VITREOSCILLA HEMOGLOBIN: STRUCTURE-FUNCTION AND GENETIC

ENGINEERING STUDIES

BY

XIAODONG LI

DEPARTMENT OF BIOLOGICAL AND CHEMICAL SCIENCES

Submitted in partial fulfillment of the

requirements for the degree of

Master of Science in Biology

in the Graduate College of the

Illinois Institute of Technology

Approved _________________________

Adviser

Chicago, Illinois

May 2014

iii

ACKNOWLEDGEMENTS

My deepest gratitude goes to Dr. Benjamin Stark for his patience, advice and

support through my study. Dr. Stark is the best teacher Ive ever met, he helped me out

during my darkest time and gave me so much confidence in order to finish my graduate

study at IIT.

My appreciation extends to my labmates, especially Yang Chen, Nan Bai and

Stephanie Kunkel for their help both in lab and life. They contributed a lot in my thesis

work and helped me solve a lot of problems. Im also grateful for Jia Wangs help in my

writing.

iv

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS ...................................................................................... iii

LIST OF TABLES ................................................................................................... vi

LIST OF FIGURES ................................................................................................. vii

LIST OF SYMBOLS ............................................................................................... viii

ABSTRACT ............................................................................................................. ix

CHAPTER

1. INTRODUCTION .............................................................................. 1

1.1 Biodesulfurization and 32O modification .............................. 1

1.2 Validating the expression of mutated VHb ................................. 5

2. MATERIALS AND METHODS ........................................................ 5

2.1 Chemicals, buffers, enzymes and ladders ................................... 7

2.2 Bacterial strains, plasmids and medium ..................................... 7

2.3 Construction of pNW33N-vgb .................................................... 8

2.4 Transformation of plasmid pNW33N-vgb .................................. 10

2.5 32O-Y/pNW33N-vgb growth assay at different temperatures ... 11

2.6 Gibbs Assay ................................................................................ 12

2.7 Transformation of M2-vgb .......................................................... 12

2.8 CO-difference spectra ................................................................. 13

3. RESULTS ................................................................................................ 15

3.1 Construction of pNW33N-vgb .................................................... 15

3.2 Transformation of plasmid pNW33N-vgb .................................. 15

3.3 32O-Y/pNW33N-vgb growth rates ............................................. 15

3.4 Gibbs Assay ................................................................................ 15

3.5 Transformation of M2-vgb .......................................................... 16

3.6 CO-difference spectra ................................................................. 16

v

4. DISCUSSION .......................................................................................... 17

4.1 Genetic Engineering of 32O-W and 32O-Y ............................... 17

4.2 Growth Assay of 32O-Y/pNW33N-vgb .................................... 18

4.3 Problems in Growth Assay ......................................................... 18

4.4 Gibbs Assay ................................................................................ 19

4.5 Structure-function study of M2-vgb ........................................... 19

5. FIGURES AND TABLES ....................................................................... 21

APPENDIX

A. SEQUENCE OF VGB GENE ................................................................. 33

BIBLIOGRAPHY .................................................................................................... 35

vi

LIST OF TABLES

Table Page

5.1 Growth Assay Data of 32O-Y/pNW33N-vgb at 45C ...................................... 30

5.2 Gibbs Assay Data for Untransformed 32O-Y and 32O-Y/pNW33N-vgb ........ 31

5.3 VHb levels in DH5, DH5/pUC8:16 and DH5/M2-vgb .............................. 32

vii

LIST OF FIGURES

Figure Page

1.1 Structure of DBT............................................................................................... 2

1.2 The Dsz Metabolic Pathway for DBT Desulfurization ..................................... 3

5.1 Gel Picture of Plasmid pNW33N and RE Digestion of pNW33N-vgb. ........... 22

5.2 Gel Picture of Colony PCR for 32O-Y/pNW33N-vgb and DH5/M2-vgb ...... 23

5.3 Plasmid Map of Constructed pNW33N-vgb ..................................................... 24

5.4 Growth Curve of Untransformed 32O-Y and 32O-Y/pNW33N-vgb at 45C .. 25

5.5 Standard Curve for Gibbs Assay....................................................................... 26

5.6 Comparison of 2-HBP Production by 32O-Y and 32O-Y/pNW33N-vgb ........ 27

5.7 Sequence of vgb Mutant 2................................................................................. 28

5.8 CO-Difference Spectra of DH5/M2-vgb, DH5/pUC8:16 and DH5 ........... 29

viii

LIST OF SYMBOLS

Symbol Definition

2-HBP 2-hydroxybiphenyl

32O-W Paenibacillus apiaries

32O-Y Paenibacillus naphthalenovorans

Amp ampicillin

BDS biodesulfurization

bp base pair

CDM chemical defined medium

Chl chloramphenicol

DBT dibenzothiophene

DCW dry cell weight

dH2O deionized water

FCC fluid catalytic cracking

g gram

Hbs hemoglobins

HDS hydrodesulfurization

IGTS8 Rhodococcus erythropolis IGTS8

kbp kilo base pairs

Km kanamycin

LB Luria broth

M molar

min minute

ml milliliter

mM millimolar

mm millimeter

ms millisecond

nm nanometer

OD optical density

ix

PCR polymerase chain reaction

ppm parts per million

PPP pentose phosphate pathway

rpm revolutions per minute

sec second

V volt

vgb Vitreoscilla hemoglobin gene

VHb Vitreoscilla hemoglobin

g microgram

M micromolar

mol micromoles

s microsecond

x

ABSTRACT

Paenibacillus strains 32O-W and 32O-Y were attempted to be transformed by

electroporation with constructed plasmid pNW33N-vgb, modified to contain the vgb gene

which can be expressed as Vitreoscilla hemoglobin. Only attempts with 32O-Y were

successful. Transformed 32O-Y/pNW33N-vgb was grown in CDM medium with

dibenzothiophene (DBT) as the sole source of sulfur at different temperatures. Dramatic

variability was observed in culture at different temperatures, so only the data at 45 C

was analyzed. The growth assay showed that the 32O-Y/pNW33N-vgb strain grew

slower than untransformed 32O-Y, although Gibbs assay showed improvements in

utilizing ability of DBT of 32O-Y/pNW33N-vgb compared to untransformed 32O-Y.

