INFECTION AND IMMUNITY,0019-9567/00/$04.0010

Dec. 2000, p. 7078–7086 Vol. 68, No. 12

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Toxoplasma gondii Homologue of Plasmodium Apical MembraneAntigen 1 Is Involved in Invasion of Host Cells

ADRIAN B. HEHL,1,2 CHRISTINE LEKUTIS,1 MICHAEL E. GRIGG,1 PETER J. BRADLEY,1

JEAN-FRANCOIS DUBREMETZ,3 EDUARDO ORTEGA-BARRIA,1,4

AND JOHN C. BOOTHROYD1*

Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, California 94305-51241;Institute of Parasitology, University of Zurich, CH-8057 Zurich, Switzerland2; EP CNRS 525, Institut de Biologie

de Lille, 59021 Lille Cedex, France3; and Department of Parasitology, Gorgas Memorial HealthResearch and Information Center, Panama 5, Panama4

Received 1 August 2000/Returned for modification 21 August 2000/Accepted 9 September 2000

Proteins with constitutive or transient localization on the surface of Apicomplexa parasites are of particularinterest for their potential role in the invasion of host cells. We describe the identification and characterizationof TgAMA1, the Toxoplasma gondii homolog of the Plasmodium apical membrane antigen 1 (AMA1), which hasbeen shown to elicit a protective immune response against merozoites dependent on the correct pairing of itsnumerous disulfide bonds. TgAMA1 shows between 19% (Plasmodium berghei) and 26% (Plasmodium yoelii)overall identity to the different Plasmodium AMA1 homologs and has a conserved arrangement of 16 cysteineresidues and a putative transmembrane domain, indicating a similar architecture. The single-copy TgAMA1gene is interrupted by seven introns and is transcribed into an mRNA of ;3.3 kb. The TgAMA1 protein isproduced during intracellular tachyzoite replication and initially localizes to the micronemes, as determinedby immunofluorescence assay and immunoelectron microscopy. Upon release of mature tachyzoites, TgAMA1is found distributed predominantly on the apical end of the parasite surface. A ;54-kDa cleavage product ofthe large ectodomain is continuously released into the medium by extracellular parasites. Mouse antiserumagainst recombinant TgAMA1 blocked invasion of new host cells by approximately 40%. This and our inabilityto produce a viable TgAMA1 knock-out mutant indicate that this phylogenetically conserved protein fulfills akey function in the invasion of host cells by extracellular T. gondii tachyzoites.

Toxoplasma gondii is an obligate, intracellular parasite ofwarm-blooded animals. In humans, it is best known as a patho-gen in the developing fetus and in immunocompromised (e.g.,AIDS) patients. It is related to other members of the phylumApicomplexa, such as Plasmodium (the cause of malaria) andEimeria (the cause of coccidiosis).

Over the last few years, T. gondii has been actively developedas a model organism with which to study the biology of api-complexan parasites (6). As part of this effort, a large databaseof expressed sequence tags (ESTs) has been generated, whichled to the tentative identification of numerous Toxoplasmagenes based on homology to coding regions from other organ-isms (1, 19, 25). Parallel efforts to sequence the genomes ofPlasmodium (31) and Cryptosporidium (24, 38, 40) are alsocontributing to the number of apicomplexan sequences depos-ited in the databases. Of particular interest is a class of ho-mologs representing genes that are unique and conservedamong apicomplexan parasites (1). This group of phylogeneti-cally restricted sequences code for proteins closely linked tothe particular biology common to apicomplexans, which opensavenues for functional studies in T. gondii which would bedifficult to do in a less tractable system.

Invasion of host cells by the asexual stages of apicomplexanparasites is a complex, receptor-mediated event, which is stillnot well understood. It involves structures of the apical com-plex (15), specialized surface antigens (17, 32), and productsreleased by secretory organelles (i.e., micronemes, rhoptries,

and dense granules) (7, 14, 30). While some members of thisphylum, such as T. gondii, are extremely promiscuous withrespect to the cell types they are able to infect, others, such asthe asexual stages of Plasmodium and Eimeria, are able toselectively invade only certain specialized cells or tissues. De-spite these differences in host and tissue specificity, there ap-pears to be a significant conservation of the invasion apparatus,on the level of both ultrastructure and proteins associated withapical organelles (15, 16, 39, 41, 42). These common elementsare of particular interest biologically, as they constitute thephylogenetically conserved, basic machinery for host cell inva-sion essential for the survival of these obligate intracellularparasites. Presumably, additional features and/or adaptationsof this basic invasion apparatus have provided each specieswith the ability to infect its respective host(s) or host cell(s)with various degrees of specificity.

T. gondii molecules involved in the interaction with host cellreceptors have been elusive, mainly because of the wide rangeof cells that this parasite is able to invade. Some of the relevantmolecules are most likely concentrated on or at the apicalsurface membrane at the time of invasion and control tempo-rally discrete events. These events include initial attachment,reorientation, triggered secretion of vesicle contents, buildingand translocation of the moving junction, and finally the es-tablishment of a functional parasitophorous vacuole (5, 7, 13).Some putative players in these events have been identified byantibodies raised to proteins of apical structures (27); othershave been discovered as part of the excreted-secreted fractionstored in organelles and released in a controlled fashion uponcontact with the host cell (4, 37).

One of the Plasmodium proteins implicated in invasion is theapical membrane antigen (AMA1) expressed by merozoites.

* Corresponding author. Mailing address: Department of Microbi-ology and Immunology, Stanford University School of Medicine, Stan-ford, CA 94305-5124. Phone: (650) 723-7984. Fax: (650) 723-6853.E-mail: john.boothroyd@stanford.edu.

