0.122 0.121 0.096 0.102 0.093
Day 2 0.899 0.832 0.707 0.461 0.562 0.543
Day 3 1.910 1.902 1.452 0.896 0.960 1.002
Day 4 1.980 2.004 1.552 1.100 1.089 0.950
Day 5 2.134 2.440 1.762 0.926 0.952 0.828
Day 6 2.208 2.672 1.972 0.844 0.952 0.721
-
31
Table 5.2. Gibbs Assay data for untransformed 32O-Y and 32O-Y/pNW33N-vgb. Values
are averages of three independent measurements; standard deviations are indicated.
Samples for the Gibbs assay were from the cultures from which the growth data in
Figure 5.4 and Table 5.1 were taken.
Strain Absorbance S.D.
Untransformed 32O-Y 1.871 0.079
32O-Y/pNW33N-vgb 2.028 0.007
-
32
Table 5.3. VHb levels in untransformed DH5 (no VHb), DH5/pUC8:16 (wild type VHb) and DH5/M2-vgb (mutant 2 VHb). Values are averages of three independent measurements; standard deviations are included. Calculations were made using the
extinction coefficient E419-436=274 mM-1cm-1 (Dikshit and Webster, 1988) and normalized to the concentration of cells (0.25g/mL) used to make the cell lysate in each
case.
Strain VHb levels (nMol/g)
Standard Deviation (nMol/g)
DH5/pUC8:16 19.68 0.76
DH5/M2-vgb 0.12 0.05
Untransformed-DH5 0.35 0.01
-
33
APPENDIX A
SEQUENCE OF VGB GENE
3
60
-
34
AAGCTTACAGGACGCTGGGGTTAAAAGTATTTGAGTTTTGATGTGGATTAAG
TTTTAAGAGGCAATAAAGATTATAATAAGTGCTGCTACACCATACTGATGTAT
GGCAAAACCATAATAATGAACTTAAGGAAGACCCTCATGTTAGACCAGCAAA
CCATTAACATCATCAAAGCCACTGTTCCTGTATTGAAGGAGCATGGCGTTACC
ATTACCACGACTTTTTATAAAAACTTGTTTGCCAAACACCCTGAAGTACGTCC
TTTGTTTGATATGGGTCGCCAAGAATCTTTGGAGCAGCCTAAGGCTTTGGCGA
TGACGGTATTGGCGGCAGCGCAAAACATTGAAAATTTGCCAGCTATTTTGCCT
GCGGTCAAAAAAATTGCAGTCAAACATTGTCAAGCAGGCGTGGCAGCAGCGC
ATTATCCGATTGTCGGTCAAGAATTGTTGGGTGCGATTAAAGAAGTATTGGG
CGATGCCGCAACCGATGACATTTTGGACGCGTGGGGCAAGGCTTATGGCGTG
ATTGCAGATGTGTTTATTCAAGTGGAAGCAGATTTGTACGCTCAAGCGGTTGA
ATAAAGTTTCAGGCCGCTTTCAGGACATAAAAAACGCACCATAAGGTGGTCT
TTTTACGTCTGATATTTACACAGCAGTTTGGCTGTTGCCAAAACTTGGGACAA
ATATTG
The coding sequence is in gray. The promoter region is underlined.
-
35
BIBLIOGRAPHY
Byrns A., et al. 1943. Catalytic desulfurization of gasolines by cobalt molybdate process,
Industrial & Engineering Chemistry, vol. 32, pp. 1160 1167.
Borgne S. L. and Quintero R. 2003. Biotechnological processes for the refining of
petroleum, Fuel Processing Technology, vol. 81, pp. 155 169.
De Rossi E., et al. 1994. New shuttle vector for cloning in Bacillus stearothermophilus,
Res Microbiol, vol. 145, pp. 579 583.
Dikshit K. L. and Webster D. A. 1988. Cloning, characterization and expression of the
bacterial globin gene from Vitreoscilla in Escherichia coli, Gene, vol. 70, pp. 377 386.
Fish P. A., et al. 2000. Vitreoscilla hemoglobin enhances the first step in 2,4-dinitrotoluene
degradation in vitro and at low aeration in vivo, J Molec Catalysis B: Enzymatic, vol. 9,
pp. 75 82.
Kilbane II J. and Borgne S.L. 2004. Petroleum biorefining: the selective removal of sulfur,
nitrogen, and metals, Studies in Surface Science and Catalysis, vol. 151, pp. 29 65.
Kropp K. G. and Fedorak P. M. 1998. A review of the occurrence, toxicity, and
biodegradation of condensed thiophenes found in petroleum, Canadian Journal of
Microbiology, vol. 44, pp. 605 622.
Kampa M. and Castanas E. 2008. Human health effects of air pollution, Environmental
Pollution, vol. 151, pp. 362 367.
Lin J. M., et al. 2003. Effects of Vitreoscilla hemoglobin on the 2,4-dinitrotoluene (DNT)
dioxygenase activity of Burkholderia and on DNT degradation in two-phase
bioreactors, J Ind Microbiol Biotechnol, vol. 30, pp. 362 368.
McFarland B. L., et al. 1998. Biocatalytic sulfur removal from fuels: applicability for
producing low sulfur gasoline, Critical Reviews in Microbiology, vol. 24, pp. 99 - 147.
Rhee M. S., et al. 2007. Development of plasmid vector and electroporation condition for
gene transfer in sporogenic lactic acid bacterium, Bacillus coagulans, Plasmid, vol. 58,
pp. 13 22.
Stark B. C. 2012. The biochemistry of Vitreoscilla hemoglobin, Computational and
Structural Biotechnology Journal, vol. 3, pp. 1 8.
Topse H., et al. 1996. Hydrotreating catalysis, Catalysis-Science and Technology, vol. 11,
pp. 1 269.
-
36
Van der Geize R., et al. 2008. Characterization of a second Rhodococcus erythropolis SQ1
3-ketosteroid 9-hydroxylase activity comprising a terminal oxygenase homologue, KshA2, active with oxygenase-reductase component KshB, Appl Environ Microbiol,
vol. 74, pp. 7197 7203.
Webster D. and Hackett D. 1966. The purification and properties of cytochrome o from
Vitreoscilla, Journal of Biological Chemistry, vol. 241, pp. 3308 3315.