This finding indicated that genetic engineering of introducing vgb into 32O-Y may cause

deterioration in cell growth rate but improvement in desulfurization activities.

Plasmid pUC-vgb-M2 was transformed into E. coli DH5. The transformed

DH5/M2-vgb was cultured along with DH5/pUC8:16, bearing plasmid pUC8:16 that

was previously constructed in our lab and can be expressed to produce wild type VHb,

and untransformed DH5. CO-difference spectra were performed with the lysed cultures

for the detection of VHb expression. As a result, DH5/M2-vgb was confirmed to lack

the ability to express functional VHb.

1

CHAPTER 1

INTRODUCTION

1.1 Biodesulfurization and 32O modification

Petroleum is a naturally occurring liquid found in geologic formations beneath the

Earths surface, which is now commonly refined into various types of fuels, non-fuel

products such as greases, petroleum wax, and chemical industry feed stocks including

propane, butane, benzene and xylene. The petroleum used today is light oil, which has

a relatively low sulfur content. The sulfur content is important as combustion of sulfur in

refined petroleum products produces sulfur oxides (see below). The increasing demand

for oil and the limited resource of light oil has shifted the focus of the petroleum industry

into refining heavy oil which has a higher sulfur content.

One of the major concerns in oil refining is the removal of contaminants existing

in crude oil, such as sulfur, nitrogen and oxygen, which may contribute greatly to air

pollution. For instance, sulfur and nitrogen will form sulfur dioxides and nitrogen oxides

after combustion of the fuels (M. Kampa et al., 2008). They are the main compound

causing air pollution, as well as contributing to global warming and acid rain (K. G.

Kropp et al., 1998). In order to minimize the problems, governments have required fuel

refiners to produce high quality fuels, namely with less contaminants. For example, the

limit of sulfur content in diesel fuel has been greatly reduced from 500 ppm to 15 ppm (S.

L. Borgne et al., 2003).

Various physical and chemical processes have been applied for the removal of

sulfur from petroleum (desulfurization) such as hydrodesulfurization (HDS) and fluid

catalytic cracking (FCC) (A.Byrns et al., 1943; H.Topsoe et al., 1996). Both of them

2

require high temperature and pressure operation, which is energetically costly. For

decades scientists in biotechnologies have tried to involve organisms, especially bacteria,

in the desulfurization process. This is called biodesulfurization (BDS). Biocatalysts can

often mediate processes more efficiently and environmentally-friendly with less by-

products than conventional chemical methods. The most common organosulfur

compound in oil fractions used for diesel fuel is dibenzothiophene (DBT; Figure 1.1),

which is now the model compound for studying BDS applied to petroleum (B. L.

McFarland et al., 1998).

Figure 1.1 Structure of DBT.

The model biocatalyst for DBT metabolism is Rhodococcus strain IGTS8 which

enzymatically converts DBT to the non-sulfur containing compound 2-hydroxy-biphenyl

(2-HBP) and sulfite. This pathway is known as the Dsz pathway (Figure 1.2).

Variations of the Dsz pathway have been found in a number of other bacteria including

thermophiles.

3

Figure 1.2 The Dsz Metabolic Pathway for DBT desulfurization (J. Kilbane et al., 2004).

4

One of the major concerns in BDS research is to improve the activity of

biocatalysts. With DBT as the model compound, it is assumed that bacteria with better

growth on DBT medium can desulfurize DBT more efficiently. Culture 32O, isolated by

Joelle Salazar and Batzaya Davaadelgar of our lab from the environment near the Field

Museum in Chicago, contains the bacteria being studied in the following thesis. 32O can

grow in CDM minimal medium with DBT as the sole sulfur source. Two uniform

species, 32O-W and 32O-Y, were obtained from culture 32O by Jia Wang through a

series of passages and purifications. A phylogenetic study based on 16S rRNA sequence

analysis showed that both of them are identified as Paenibacillus species. Both 32O-W

and 32O-Y are thermophilic and can grow in rich medium up to 56 C (32O-Y) and 63C

(32O-W). Only 32O-Y can utilize DBT as sole sulfur source. Coculturing of 32O-W with

32O-Y enhances the ability of 32O-Y to utilize DBT. 32O-Y can utilize DBT up to a

temperature of at least 50C with an optimum of 40-45C. Like Rhodococcus IGTS8,

32O-Y converts DBT to 2-HBP. The further concern of the work in this thesis is the

improvement of 32O-W and 32O-Y as biocatalysts, particularly since they may be able to

be used at somewhat elevated temperatures, at which petroleum is more easily mixed.

Vitreoscilla is a genus of Gram-negative aerobic bacteria. Bacterial hemoglobins

(in the case of Vitreoscilla known as VHb) were first discovered in Vitreoscilla; the

cloning of its gene (vgb) and expression of vgb in heterologous hosts has demonstrated its

value in a wide range of biotechnological applications including promotion of cell

growth, protein synthesis, respiration and metabolite productivity (D. Webster et al.,

1996; Stark, et al., 2012). We found one report on the enhancement of the Dsz pathway

by expression of VHb (H. Liu et al., 2007). In this thesis we tried to clone the VHb gene

5

(vgb) into 32O-W and 32O-Y to see whether VHb expression could enhance their ability

to metabolize DBT. Plasmid pNW33N was used as shuttle cloning vector for this work.

pNW33N is a fifth generation vector that stably replicates in both thermophilic Bacillus

species and E. coli. We thus hoped that pNW33N would be a suitable vector for the two

Paenibacillus species 32O-Y and 32O-W.