7078

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

This is a type Ia transmembrane protein with a conserved corestructure determined by 16 cysteine residues in the matureextracellular domain (20). The extracellular portion can besubdivided into three structural domains (I to III), containingsix, four, and six cysteines, respectively, which form intrado-main disulfide bridges (20). The Plasmodium knowlesi andPlasmodium falciparum AMA1 (PkAMA1 and PfAMA1, re-spectively), for example, are synthesized as proproteins of 66and 80 kDa, respectively, in mature trophozoites and segment-ing schizonts and become concentrated at the apical end of theparasites. Upon merozoite release, AMA1 is proteolyticallyprocessed and secreted as a membrane-bound protein onto thesurface of free merozoites, where it distributes over the entireparasite (9, 45). While the biological function of AMA1 is stillunclear, the importance of this minor antigen in the invasion ofred blood cells (RBCs) by free merozoites has been shown inseveral studies (8, 10, 43). Monoclonal antibodies (MAbs)raised against native PkAMA1 were able to prevent invasion ofrhesus RBCs in vitro (43), and immunization of mice withrecombinant and refolded AMA1 or passive transfer of specificAMA1 polyclonal antibodies into Plasmodium chabaudi-in-fected mice prevented lethal parasitemias (2). These data pointto an important role of Plasmodium AMA1 in the invasion oferythrocytes. Here, we show that T. gondii has an AMA1 ho-mologue that is also implicated in the invasion process butlocalizes to the micronemes rather than the rhoptry necks, asseen with Plasmodium AMA1.

MATERIALS AND METHODS

Parasites and cultivation. Tachyzoites of the representative T. gondii strainsRH (36), ME49 (21), and CEP (34) were grown in monolayers of human foreskinfibroblasts (HFF) in Dulbecco’s modified Eagle’s medium (DMEM) supple-mented with 10% Nu-serum, 2 mM glutamine and gentamicin (20 mg/ml) at 37°Cin a humid 5% CO2 atmosphere.

Library searches and nucleic acid techniques. Assembly of sequences andhomology searches of the Toxoplasma EST databases have been described (1, 19,25). Complete descriptions of the databases can be found at the Genome Websites (http://www.ebi.ac.uk/parasites/toxo/toxopage.html and http://cbil.humgen.upenn.edu/toxodb/toxodb.html). TgAMA1 ESTs were identified by searchingthe GenBank database with Toxoplasma EST sequences using BLASTX at NCBI(http://www.ncbi.nlm.nih.gov) and assembled into a single nucleotide sequencecontig with the assembly program of the Wisconsin Package version 9.0 (Genet-ics Computer Group, Madison, Wis.). The lZapII insert TgESTzy99b08.r1,containing a full-length cDNA of TgAMA1 from strain ME49, was obtainedfrom the Washington University–Merck Toxoplasma EST repository via DavidSibley (St. Louis, Mo.). The insert was excised for further sequencing as pBlue-script SKII using the Stratagene ExAssist helper phage according to the manu-facturer’s protocol.

Full-length cDNAs from three T. gondii strains (RH, ME49, and CEP) wereobtained by reverse transcription-PCR amplification of total RNA preparedfrom tachyzoites with Ultraspec RNA (Biotecx Laboratories Inc., Houston,Tex.). Reverse transcription was performed with standard protocols using anoligo(dT) anchor primer (dTAP) and Superscript II (Gibco-Life Sciences). PCRamplification of coding regions was done with nested primers (CSEQ-S andCSEQ-AS) and the adapter primer (AP) using Taq polymerase (Sigma) andstandard cycling conditions. Products were cloned into the pCR2.1-Topo vector(Invitrogen). Sequencing was performed on an ABI PRISM at the StanfordUniversity sequencing facility using custom oligonucleotide primers. Sequencealignments were done using CLUSTALW with the blosum weight matrix anddefault settings via the world-wide web (http://ferrari.ibcp.fr/cgi-bin/Mail_clustalw.pl).

Southern blot. Genomic DNA was obtained from RH strain tachyzoites lysedin a Tris-EDTA-LiCl-Triton buffer (26). The DNA was digested overnight withNheI, KpnI, HindIII, EcoRI, or BglII, separated through a 0.9% agarose gel, andtransferred to a Nytran membrane through capillary action. The membrane wasprobed with a 600-bp AMA1 promoter fragment labeled by random priming with[a-32P]dGTP. After autoradiography, the membrane was stripped and reprobedwith a 1,600-bp AMA1 C-terminal open reading frame (ORF) fragment, alsolabeled by random priming with [a-32P]dGTP.

Northern blot. Total RNA was prepared from tachyzoites with Ultraspec asdirected by the manufacturer (Biotecx Laboratories). Poly(A)-enriched RNAwas derived from the total RNA preparation using the Oligotex mRNA kit(Qiagen, Valencia, Calif.). The RNA was then size fractionated in a 1.0%agarose gel and transferred through capillary action to a Zeta-Probe membrane

(Bio-Rad Laboratories, Hercules, Calif.). The membrane was probed sequen-tially with the 59 and 39 AMA1 fragments described above.

Oligonucleotide primers. The oligonucleotides used included LF-S (AGTGAATTCGTCGACCTTGGACAAGACA), LF-AS (TGAGGATCCTTAGTCGGCCGTGCACTGAAGT), SF-S (ATCGAATTCTGCGCCGAGTTTGCCTTTAAGA), SF-AS (TGAGGATCCTTAACTCCCCGCTGCTGTATACGA), CF-S(CGTGAATTCGCGAAGAGGTTGGACAGA), CF-AS (CGTGGATCCTTAGTAATCCCCCTCGACCATAACA), dTAP (CCGGAATTCGGTACCTCTAGAT18VN), AP (CCGGAATTCGGTACCTCTAGA), CSEQ-S (ATGGGGCTCGTGGGCGTA), CSEQ-AS (GTAGTAATCCCCATCGACCA), AMAKOS(CGAAGCTTGGGACTCAGCTCAAGCACA), AMAKOAS (GCGGCCGCTACGGAATCGCTGTTCT), AMAKOUS1 (GGGCGAGGTCAGCAGATGT),AMAKOUAS (GCGGACAGGCGTAGTAACT), 3DHFRS (GCCATTCATGCCAGTCAGT), KOUS3 (TCCGGCCAAATACATTAAATC), 5DHFRA (GAACAGCAGCAAGATCGGAT), KODAS (ACATAATGTCAACAGCGTAAG), and AMAG (GCCCCATGTGCTTCGTCTCA).

Generation of fusion proteins. Three constructs, long (LF), short (SF), andcytosolic (CF), for production of fusion proteins were generated in the pMal-P2system (New England Biolabs). The fragments were amplified from TgAMA1cDNA from strain RH using the primer pairs LF-S and LF-AS, SF-S and SF-AS,and CF-S and CF-AS. The primers were designed with EcoRI (sense) andBamHI (antisense) restriction sites for cloning into the respective sites of theexpression vector, downstream of the maltose-binding protein (MBP) gene,giving rise to fusion genes MBP-LF, MBP-SF, and MBP-CF. MBP-LF containeda region corresponding to domains I and II of the ectodomain from Val-69 toAsp-410. MBP-SF covered domain I, starting at the second cysteine (Cys-166)and extending through domain II to Asp-379. MBP-CF contained the COOH-terminal 62-amino-acid stretch corresponding to the presumed cytoplasmic do-main from Ala-479 to Tyr-541. Bacterial overexpression was induced using 0.5mM IPTG (isopropyl-b-D-thiogalactopyranoside) for 2 h at 37°C, and fusionproteins were purified from bacterial cold shock lysates on amylose resin accord-ing to standard protocols (35) and lyophilized as previously described (18).

Peptide synthesis. Two peptides corresponding to Ser-21 through Ser-36,starting at the predicted cleavage site of the signal sequence (N-pep: NH-S-G-L-S-S-S-T-R-S-R-E-S-Q-T-L-S-C-COOH) and from the cytoplasmic tail regionGln-489 through lysine 505 (C-pep: NH-C-Y-Q-A-A-H-H-E-H-E-F-Q-S-D-R-G-A-R-K-COOH) of TgAMA1 were synthesized and coupled to keyhole limpethemocyanin (KLH).

Generation of polyclonal antibodies. BALB/c mice were immunized intraperi-toneally on days 0, 15, and 30 with approximately 50 mg of fusion protein orKLH-coupled peptide resuspended in 100 ml of phosphate-buffered saline (PBS)and emulsified with an equal volume of RIBI adjuvant (RIBI ImmunochemResearch Inc., Hamilton, Mont.). Blood was collected prior to initial immuni-zation and after each boost from the tail vein, and the serum fraction was assayedfor specific antibody content.

MAb production. Splenocytes were harvested from an adult BALB/c mouse 3days after boosting with the AMA1 cytoplasmic tail peptide conjugated to KLH.The splenocytes were fused to P3x63Ag8.653 myeloma cells at a 5:1 ratio, andhybridomas were selected in DMEM containing hypoxanthine-aminopterin-thy-midine. Tissue culture supernatants were screened for AMA1 reactivity by West-ern blot using strips derived from a sodium dodecyl sulfate-polyacrylamide gelelectrophoresis (SDS-PAGE) gel of reduced parasite lysate. From this screen,one AMA1 cytoplasmic tail-specific hybridoma was obtained, CL22 (immuno-globulin G2A [IgG2A]).

Inhibition of invasion. Briefly, tachyzoites of the RH strain were pretreated for30 min at 37°C with heat-inactivated antiserum obtained from mice immunizedwith MBP-AMA1 fusion proteins or with normal mouse serum. Pretreatedtachyzoites were added to HFF monolayers in 24-well plates in duplicate. Aftera 1-h incubation period at 37°C, unbound tachyzoites were washed off themonolayers. The number of cell-associated tachyzoites was assessed microscop-ically after fixation or by tritiated uracil incorporation as previously described(33).

Protein analysis. Total lysates were prepared from extracellular tachyzoites inSDS-PAGE sample buffer under reducing conditions. Analytical SDS-PAGEand transfer of proteins to nitrocellulose membranes were performed accordingto standard protocols (3). Filters were blocked in 5% dry milk–0.5% Tween20–PBS and incubated with antisera or MAbs diluted in blocking solution.Bound antibodies were detected with horseradish peroxidase-conjugated goatanti-mouse IgG and developed using enhanced chemiluminescence (ECL; Am-ersham).

Secretion assays. Culture supernatants containing secreted protein were pre-pared by washing freshly lysed tachyzoites twice in RPMI without serum andincubating the parasites at a density of 108/ml in this solution for 5 min to 1 h at37°C. Cells were cooled on ice, pelleted by centrifugation at 1,000 3 g, and lysedin 200 ml of reducing SDS-PAGE sample buffer. The supernatant was recentri-fuged under the same conditions and again at 14,000 3 g for 30 min (4°C). Thecleared supernatant was lyophilized in 200-ml aliquots and dissolved in 100 ml ofreducing SDS-PAGE sample buffer. Approximately 10 ml of each fraction wasseparated on SDS-PAGE and blotted as described above.

Subcellular fractionation. Fractionation of T. gondii (RH strain) was carriedout essentially as described (22). Briefly, parasites were lysed in a Stansted celldisruptor in SMDI (250 mM sucrose, 20 mM MOPS [morpholinepropanesulfo-

VOL. 68, 2000 T. GONDII HOMOLOGUE OF PLASMODIUM AMA1 7079

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

nic acid, pH 7.2], 2 mM dithiothreitol [DTT], 5 mg of leupeptin per ml, and 1 mMphenylmethylsulfonyl fluoride [PMSF]). Unbroken cells and debris were pelletedat 500 3 g for 15 min in a clinical centrifuge. The supernatant was spun for 25min at 25,000 3 g to obtain a high-speed pellet containing organelles, which weresubsequently separated on a 30% Percoll gradient. Three fractions were col-lected: a top band previously described as containing tachyzoite “ghosts,” amiddle fraction enriched in micronemes, and a bottom band containing rhoptriesand dense granules. The three fractions were centrifuged at 100,000 3 g for 90min, and the organelles were collected from the top of the sedimented Percoll,resuspended in an equal volume of SMDI, and separated by SDS-PAGE. Pro-teins were transferred to nitrocellulose by a wet electrophoretic technique. West-ern blots were probed with MAbs using either a 1:50 dilution of tissue culturesupernatant or a 1:1,000 to 1:2,000 dilution of ascites fluid in PBS. The T.gondii-specific MAbs used included MAbs against AMA1 (CL22), MIC2 (6D10)(44), ROP2, ROP3, and ROP4 (T34A7) (22), and GRA3 (2H11) (23).