As thermophilic BDS activity depends greatly on temperature, it is necessary to

research into different thermophilic environments, namely different temperatures. As the

stability of hemoglobin in higher temperatures remains unknown, in the work described

here we compared the ability of these species expressing VHb with the nontransformed

controls for both growth in medium with DBT as the sole sulfur source, and ability to

produce 2-HBP. Our overall goal was to determine whether we could confirm the

previous report that engineering with VHb can enhance DBT metabolism, and provide

further guidance on ways to improve this enhancement.

1.2 Validating the expression of mutated VHb

Another part of this thesis contains the validation of VHb expression for vgb gene

mutant vgb-M2. The vgb-M2 gene was obtained from the lab of Professor David Ollis of

the Australian National University in Canberra, Australia. Members of the Ollis group

constructed a library of mutated vgb genes in vitro using error prone PCR. Following this

the mutant library was cloned en masse into a pUC plasmid and the resulting clones

transformed into E. coli DH5. The resulting library of transformants was grown in a

mixed culture through many passages to enrich for the fastest growing transformants.

Individual transformants were then isolated from this enrichment culture and rechecked

individually for growth rate compared to that of DH5 bearing wild type vgb. Those

6

purified clones with significantly faster growth than the wild type vgb bearing strain were

isolated; one of them is designated vgb-M2. Vgb-M2 contains 6 point mutations; one of

them is a non-sense mutation (TAG/UAG), which will prevent the synthesis of the

complete VHb amino acid chain. However, as a UAG nonsense suppressing tRNA exists

in E. coli DH5, it became hard to know for certain whether the vgb-M2 gene can be

expressed efficiently in this strain and whether the expressed VHb is functional (that is

can bind ligands such as O2 and CO). In this thesis, our work was to check the existence

of VHb in a vgb-M2 culture compared with a positive control of the same bacterial strain

bearing pUC-8:16, a plasmid that was previously constructed in our lab and can be

expressed to produce wild type VHb. A negative control of an untransformed DH5

culture was also included. The technique used to assay for functional VHb was the CO-

difference spectrum.

7

CHAPTER 2

MATERIALS AND METHODS

2.1 Chemicals, buffers, enzymes and ladders

Chemicals and buffers used are as follows: Na2CO3 (10% w/v), dibenzothiophene

(DBT), Gibbs reagent (2,6-dichloroquinone-4-chloroimide), 2-hydroxybiphenyl (2-HBP),

NaOH and HCl for pH adjustment, phosphate buffer (0.05 M, pH 7.2) (Na2HPO4 (4.33

g/L) and KH2PO4 (2.65 g/L)) and Na2S2O3.

Enzymes used in this thesis were: PstI, HindIII, Taq polymerase master-mix (5X),

T4 DNA ligase and appropriate buffers (all from New England Biolabs). QIAprep

miniprep kits and QIAEX II gel extraction kit (Qiagen) were also used.

DNA ladders used in this thesis were: HindIII digested lambda DNA and 2 log

ladder (NEB).

2.2 Bacterial strains, plasmids and medium

Escherichia coli strain DH5 competent cells (NEB) were used for plasmid

construction, replication and expression of pNW33N-vgb. Pure cultures of 32O-W and

32O-Y plate stocks (from Jia Wang) were also used in this thesis. Plasmid pNW33N (De

Rossi et al., 1994) was obtained from the Bacillus stock center at Ohio State University.

Medium used in this thesis included: LB medium (pH 7.0): tryptone (10 g/L),

yeast extract (5 g/L), NaCl (10 g/L), adjusted pH to 7.0 with 5M NaOH and CDM

(Chemically Defined Medium): phosphate buffer (1 M, 20X, pH 7.2) (Na2HPO4 (86.6

g/L) and KH2PO4 (53 g/L)), NH4Cl (1M, 100X) (54 g/L), MgCl2 (1M, 1000X) (204 g/L),

CaCl2 (0.3 M, 1000X) (44 g/L), trace elements (1000X, pH 6.7) containing FeCl3 (2.04

g/L), ZnCl2 (70 mg/L), MnCl2 (100 mg/L), CuCl2 (20 mg/L), NiCl2 (20 mg/L), Na2MoO4

8

(40 mg/L), H3BO4 (20 mg/L) and glucose solution (1M). Phosphate buffer, NH4Cl,

MgCl2 and CaCl2 and glucose were separately prepared, sterilized and stored. Trance

element solution was sterilized by filtration. The ingredients of 1L working CDM

medium were: 50 mL of 20X phosphate buffer, 10 mL of 100X NH4Cl, 1 ml of 1000X

MgCl2, 1 mL of 1000X CaCl2, 1 mL of 1000X trace elements and 30 mL of 1 M glucose

solution.

2.3 Construction of pNW33N-vgb

Preparation of insert fragments (vgb). Vgb was amplified from pUC8:16 (which

contains vgb cloned into pUC8) by PCR with forward primer (5-CAT GAT AAG CTT

AGG AGG CTA GAT GTT AGA CCA GCA AA-3) and reverse primer (5-CAT GAT

CTG CAG TTA TTC AAC CGC TTG AG-3). The PCR system was designed as 1 L

for each primer (final primer concentration of 0.2M), 1 L plasmid pUC8:16, 10 L 5X

Taq mastermix, 37 L milliQ H2O (with a total volume of 50 L). The PCR reaction was

performed in the following conditions: initial denaturation at 94 C for 6 min,

denaturation at 94 C for 1 min, annealing at 48 C for 30 sec and extension at 68 C for

30 sec. 30 cycles were performed in those PCR steps, with a final extension at 68 C for

10 min.

Gel extraction of the fragments (vgb). The amplified fragments were extracted by

gel extraction. The expected DNA band was excised from the agarose gel with a clean,

sharp scalpel. Buffer QX1 was added and QIAEX beads were resuspended in the

solution, followed by incubation at 50C for 10 min until the color of the mixture became

yellow. The sample was then centrifuged down, washed by Buffer QX1 three times and

9

eluted with 20 L of TE. Finally the mixture was centrifuged and the supernatant was

harvested into a clean tube as the clean vgb fragment.

Miniprep of pNW33N. The pNW33N plasmid was originally stored as

DH5/pNW33N in a glycerol stock. A fresh plate stock was made from the glycerol

stock and then a fresh liquid culture in LB-ampicillin (25g/mL) was grown from a

colony on the plate. A mini-preparation was conducted to extract the pNW33N plasmid.

Restriction Digestion. The sample fragments and vector plasmid pNW33N were

both digested with PstI and HindIII. Plasmid pNW33N was digested in the system of 2

L vector, 2 L buffer 2, 1 L PstI, 1 L HindIII and 14 L milliQ H2O. The vgb

fragments were digested in the system of 16 L fragments, 2 L buffer 2 and 1 L for

each enzyme. Both systems were 20 L total volume. The mixtures were incubated at

37C for 2 hours followed by 20 min in 80C for the inactivation of the enzymes.

Ligation of pNW33N and vgb fragment. After the preparation of both of the

plasmid vector pNW33N and vgb fragment, their concentrations were measured

(pNW33N: 65.9 ng/L; vgb: 16.2ng/ L) using a nanodrop spectrophotometer. The

ligation system was determined using a molar ratio of 3:1 (insert : vector), namely 1.25

L of fragments, 0.77 L of vector, 2 L 10X Buffer, 15 L of milliQ H2O and 1 L of

T4 ligase. The mixtures were incubated at 4C overnight.

Transformation of constructed pNW33N-vgb plasmid. The DH5 competent cells

were thawed on ice and mixed with 100 ng ligation mixture. The mixture was incubated

on ice for 30 min, heat-shocked at 42C for 45 seconds and immediately placed on ice for

2 min. The competent cells were transferred to LB medium and cultured for 2 hours at

37C. The culture was centrifuged and resuspended with 100 L LB medium, then spread

10

on an LB-Chl (25g/mL) plate for the selection of the transformants. The plates were

incubated at 37C overnight.

Validation of constructed pNW33N-vgb plasmid. After the colonies on the LB-Chl

plate grew, a single colony was picked from the plate and transferred to 5mL liquid LB-

Chl medium for an hour culture (at 37C). A mini-prep was conducted on the culture to

extract the amplified plasmid pNW33N-vgb. The plasmid pNW33N-vgb was then

verified by restriction enzyme digestion with PstI and HindIII, along with agarose gel

electrophoresis. After the bands on the gel were verified, 5 L of the plasmids were sent

for sequencing to fully validate the correctly constructed pNW33N-vgb.

2.4 Transformation of plasmid pNW33N-vgb into 32O-W and 32O-Y

Preparation of 32O-W and 32O-Y electrocompetent cells. Single colonies of 32O-

W and 32O-Y were both picked from previous plate stocks and transferred to liquid LB

medium and cultured for 16-20 hours at 50C. Then 1 ml of each culture was diluted into

100 ml of LB medium with an initial OD600nm of 0.05. The cells were grown at 50C, 200

rpm until the OD600nm reached 0.6. Ampicillin was added to the culture with a final

concentration of 200 g/mL and the culture continued at 50C for another 2 hours. The

cells were harvested by centrifugation at 4C, 5000 rpm in the Sorvall SS34 rotor for 10

min and washed 4 times, each time with 1.0 ml 0.3 M sucrose. Then the pelleted cells

were resuspended in 1 ml of ice cold 0.5 M sucrose and stored at -40C.

Electroporation. 500 ng plasmid and 30 L competent cells were added together

into a sterile and ice-cold 1.5 mL microcentrifuge tube and gently mixed by pipetting.

The mixture was then transferred to a sterile ice-cold electroporation cuvette. The cuvette

was covered and placed into the electroporation apparatus (BTX model ECM 830) and

11

given a pulse at 1500 V for 200 s. The mixture was immediately transferred to 1 mL

SOC medium in a 5 mL tube and cultured at 37 C, 200 rpm for 6 hours for recovery.

After the recovery, cells were harvested by centrifugation at 5000 rpm in the Sorvall

SS34 rotor for 1 min. Most of the medium was discarded, with a little amount left to

resuspend the pellets and spread on an LB-Chl (25 g/mL) plate. Those plates were

incubated at 37 C overnight.

Validation of electroporation. After colonies were grown on the selective plates,

random colonies were picked up for colony PCR using the primers previously mentioned.

In this thesis, only the transformed 32O-Y colony grew on the selective plates, so an

original untransformed 32O-Y colony was used as the negative control. A

DH5/pNW33N-vgb colony was used as the positive control. The PCR reaction was

performed in the following conditions: initial denaturation at 94 C for 6 min,

denaturation at 94 C for 1 min, annealing at 48 C for 30 sec and extension at 68 C for

30 sec. 30 cycles were performed in those PCR steps, with a final extension at 68 C for

10 min. The PCR products were transferred to an agarose gel for electrophoresis analysis.