Immunofluorescence assay. Live tachyzoites were prepared for indirect sur-face immunofluorescence as described previously (18). Cell integrity was moni-tored by labeling with anti-ROP1 and anti-MIC2 antibodies. For analysis ofintracellular parasites, infected fibroblasts grown on glass coverslips were washedin PBS, fixed in cold 2% formaldehyde, and permeabilized with 0.5% TritonX-100 in PBS (PBS-T) for 20 min. Blocking and incubations with diluted antiseraor secondary antibodies were done according to standard methods in 2% bovineserum albumin in PBS-T, and coverslips were washed in PBS between incuba-tions with antibody. Labeled cells were embedded with Vectashield (VectorLaboratories) solution for microscopy.

Immunoelectron microscopy. Immunoelectron microscopy was performed onultrathin cryosections. A tachyzoite-infected Vero cell monolayer was fixed with4% paraformaldehyde–0.05% glutaraldehyde in 0.2 M sodium phosphate bufferfor 90 min, then washed in PBS containing 10% fetal calf serum (PBS-FCS), andinfused in 2.3 M sucrose containing 10% polyvinylpyrrolidone prior to freezingin liquid nitrogen. Sections were obtained on an FCS cryoattachment-equippedLeica Ultracut operating at 2100°C. Sections were floated successively on PBS-FCS, mouse MBP-SF antiserum diluted 1:20 in PBS-FCS, anti-mouse IgG rabbitserum diluted 1:400 in PBS-FCS, 8-nm protein A-gold diluted in PBS to anoptical density at 525 nm (OD525) of 0.05, with five 3-min washings in PBSbetween each step. Sections were then embedded in methylcellulose (2%)–uranyl acetate (0.4%) and observed with a Philips EM 420 electron microscope.

AMA1 knockout. An AMA1 knockout vector was constructed by insertion ofAMA1 flanking sequences on either side of a hypoxanthine-xanthine-guaninephosphoribosyltransferase (HXGPRT) expression cassette in pBluescript (12).Briefly, a 1-kb upstream AMA1 fragment and a 4.5-kb downstream AMA1 frag-ment were obtained by PCR from a genomic DNA template and cloned intopolylinker sites adjacent to the dihydrofolate reductase (DHFR) 59 untranslatedregion (UTR) and 39 UTR so that the AMA1 and HXGPRT sequences sat in thereverse orientation. Specifically, the 4.5-kb AMA1 downstream fragment wasamplified by PCR with the AMAKOS and AMAKOAS primers, whereas the1.0-kb AMA1 upstream fragment was amplified by PCR with the AMAKOUS1and AMAKOUAS primers. Both PCR fragments were shuttled into pCR2.1-Topo (Invitrogen) prior to insertion adjacent to the HXGPRT expression cas-sette. Thus, the HXGPRT expression cassette replaces (in opposite orientation)the AMA1 promoter, start codon, and signal peptide. Approximately 50 mg of theAMA1 knock-out plasmid was linearized with NotI prior to electroporation intoRH strain tachyzoites lacking HXGPRT. After 24 h, transformants were selectedwith 100 mg of mycophenolic acid and 50 mg of xanthine per ml of RPMIcontaining 10% FCS. On day 18 posttransfection, tachyzoites were cloned fromthe drug-resistant population. Genomic DNA was isolated from 80 distinctdrug-resistant clones as well as the drug-resistant population to determinewhether targeted disruption of AMA1 had occurred. Homologous recombinationupstream of AMA1 was analyzed by PCR using a DHFR 39 UTR sense primer(3DHFRS) and an AMA1 primer (KOUS3), which anneals to a region beyondthat included in the knockout vector. Similarly, homologous recombinationdownstream of AMA1 was analyzed by PCR using a DHFR 59 UTR antisenseprimer (5DHFRA) and an AMA1 primer which anneals to a region beyond thatincluded in the knockout vector (KODAS). Interruption of the AMA1 ORF wasmonitored by PCR using AMA1-specific primers KOUS3 and AMAG. The latterprimer anneals to a segment of the AMA1 ORF not present in the knockoutvector. Southern blot analyses were also done on a subset of the drug-resistantclones as described above, in order to confirm the results obtained by PCR.

RESULTS

AMA1 is a conserved protein in Plasmodium and Toxo-plasma. BLASTX analysis of the Toxoplasma EST databaserevealed a clear homologue of Plasmodium AMA1 repre-sented by three ESTs. The complete nucleotide sequence ofthis Toxoplasma homologue (TgAMA1) was determined fromclone TgEST zy99b08.r1 containing an insert of 2,507 bp (Gen-Bank accession number AF010264). The source of the cDNAwas a library made from mRNA of strain ME49 tachyzoites

(1). A single ORF from nucleotide (nt) 52 to nt 1677 codes fora 541-amino-acid (aa) protein with a predicted molecular massof ;60 kDa and a theoretical pI of 5.47. Upstream and down-stream AMA1 gene fragments were obtained by inverse PCRusing AMA1-specific primers and an EcoRV-digested, circu-larized genomic DNA template. The complete sequence of thePCR-amplified AMA1 gene was acquired by primer walking.This revealed seven introns within the AMA1 coding region,ranging from 240 to 702 bp in length. The genome organizationis shown schematically in Fig. 1A. A hydrophobicity plot showsan N-terminal hydrophobic region, which is identified by theprogram PSORT as a signal sequence with a predicted cleav-age site between Ala-20 and Ser-21. After cleavage of thesignal sequence, the calculated molecular mass of the matureprotein is 57.9 kDa. A putative hydrophobic membrane-span-ning region was identified between Ala-456 and Leu-472. Theoverall arrangement of these elements in TgAMA1 as well asin the Plasmodium homologues is indicative of a type Ia mem-brane protein (Fig. 1B), with the COOH-terminal 69 aa (Glu-473 to Tyr-541) constituting a presumptive cytoplasmic tail.

Southern blot analyses were done to determine how manycopies of AMA1 exist within the Toxoplasma genome. Asshown in Fig. 1C, AMA1 is a single-copy gene, since probesderived from the 59 or 39 end of AMA1 detected only a singlefragment on sequentially probed blots. Likewise, a single3.3-kb transcript was detected on Northern blots of tachyzoitepoly(A)-enriched RNA (data not shown). The EST sequencepredicts poly(A) addition ;900 nt downstream of the stopcodon. This places the predicted 59 end of the transcript about700 nt upstream of the apparent start codon. Neither of thesesites, however, has been experimentally confirmed.

The ectodomain of mature Plasmodium AMA1 proteinscontains 16 cysteine residues which form a secondary structureof three domains stabilized by disulfide bonds, with six, four,

FIG. 1. (A) To-scale graphic depiction of the TgAMA1 gene locus, depictingexon (black boxes) and intron segments. Black line, noncoding genomic se-quence. (B) Graphic representation of the predicted full-length TgAMA1 pro-tein (GenBank accession number AF010264). Black boxes, hydrophobic se-quences. Cysteines are represented by vertical lines. Domains I, II, and III aredefined by analogy to those described by Hodder et al. (20) for the P. knowlesiAMA1 ectodomain. (C) Southern blot analysis. Genomic DNA from RHtachyzoites was isolated and digested overnight with NheI (N), KpnI (K), HindIII(H), EcoRI (R), or BglII (B). The DNA was resolved by agarose gel electro-phoresis, and blots were probed sequentially with a 600-bp AMA1 59 probe anda 1,200-bp AMA1 39 probe. The migration of size markers is indicated (inkilobases).

7080 HEHL ET AL. INFECT. IMMUN.

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

FIG

.2.

Multiple

alignment

ofA

MA

1am

inoacid

sequencesfrom

P.berghei,P

.yoelii,P.chabaudi,P

.knowlesi,P

.vivax,andP

.falciparum,and

TgA

MA

1.Identicalresiduesin

fouror

more

ofthe

sevensequences

areboxed.

Gaps

insertedto

optimize

alignments

arerepresented

bydashes.

7081

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

and six cysteines in domains I, II, and III, respectively (20). Thecorrect folding of the ectodomain conformation is apparentlyimportant for proper function of Plasmodium AMA1, as onlyantibodies generated against epitopes in the native conforma-tion are fully protective (2, 10, 43). A similar arrangement of 16cysteines is preserved in the TgAMA1 ectodomain. The 10cysteines corresponding to domains I and II can be easilyaligned with those of the malaria AMA1 sequences. In con-trast, the spacing of the six cysteines in domain III, which arepredicted to form a “knot”-like structure in the P. chabaudiAMA1 (20), is not sufficiently conserved to allow sequencealignment without introduction of several gaps (Fig. 1B and 2).Specifically, the CPC and CXC motifs found in domain III ofPlasmodium AMA1 are not present in TgAMA1.

Multiple sequence alignment of the predicted AMA1 aminoacid sequences from six Plasmodium species (P. berghei[U45969], P. yoelii [U45971], P. chabaudi [U49743], P. vivax[AF063138], P. knowlesi [P21303], and P. falciparum [320941])with TgAMA1 (AF010264) was done to help identify phyloge-netically conserved functional regions (Fig. 2). A strikinglyhigh degree of conservation is found in a stretch of 34 aa, fromresidues His-63 to Ile-96 (numbering is for the T. gondii se-quence). A minimum of 19 and a maximum of 22 identitieswere found in pairwise ungapped alignments of the Toxo-plasma and each Plasmodium sequence in this region alone,corresponding to 56% (P. berghei, P. yoelii, and P. chabaudi)and 65% (P. falciparum) identity. This conserved region alsoincludes the first cysteine residue of domain I (Fig. 1B), whichpredicts that 26 aa of this conserved block extend from thenative protein, while 7 residues form part of a loop structure indomain I. On the NH-terminal side of His-63 in TgAMA1, thedivergence is greater, with very few conserved positions inindividual alignments and none in the multiple alignment of allseven sequences. In the putative 69-aa cytoplasmic domain, wefind surprisingly little conservation in TgAMA1: only 12 iden-tical positions (17%), including a conserved terminal tyrosine,are found in a multiple alignment with the Plasmodium homo-logues. Individual alignment with the P. vivax AMA1 shows thebest conservation, with 19 identities and 21 similarities in thisregion. This dissimilarity may explain the differences in sub-cellular localization discussed below.

TgAMA1 is expressed in tachyzoites of T. gondii. To derivespecific antisera against TgAMA1, three TgAMA1 fragmentswere expressed as fusions with MBP in Escherichia coli.MBP-LF (long fragment) contained a region corresponding todomains I and II of the ectodomain, from Val-69 to Asp-410.MBP-SF (short fragment) covered domain I, starting at thesecond cysteine (Cys-166) but excluding the highly conservedregion and extending through domain II to Asp-379. MBP-CF(cytosolic fragment) contained the COOH-terminal 62 aa, cor-responding to the presumed cytoplasmic domain from Ala-479to Tyr-541. Antiserum to MBP-LF detected a single strongband migrating at ;65 kDa in Western blots of total lysates orTriton X-100 extracts from RH tachyzoites separated on re-ducing SDS-PAGE (Fig. 3A). Identical results were obtainedfor the two other reference strains (ME49 and CEP) and whenantibodies to MBP-SF and MBP-CF were used (data notshown).

Antisera to peptides corresponding to the predicted matureNH terminus (N-pep: Ser-21 to Ser-36) and the central portionof the cytoplasmic tail (C-pep: Gln-489 to Lys-505) were gen-erated in mice. Antibodies raised to C-pep strongly labeled thesame 65-kDa band in lysates, while the antiserum to N-pepshowed consistently weaker reactivity, with a band migratingslightly above the 65-kDa TgAMA1 signal (Fig. 3B). The ap-parent lack of reactivity of the N-pep antibodies with the major

protein species, together with their detection of a minor andslightly larger species, suggests N-terminal posttranslationalprocessing of TgAMA1 after signal sequence cleavage. Thisresult is consistent with what has been observed for Plasmo-dium AMA1 proteins (9) but would require confirmation bydirect N-terminal sequence analysis. The site at which thisputative prepro cleavage occurs during synthesis and traffick-ing of TgAMA1 is not yet known.