2.5 32O-Y/pNW33N-vgb growth assay at different temperatures

Preculture. In order to standardize the starting culture for growth at different

temperatures, each time the 32O-Y/pNW33N-vgb cells were freshly cultured in LB-Chl

(25 g/mL) medium. After this preculture reached OD600nm 0.5, 500 L of preculture

was transferred to CDM-DBT-Chl (25 g/mL) medium for culturing at different

temperatures.

Growth rates at different temperatures. 32O-Y/pNW33N-vgb was cultured in 50

mL CDM-DBT-Chl (25 g/mL) medium at various temperatures including: 40 C, 42 C,

12

45 C, 47 C and 50 C along with the negative control of untransformed 32O-Y at the

corresponding temperatures. The OD600nm of each culture was recorded every day until

the cultures reached their maximum OD600nm.

2.6 Gibbs Assay

Standard Curve. Standard samples of 2-HBP were prepared in a series of

concentrations: 0 g/mL, 1 g/mL, 2 g/mL, 4 g/mL, 8 g/mL, 16 g/mL, 32 g/mL

and 50 g/mL. The Gibbs Assay was performed on each sample to create a standard

curve for converting the OD610nm results to 2-HBP concentrations in mol/mL.

Gibbs Assay. After the OD600nm of each culture of 320-Y/pNW33N reached

maximum, 1 mL of culture was transferred to a new centrifuge tube. The samples were

adjusted to pH 8.0 with 10% (w/v) Na2CO3. 10L of Gibbs reagent was added to each

sample, mixed in by vortexing and the sample incubated at room temperature for 1 hour.

The cells were centrifuged down at 12000 rpm for 1 min in a microfuge and the

absorbance of the supernatant was measured at 610 nm. The absorbance values were then

converted to the concentration of 2-HBP using the standard curve.

2.7 Transformation of M2-vgb

The DH5 competent cells were thawed on ice and mixed with 100 ng pUC-M2-

vgb plasmid mixture. The mixture was incubated on ice for 30 min, heat-shocked at 42C

for 45 seconds and immediately placed on ice for 2 min. The competent cells were

transferred to LB medium and cultured for 2 hours at 37C. The culture was centrifuged

and resuspended with 100 L LB medium, then spread on an LB-Amp (25g/mL) plate

for the selection of the transformants. The plates were incubated at 37C overnight. The

13

miniprepped plasmid pUC-M2-vgb from transformed DH5/M2-vgb was sent for

sequencing.

2.8 CO-difference spectra

DH5/M2-vgb, DH5/pUC8:16 and DH5 were cultured in 50mL LB medium at

37 C for 24-36 hours at 200 rpm with corresponding antibiotics (DH5/M2-vgb,

ampicillin (25 g/mL); DH5/pUC8:16-vgb, ampicillin (25 g/mL); DH5, none) until

the OD600nm reached 1.0. Cells were harvested in empty pre-weighed sterile tubes and

centrifuged down at 5000 rpm for 15 min at 4 C in the Sorvall SS34 rotor, followed by

resuspension and washing with 0.05M Tris-HCl buffer (pH 7.5). The supernatants were

discarded and the tubes were reweighed. The actual cell weight was determined as the

weight of cells plus the tube minus the empty tube weight. The pellets were resuspended

with 0.01 M Tris-HCl buffer, lysozyme (4mg/g of cell weight), DNase I (0.05mg/g of cell

weight) and RNase A (0.05 mg/g of cell weight). The mixtures were then incubated at 4

C for 24 hours on a magnetic stirrer at a low speed. The cell debris were harvested by

centrifugation at 10,000 rpm for an hour at 4 C in the Sorvall SS34 rotor. The

supernatants were transferred to new tubes for scanning spectrophotometry analysis. A

small amount of Na2S2O3 was added to each tube for the reduction of the heme iron to the

Fe+2 valence. Each sample was tested as a set of two. The spectrophotometer took the

difference between the two samples at each wavelength between 400 nm to 600 nm.

Baseline correction was performed to ensure the absorbance of the two samples were the

same. After the baseline correction, one of the samples was saturated with CO for the

covalent bonding of hemoglobin and CO. After 1 min of saturation (about 1 bubble of

CO per second), the samples were again compared in the spectrophotometer and the

14

differences at each wavelength between 400 nm to 600 nm were captured. A graph of the

resulting CO-difference spectrum was automatically outputted by the software

controlling the spectrometer.

15

CHAPTER 3

RESULTS

3.1 Construction of pNW33N-vgb

The vector pNW33N and plasmid pUC8:16 which contains the wild type vgb

gene were identified by electrophoresis (Figure 5.1). The vgb sequence was amplified by

PCR from plasmid pUC8:16. Both the vgb amplicon and the vector pNW33N were

digested by restriction enzymes PstI and HindIII. Ligation was performed and the

products were transformed into E. coli DH5. A miniprep was performed to extract the

plasmid pNW33N-vgb. Restriction enzyme digestion was used on extracted pNW33N-

vgb for validation (Figure 5.1). The plasmid map of pNW33N-vgb is shown in Figure 5.3.

3.2 Transformation of plasmid pNW33N-vgb into 32O-W and 32O-Y

Plasmid pNW33N-vgb was transformed into 32O-W and 32O-Y by

electroporation. The transformation with 32O-Y was successful. The transformed 32O-Y

was cultured and tested for growth on an LB-Chl (25 g/mL) plate. Colony PCR on 32O-

Y/pNW33N-vgb was used for further validation. The PCR results were run on an agarose

gel (Figure 5.2).

3.3 32O-Y/pNW33N-vgb growth rates

32O-Y/pNW33N-vgb and untransformed 32O-Y were cultured in CDM-DBT

medium at 45 C. The growth curve is shown in Figure 5.4. All the growth data are

summarized in Table 5.1.