TgAMA1 is a microneme protein and relocalizes to the sur-face membrane upon egress of tachyzoites from the parasito-phorous vacuole. To localize TgAMA1 in T. gondii, immuno-fluorescence studies using antisera against fusion proteins andpeptides were performed on native extracellular or fixed anddetergent-permeabilized intracellular and extracellular para-sites. With fixed, permeabilized intracellular parasites,MBP-SF antiserum gave a crescent-shaped pattern at the an-terior end of the cell (Fig. 4A and B). For fixed but unperme-abilized extracellular tachyzoites, the staining pattern wasclearly distinct from that of intracellular parasites, showing aconcentrated surface fluorescence of the apical half of theparasites, with a weak, circumferential staining posterior to this(Fig. 4C and D). Thus, the comparison of parasite surface andintracellular signals obtained with antiserum to the MBP-SFfusion protein shows an apparent redistribution of TgAMA1subsequent to release of tachyzoites from the parasitophorousvacuole.

Using N-pep antibodies on intracellular parasites, staininganterior to the nucleus was seen (Fig. 4E and F) that is clearlydistinct from the staining pattern obtained with antisera to theMBP fusion proteins (Fig. 4A and B). Whether the anti-N-pepstaining represents precursor proteins in transit through thesecretory pathway could not be determined. Extracellular par-asites which were not permeabilized with detergent showedpredominantly staining of the very tip of the apical complexplus some peripheral staining, possibly representing a smallamount of immature TgAMA1 just reaching the surface (Fig.4G and H).

The anterior fluorescence staining shown in Fig. 4A is mostreminiscent of microneme proteins. Specifically, the stainingpattern observed using the MBP-AMA1 polyclonal closely re-sembles the apical cap-like pattern observed for the mi-croneme protein MIC2 (27). This is in contrast to the club-likestaining pattern seen for the rhoptry protein ROP1 and themottled staining pattern seen for the dense granule proteinGRA3 (data not shown). To determine if TgAMA1 is indeed

FIG. 3. Western blot strips of parasite-associated TgAMA1 separated onSDS-PAGE. (A) Triton X-100 extracts of RH strain tachyzoites incubated withmouse polyclonal antibodies raised against MBP-LF (LF) or preimmune serum(PI). (B) Reactivity of C-pep (C) and N-pep (N) antibodies with tachyzoiteextracts separated on SDS-PAGE gels. A putative precursor band, detected withanti-N-pep, is indicated by an arrow. The migration of size markers is indicated(in kilodaltons).

7082 HEHL ET AL. INFECT. IMMUN.

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

localized to micronemes, dual immunofluorescence was per-formed with the mouse MAb CL22, raised to the C-pep ofTgAMA1, and with rabbit antiserum for TgMIC2, a well-stud-ied micronemal protein (44). The results (Fig. 5A to D) showcolocalization of TgAMA1 and MIC2, strongly suggesting thatthe former protein is predominantly found in micronemes. Toconfirm this, immunoelectron microscopy on cryosections ofintracellular tachyzoites was done using MBP-SF antiserum.Gold particles consistently decorated microneme vesicles butrarely other organelles or subcellular structures (Fig. 5E). Aprevious report had concluded that AMA1 of P. falciparumlocalizes to the anterior part of the rhoptry vesicles (9), therhoptry necks. Virtually none of the organellar TgAMA1, how-ever, is associated with rhoptries or rhoptry necks, suggestingthat trafficking and secretion of AMA1 homologues to theparasite surface might follow a different pathway in these twogenera.

To determine if the occasional gold particle over rhoptriesrepresents background or real labeling, the C-pep MAb CL22was used to detect the protein in subcellularly fractionated T.gondii lysates. Both TgAMA1 and TgMIC2 are located in theghost fraction and the middle fractions but are conspicuouslyabsent from the rhoptry-dense granule band (Fig. 6). In con-trast, ROP2, ROP3, ROP4, and GRA3 are enriched in therhoptry-dense granule band compared to the middle fractions.Thus, biochemical analyses confirm that AMA1 is a mi-croneme, not a rhoptry protein, in T. gondii.

TgAMA1 is secreted as a lower-molecular-weight form.Shedding of lower-molecular-weight forms (Pk42/44) ofPkAMA1(PK66) into the culture supernatant has been re-ported for free P. knowlesi merozoites prior to and duringinvasion of RBCs (11). Large amounts of a soluble lower-molecular-weight form of TgAMA1 were also found in theexcreted-secreted fraction after incubation of extracellulartachyzoites in serum-free medium. In Western blots of thisfraction collected at different time points, a single ;54-kDasoluble fragment, sTgAMA1, was detected with antibodies toMBP-LF (Fig. 7). The stable fragment was first detected after10 to 20 min of incubation and rapidly increased in concentra-tion over the course of the incubation. Detectable amounts ofthe 54-kDa soluble form could not be found associated with

free parasites (Fig. 7, pellet fractions). Western blots of se-creted material and the corresponding parasite lysates wereprobed with the C-pep antibodies. The C-pep antiserum la-beled the ;65-kDa forms in total lysates, but did not react withsTgAMA1 (data not shown). From these results and the ob-served size difference of approximately 10 kDa between themembrane-associated and soluble forms of TgAMA1, we pro-pose that sTgAMA1 is the product of a proteolytic cleavage indomain III (i.e., in the ectodomain but relatively close to thetransmembrane region).

TgAMA1 is involved in host cell invasion and may be anessential protein. To investigate the function of TgAMA1, wetested the ability of mouse antibodies produced against fusionproteins to inhibit invasion of HFF by extracellular parasites.Tachyzoites were treated with the AMA1-reactive antiserumor pooled normal mouse serum prior to infection of an HFFmonolayer. The number of parasites found associated withhost cells was assessed microscopically. Coating parasites withthe MBP-LF serum reduced the number of cell-associatedtachyzoites by ;35 to 75% compared to control serum-coatedparasites (data not shown). Precise quantitation of the inhibi-tory effect of the antiserum is difficult with this assay, so themore quantitative uracil incorporation assay was also done.Antisera obtained from two mice immunized with MBP-LFreproducibly inhibited invasion by ;40% (Fig. 8). This effectdoes not appear to be a result of antibodies to the MBPportion of the fusion protein, as antiserum from mice immu-nized with MBP-SF did not alter invasion by tachyzoites. Asthe MBP-LF protein differs from MBP-SF in containing mostof the highly conserved region between His-63 and Ile-96, thissegment may have an important biological role.