3.4 Gibbs Assay

After the growth of 32O-Y/pNW33N-vgb and untransformed 32O-Y reached the

maximum, Gibbs Assay was performed on them to measure their abilities regarding

16

conversion of DBT to 2-HBP (Table 5.2). The Gibbs Assay results of both 32O-

Y/pNW33N-vgb and untransformed 32O-Y were compared and are shown in Figure 5.6.

The Gibbs Assay standard curve is shown in Figure 5.5.

3.5 Transformation of M2-vgb

Plasmid M2-vgb was transformed into E. coli DH5 and cultured on an LB-Amp

(25 g/mL) plate. Colony PCR was performed on the transformed DH5 for validation.

The PCR results are shown in Figure 5.2. The sequencing result of M2-vgb is shown in

Figure 5.7. For comparison, the sequence of wild type vgb is shown in the Appendix.

3.6 CO-difference spectra

DH5/M2-vgb, DH5/pUC8:16 and DH5 were cultured in LB medium. The

cells were collected and lysed. The supernatants were used for CO-difference spectra

determination. The spectra were automatically outputted (Figure 5.8). All the absorbance

data from the spectra were converted to the concentration of VHb and normalized to the

concentration of cells used to make the cell lysate as described by Dikshit and Webster

(Dikshit and Webster, 1988) (Table 5.3).

17

CHAPTER 4

DISCUSSION

4.1 Genetic engineering of 32O-W and 32O-Y

Plasmid Construction. The genetic engineering of 32O-W and 32O-Y is one of

the main goals of this thesis. Originally, we chose plasmid pRESX-vgb which was

obtained from Jia, another member in our lab, for the transformation. However, none of

the transformation attempts were successful. The main reason that came into concern in

this regard is that 32O-W and 32O-Y are both Paenibacillus species, while plasmid

pRESX is a shuttle vector used for transformation between Escherichia and Rhodococcus

species (R. van der Geize, et al. 2008). So we introduced shuttle vector pNW33N into

this transformation process. pNW33N was confirmed to be able to replicate in both

Bacillus and Escherichia species. Plasmid pNW33N features a large multiple cloning site

and encodes a chloramphenicol acetyltransferase that is expressed in both gram-positives

and gram-negatives, so chloramphenicol was used as the antibiotic in the transformation.

Electroporation. Both 32O-W and 32O-Y were tried regarding transformation

with pNW33N-vgb. The attempt with 32O-Y was successful, which was validated by

colony PCR. Only a few colonies were grown on the selective plate for 32O-W

transformation and they grew relatively slowly and showed different morphology

compared to untransformed 32O-W colonies. That suggested those transformants may

have been false positives or even contaminants. Further colony PCR confirmed that the

transformants did not contain the vgb gene. Various reason may have caused the failure

in transformation, so we shifted our focus of genetic engineering of both 32O-W and

32O-Y into 32O-Y alone.

18

4.2 Growth Assay of 32O-Y/pNW33N-vgb at different temperatures

32O-Y/pNW33N-vgb was cultured at 45 C at first. The culture grew slowly

directly from colonies to CDM-DBT medium so pre-culturing in LB medium was used.

Compared with the untransformed 32O-Y culture which has a light yellow color, the

32O-Y/pNW33N-vgb culture has a red color which indicates the expression of VHb.

Surprisingly, untransformed 32O-Y grows much faster than the 32O-Y-transformant. The

original hypothesis is that the introduction of vgb into 32O-Y will help with the growth,

but the growth assay suggests that the expression of VHb may interrupt the metabolism

of 32O-Y. One possible reason is that 32O-Y may not be able to form the correct

structure of VHb and that is harmful for their growth. As the temperatures went up, this

phenomenon became more obvious because VHb is less stable at higher temperature.

4.3 Problems with the Growth Assay

The major problem with the growth assay is the culture of untransformed 32O-Y.

32O-Y has no antibiotic resistance and grows relatively slowly directly in CDM-DBT

medium. This makes the culture easy to contaminate. Another problem lies in repeated

passages during growth in different temperatures. Both 32O-Y/pNW33N-vgb and

untransformed 32O-Y strains were transferred from cultures at one temperature to

cultures at the next temperature. It is possible due to the repeated passages that the

variability becomes a lot greater than we expect from normal experiment. At the late

stage of the repeated passages, the growth rates of both strains changed dramatically.

Colony PCR was tested on the late cultures and no vgb gene was detected. The reason

may lie in both mutations in the bacteria and plasmid elimination, which were difficult to

document in this thesis. So only the growth data at 45 C have been analyzed.

19

4.4 Gibbs Assay

The Gibbs Assay was performed on the 45 C cultures of both 32O-Y/pNW33N-

vgb and untransformed 32O-Y at the point at which cell densities in the cultures had

become maximum. The result for 32O-Y/pNW33N-vgb is almost 10% higher than that of

untransformed 32O-Y. This indicates that 32O-Y/pNW33N-vgb can convert it to 2-HBP

more effectively than untransformed 32O-Y. As we already found out that the

untransformed 32O-Y grows faster than 32O-Y/pNW33N-vgb, the advantage of 32O-

Y/pNW33N-vgb in sulfur metabolism on a per cell mass basis is more obvious. The

results suggest that introducing hemoglobin cannot enhance the growth rate of 32O-Y,

however, it can greatly enhance its ability utilize DBT. The principle is that hemoglobin

can help deliver oxygen to the monoxygenase (P. A. Fish, et al. 2000; J. M. Lin, et al.

2003), which is crucial in the 4 S metabolizing pathway.

4.5 Structure-function study of M2-vgb

Plasmid M2-vgb was transformed into DH5 successfully. The plasmid obtained

from miniprep of the transformed DH5 was sent for sequencing. The sequencing result

matched the record we got from Professor David Ollis and showed that there are 6 point

mutations in the vgb-M2 mutant gene, 3 of these are neutral mutations, 2 result in amino

acid substitutions and one is an amber (UAG) mutation. The amber mutation is expected

to be suppressed to some degree by the amber suppressor tRNA encoded in the genome

of DH5. DH5/M2-vgb, DH5/pUC8:16 and untransformed DH5 were cultured and

lysed for the CO-difference spectrum study. As the positive control, DH5/pUC8:16,

which expresses wild type VHb showed peak in the spectrum, 0.87 A units, at 420 nm

and trough in the spectrum (-0.51 A units) at 437 nm, and two minor peaks at 572 nm and

20

557 nm. All of these features are characteristic of CO-difference spectra of wild type

VHb. The spectrum of untransformed DH5 only has two minor peaks, 0.084 at 423 nm

and 0.045 at 446 nm, neither of which is characteristic of VHb. Compared to

DH5/pUC8:16, the peak wavelength shifts from 420 nm to 423 nm and the trough

wavelength from 437 nm to 446 nm. The reason is that although untransformed DH5

will not synthesize VHb, bacteria will still produce heme proteins (particularly

cytochromes in their membrane) which will also bind with CO and cause the peaks to

show. For the spectrum of DH5/M2-vgb, the graph is similar to that of untransformed

DH5. All the data were converted to the concentration of VHb and normalized to the

concentration of cells (0.25g/mL) used to make the cell lysate in each case.

DH5/pUC8:16 can synthesize 19.7 nMol/g VHb, while DH5/M2-vgb and

untransformed DH5 can only synthesize 0.12 nMol/g and 0.35 nMol/g of heme proteins

that are not VHb.

This result indicates that the DH5/M2-vgb strain is not able to synthesize

functional VHb. This is unexpected, since the Ollis group had selected the vgb-M2

bearing strain because it grows faster than matched strain bearing wild type VHb. It now

appears that that growth advantage may not be due to hemoglobin produced from the

vgb-M2 gene. In contrast, either one or more of the missense mutations in vgb-M2 results

in a non-functioning VHb, or perhaps the amber mutation in vgb-M2 is not efficiently

suppressed, leading to production of a truncated, and also non-functional, VHb.

21

CHAPTER 5

FIGURES AND TABLES

22

Figure 5.1. Gel picture of plasmid pNW33N and RE digestion of pNW33N-vgb. Lanes 1

and Lane 6, HindIII digested lambda DNA marker; lanes 2 and 3, PstI and HindIII

digested pNW33N-vgb (4.6 kbp), two bands in each lane, pNW33N (4.2 kbp) and vgb

fragment (~460 bp); lanes 4 and 5, vector pNW33N (4.2 kbp).

0.46

23

Figure 5.2. Gel picture of colony PCR results for 32O-Y/pNW33N-vgb and DH5/M2-vgb. Lanes 1 and 2, colony PCR results for 32O-Y/pNW33N-vgb (~460 bp); lanes 3 and

4, colony PCR results for DH5/M2-vgb (~460 bp); lane 5, HindIII digested lambda DNA marker.

24

Figure 5.3. Plasmid map of constructed pNW33N-vgb.

25

Figure 5.4. Growth Curve of untransformed 32O-Y (ori) and 32O-Y/pNW33N-vgb at 45C. Values are averages of three independent measurements. Error bars indicate

standard deviations.

0

0.5

1

1.5

2

2.5

0 1 2 3 4 5 6 7

Ab

sorb

ance

Days

Growth Curve of 32O-Y ori and vgb at 45C

ori

vgb

26

Figure 5.5. Standard Curve for Gibbs Assay.

0

1

2

3

4

5

6

7

0 10 20 30 40 50 60

Ab

sorb

ance

[2-HBP] (ug/ml)

Gibbs Assay Standard Curve

27

Figure 5.6. Comparison of 2-HBP productions by untransformed 32O-Y and 32O-

Y/pNW33N-vgb. 32O-Y/pNW33N-vgb produced 10% more HBP than untransformed

32O-Y (1 mL of culture was taken from each culture after maximum growth was

reached).

10

11

12

13

14

15

16

untransformed 32O-Y 32O-Y/pNW33N-vgb

[2-H

BP

] (u

g/m

l)

Strains

2-HBP Production

28

Figure 5.7. Sequence of vgb Mutant 2. The promoter region is highlighted in magenta. The

coding sequence is highlighted in yellow. All six point mutations (changes from wild

type vgb) are indicated in red. The nonsense mutation is indicated in blue.

29

Figure 5.8. CO-Difference Spectra of DH5/M2-vgb, DH5/pUC8:16 and untransformed DH5. Green, DH5/pUC8:16; orange, DH5/M2-vgb; red, untransformed DH5.

DH5/pUC8:16 -- Green

DH5/M2-vgb -- Orange

DH5 -- Red

30

Table 5.1. Growth Assay data of 32O-Y/pNW33N-vgb at 45C. Samples for the Gibbs

assay were taken from the 32O-Y culture during day 6 and from the 32O-Y/pNW33N-

vgb culture during day 4.

Days

A32O-Y A32O-Y/pNW33N-vgb

Triplicate Triplicate

Start 0.030 0.043 0.037 0.030 0.028 0.028

Day 1 0.133 0.122 0.121 0.096 0.102 0.093

Day 2 0.899 0.832 0.707 0.461 0.562 0.543

Day 3 1.910 1.902 1.452 0.896 0.960 1.002

Day 4 1.980 2.004 1.552 1.100 1.089 0.950

Day 5 2.134 2.440 1.762 0.926 0.952 0.828

Day 6 2.208 2.672 1.972 0.844 0.952 0.721

31

Table 5.2. Gibbs Assay data for untransformed 32O-Y and 32O-Y/pNW33N-vgb. Values

are averages of three independent measurements; standard deviations are indicated.