To analyze AMA1 function in T. gondii more precisely, at-tempts were made to delete the AMA1 gene. Specifically, anAMA1 knockout vector designed to produce a gene disruptionand containing HXGPRT as a selectable marker was con-structed. RHDHXGPRT tachyzoites were transfected with alinearized AMA1-HXGPRT cassette and subsequently selectedin MPA/XAN-containing medium. PCR analysis of genomicDNA isolated from the drug-resistant population indicatedthat upstream and downstream homologous recombinationand integration of vector sequences had occurred. Even so, 80

FIG. 4. Immunofluorescence localization of TgAMA1 in T. gondii tachyzoites. (A, C, E, and G) Phase-contrast images; (B, D, F, and H) correspondingimmunofluorescence images. (A and B) Formaldehyde-fixed and detergent-permeabilized intracellular parasites treated with MBP-SF antiserum. (C and D) Fixed andnonpermeabilized extracellular tachyzoites labeled with MBP-SF antiserum, showing apical localization of TgAMA1 on the surface of intact cells, with distinctcircumferential staining. (E and F) Permeabilized intracellular tachyzoites incubated with N-pep antiserum, showing distinct perinuclear staining in addition to thesubpellicular apical signal. (G and H) N-pep antiserum labeled mostly a small area at the conoid of extracellular parasites not treated with detergent.

VOL. 68, 2000 T. GONDII HOMOLOGUE OF PLASMODIUM AMA1 7083

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

MPA/XAN-resistant clones derived from this population con-tained an uninterrupted AMA1 gene, as determined by PCR.Several of these clones were analyzed further by Southern blot.As suggested by PCR analysis of the transfected population,homologous recombination in those selected clones had oc-curred on one but never on both sides of the HXGPRT cas-sette, leaving an intact TgAMA1 locus (data not shown).

DISCUSSION

In this report, we describe the cloning and characterizationof TgAMA1, a Toxoplasma homologue of the PlasmodiumAMA1. We show that the Toxoplasma and Plasmodium pro-teins are highly conserved in overall organization and, in manyplaces, in their actual sequence. As with PfAMA1 and Plas-modium, antibodies to TgAMA1 significantly impair invasionby Toxoplasma, although to a lesser degree than seen in thePlasmodium experiments. This difference could reflect agreater redundancy in invasion mechanisms, less exposure ofkey epitopes, or a lower titer of the antibodies used in theToxoplasma experiments.

FIG. 5. Immunofluorescence localization of TgAMA1 in intracellular tachyzoites detected with the mouse MAb CL22 (A) and MIC2 detected with a rabbitpolyclonal antiserum using intracellular tachyzoites that had been fixed and permeabilized (B). The merged image shows colocalization in large areas of overlap of thetwo signals (C). The corresponding phase-contrast image is depicted in panel D. (E) Localization of TgAMA1 by immunoelectron microscopy; intracellular tachyzoitesection was labeled with MBP-SF antiserum. M, micronemes; R, rhoptries; D, dense granules. Immunogold staining of TgAMA1 in micronemes is marked with arrows.Bar, 0.2 mm.

FIG. 6. Western blot of intracellular organelles from T. gondii fractionatedon a Percoll gradient. Lane 1, lysed cells; lane 2, top fraction containingtachyzoite ghosts; lane 3, middle fraction enriched in micronemes; lane 4, bottomfraction containing rhoptries and dense granules. Blots were probed with MAbsto organellar proteins AMA1 (CL22), MIC2 (6D10), ROP2, ROP3, ROP4(T34A7), and GRA3 (2H11). The migration of size markers is indicated (inkilodaltons).

FIG. 7. Secretion assay. Washed parasites were incubated in serum-freeRPMI medium at 37°C. Excreted-secreted fractions (S) collected at 0, 5, 10, 20,30, and 60 min of incubation of extracellular tachyzoites in serum-free mediumand corresponding cell pellets (P) were separated on SDS–10% PAGE. Detec-tion of membrane-bound TgAMA1 and secreted TgAMA1 was done withMBP-LF antibodies and subsequent incubation with peroxidase-conjugated goatanti-mouse Ig secondary antibodies.

7084 HEHL ET AL. INFECT. IMMUN.

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

TgAMA1 is processed at least once and possibly twice dur-ing its transit to the extracellular milieu. The removal of a shortsegment at the N terminus apparently occurs at some stageduring transit to the surface. In extracellular parasites, at least,the mature ectodomain is eventually shed into the supernatant,apparently as a result of cleavage off of the surface (i.e., justN-terminal to the membrane-anchoring domain). All of theseproperties are analogous to the situation with PfAMA1, al-though there are differences in detail, as expected from thevery different modes of parasite replication (endodyogeny ver-sus schizogony).

A major difference between the Plasmodium AMA1s andTgAMA1 is in their subcellular localization in intracellularparasites: in Plasmodium, they are reported to be in therhoptries (9, 28), whereas our data indicate a micronemallocation for the Toxoplasma protein. Ward and colleagues havelikewise colocalized TgAMA1 to the micronemes (11a). As theintracellular targeting of type I transmembrane proteins istypically encoded in the cytoplasmic tail (29), extensive differ-ences in the sequence of this domain in AMA1 from the twoparasites may explain the different localizations. It is also pos-sible that the two compartments flow into one another and weare observing the protein at different stages in its traffickingfrom when the Plasmodium researchers localized it. There isno indication of such a flow in any other studies on rhoptry ormicroneme proteins, and so we consider this possibility un-likely.