Samples for the Gibbs assay were from the cultures from which the growth data in

Figure 5.4 and Table 5.1 were taken.

Strain Absorbance S.D.

Untransformed 32O-Y 1.871 0.079

32O-Y/pNW33N-vgb 2.028 0.007

32

Table 5.3. VHb levels in untransformed DH5 (no VHb), DH5/pUC8:16 (wild type VHb) and DH5/M2-vgb (mutant 2 VHb). Values are averages of three independent measurements; standard deviations are included. Calculations were made using the

extinction coefficient E419-436=274 mM-1cm-1 (Dikshit and Webster, 1988) and normalized to the concentration of cells (0.25g/mL) used to make the cell lysate in each

case.

Strain VHb levels (nMol/g)

Standard Deviation (nMol/g)

DH5/pUC8:16 19.68 0.76

DH5/M2-vgb 0.12 0.05

Untransformed-DH5 0.35 0.01

33

APPENDIX A

SEQUENCE OF VGB GENE

3

60

34

AAGCTTACAGGACGCTGGGGTTAAAAGTATTTGAGTTTTGATGTGGATTAAG

TTTTAAGAGGCAATAAAGATTATAATAAGTGCTGCTACACCATACTGATGTAT

GGCAAAACCATAATAATGAACTTAAGGAAGACCCTCATGTTAGACCAGCAAA

CCATTAACATCATCAAAGCCACTGTTCCTGTATTGAAGGAGCATGGCGTTACC

ATTACCACGACTTTTTATAAAAACTTGTTTGCCAAACACCCTGAAGTACGTCC

TTTGTTTGATATGGGTCGCCAAGAATCTTTGGAGCAGCCTAAGGCTTTGGCGA

TGACGGTATTGGCGGCAGCGCAAAACATTGAAAATTTGCCAGCTATTTTGCCT

GCGGTCAAAAAAATTGCAGTCAAACATTGTCAAGCAGGCGTGGCAGCAGCGC

ATTATCCGATTGTCGGTCAAGAATTGTTGGGTGCGATTAAAGAAGTATTGGG

CGATGCCGCAACCGATGACATTTTGGACGCGTGGGGCAAGGCTTATGGCGTG

ATTGCAGATGTGTTTATTCAAGTGGAAGCAGATTTGTACGCTCAAGCGGTTGA

ATAAAGTTTCAGGCCGCTTTCAGGACATAAAAAACGCACCATAAGGTGGTCT

TTTTACGTCTGATATTTACACAGCAGTTTGGCTGTTGCCAAAACTTGGGACAA

ATATTG

The coding sequence is in gray. The promoter region is underlined.

35

BIBLIOGRAPHY

Byrns A., et al. 1943. Catalytic desulfurization of gasolines by cobalt molybdate process,

Industrial & Engineering Chemistry, vol. 32, pp. 1160 1167.

Borgne S. L. and Quintero R. 2003. Biotechnological processes for the refining of

petroleum, Fuel Processing Technology, vol. 81, pp. 155 169.

De Rossi E., et al. 1994. New shuttle vector for cloning in Bacillus stearothermophilus,

Res Microbiol, vol. 145, pp. 579 583.

Dikshit K. L. and Webster D. A. 1988. Cloning, characterization and expression of the

bacterial globin gene from Vitreoscilla in Escherichia coli, Gene, vol. 70, pp. 377 386.

Fish P. A., et al. 2000. Vitreoscilla hemoglobin enhances the first step in 2,4-dinitrotoluene

degradation in vitro and at low aeration in vivo, J Molec Catalysis B: Enzymatic, vol. 9,

pp. 75 82.

Kilbane II J. and Borgne S.L. 2004. Petroleum biorefining: the selective removal of sulfur,

nitrogen, and metals, Studies in Surface Science and Catalysis, vol. 151, pp. 29 65.

Kropp K. G. and Fedorak P. M. 1998. A review of the occurrence, toxicity, and

biodegradation of condensed thiophenes found in petroleum, Canadian Journal of

Microbiology, vol. 44, pp. 605 622.

Kampa M. and Castanas E. 2008. Human health effects of air pollution, Environmental

Pollution, vol. 151, pp. 362 367.

Lin J. M., et al. 2003. Effects of Vitreoscilla hemoglobin on the 2,4-dinitrotoluene (DNT)

dioxygenase activity of Burkholderia and on DNT degradation in two-phase

bioreactors, J Ind Microbiol Biotechnol, vol. 30, pp. 362 368.

McFarland B. L., et al. 1998. Biocatalytic sulfur removal from fuels: applicability for

producing low sulfur gasoline, Critical Reviews in Microbiology, vol. 24, pp. 99 - 147.

Rhee M. S., et al. 2007. Development of plasmid vector and electroporation condition for

gene transfer in sporogenic lactic acid bacterium, Bacillus coagulans, Plasmid, vol. 58,

pp. 13 22.

Stark B. C. 2012. The biochemistry of Vitreoscilla hemoglobin, Computational and

Structural Biotechnology Journal, vol. 3, pp. 1 8.

Topse H., et al. 1996. Hydrotreating catalysis, Catalysis-Science and Technology, vol. 11,

pp. 1 269.

36

Van der Geize R., et al. 2008. Characterization of a second Rhodococcus erythropolis SQ1

3-ketosteroid 9-hydroxylase activity comprising a terminal oxygenase homologue, KshA2, active with oxygenase-reductase component KshB, Appl Environ Microbiol,

vol. 74, pp. 7197 7203.

Webster D. and Hackett D. 1966. The purification and properties of cytochrome o from

Vitreoscilla, Journal of Biological Chemistry, vol. 241, pp. 3308 3315.