We were unable to fatally disrupt the AMA1 gene in Toxo-plasma. Similarly negative results have also been obtained withPlasmodium and PfAMA1 (J. Adams, personal communica-tion). While these techniques are not routine enough in eithersystem to make a negative result conclusive, combined with theantibody studies, they strongly suggest a critical and potentiallyessential role for AMA1 in parasite growth.

As yet, there are no clues to the presumptive ligands that arerecognized by the extracellular and cytoplasmic domains ofAMA1. The former may yield important information abouthost cell molecules that mediate attachment and/or invasion bythe parasite. Molecules interacting with the cytoplasmic do-main could include those necessary for correct targeting and/orfor transducing a signal or kinetic energy from the outside tothe inside of the parasite. Experiments that identify these li-gands are now crucially needed.

ACKNOWLEDGMENTS

We thank Gary Ward for exchange of information prior to publica-tion and David Sibley for the rabbit anti-MIC2 serum and the MIC2-specific MAb 6D10.

This work was supported in part by grants from the Swiss NationalScience Foundation (31-45841.95 and 31-58912.99) to A.B.H., by aBank of America-Giannini Foundation Postdoctoral Fellowship andan NRSA fellowship (AI10373) to C.L., a grant to J.-F.D. from theMinistere de la Recherche (PRFMMIP), and grants to J.C.B. from theNational Institutes of Health (AI21423 and AI45057).

A. Hehl and C. Lekutis contributed equally to this work.

REFERENCES

1. Ajioka, J. W., J. C. Boothroyd, B. P. Brunk, A. Hehl, L. Hillier, I. D. Manger,M. Marra, G. C. Overton, D. S. Roos, K. L. Wan, R. Waterston, and L. D.Sibley. 1998. Gene discovery by EST sequencing in Toxoplasma gondii re-veals sequences restricted to the Apicomplexa. Genome Res. 8:18–28.

2. Anders, R. F., P. E. Crewther, S. Edwards, M. Margetts, M. L. Matthew, B.Pollock, and D. Pye. 1998. Immunization with recombinant AMA-1 protectsmice against infection with Plasmodium chabaudi. Vaccine 16:240–247.

3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl. 1994. Current protocols in molecular biology, p.10.2.1–10.2.35, vol. 2. J. Wiley and Sons, Inc., New York, N.Y.

4. Beckers, C. J., J. F. Dubremetz, O. Mercereau-Puijalon, and K. A. Joiner.1994. The Toxoplasma gondii rhoptry protein ROP 2 is inserted into theparasitophorous vacuole membrane, surrounding the intracellular parasite,and is exposed to the host cell cytoplasm. J. Cell Biol. 127:947–961.

5. Bonhomme, A., L. Pingret, and J. M. Pinon. 1992. Review: Toxoplasmagondii cellular invasion. Parassitologia 34:31–43.

6. Boothroyd, J. C., M. Black, S. Bonnefoy, A. Hehl, L. J. Knoll, I. D. Manger,E. Ortega-Barria, and S. Tomavo. 1997. Genetic and biochemical analysis ofdevelopment in Toxoplasma gondii. Phil. Trans. R. Soc. Lond. B Biol. Sci.352:1347–1354.

7. Carruthers, V. B., and L. D. Sibley. 1997. Sequential protein secretion fromthree distinct organelles of Toxoplasma gondii accompanies invasion ofhuman fibroblasts. Eur. J. Cell Biol. 73:114–123.

8. Collins, W. E., D. Pye, P. E. Crewther, K. L. Vandenberg, G. G. Galland, A. J.Sulzer, D. J. Kemp, S. J. Edwards, R. L. Coppel, J. S. Sullivan, et al. 1994.Protective immunity induced in squirrel monkeys with recombinant apicalmembrane antigen-1 of Plasmodium fragile. Am. J. Trop. Med. Hyg. 51:711–719.

9. Crewther, P. E., J. G. Culvenor, A. Silva, J. A. Cooper, and R. F. Anders.1990. Plasmodium falciparum: two antigens of similar size are located indifferent compartments of the rhoptry. Exp. Parasitol. 70:193–206.

10. Deans, J. A., A. M. Knight, W. C. Jean, A. P. Waters, S. Cohen, and G. H.Mitchell. 1988. Vaccination trials in rhesus monkeys with a minor, invariant,Plasmodium knowlesi 66 kD merozoite antigen. Parasite Immunol. 10:535–552.

11. Deans, J. A., A. W. Thomas, T. Alderson, and S. Cohen. 1984. Biosynthesisof a putative protective Plasmodium knowlesi merozoite antigen. Mol. Bio-chem. Parasitol. 11:189–204.

11a.Donahue, C. G., V. B. Carruthers, S. D. Gilk, and G. E. Ward. The Toxo-plasma homolog of the Plasmodium apical membrane antigen-1 (AMA-1) isa microneme protein secreted in response to elevated intracellular calciumlevels. Mol. Biochem. Parasitol., in press.

12. Donald, R. G. K., D. Carter, B. Ullman, and D. S. Roos. 1996. Insertionaltagging, cloning, and expression of the Toxoplasma gondii hypoxanthine-xanthine-guanine phosphoribosyltransferase gene: use as a selectable markerfor stable transformation. J. Biol. Chem. 271:14010–14019.

13. Dubremetz, J. F. 1998. Host cell invasion by Toxoplasma gondii. TrendsMicrobiol. 6:27–30.

14. Dubremetz, J. F., A. Achbarou, D. Bermudes, and K. A. Joiner. 1993. Ki-netics and pattern of organelle exocytosis during Toxoplasma gondii/host-cell interaction. Parasitol. Res. 79:402–408.

15. Dubremetz, J. F., N. Garcia-Reguet, V. Conseil, and M. N. Fourmaux. 1998.Apical organelles and host-cell invasion by Apicomplexa. Int. J. Parasitol.28:1007–1013.

16. Fourmaux, M. N., A. Achbarou, O. Mercereau-Puijalon, C. Biderre, I.Briche, A. Loyens, C. Odberg-Ferragut, D. Camus, and J. F. Dubremetz.1996. The MIC1 microneme protein of Toxoplasma gondii contains a dupli-cated receptor-like domain and binds to host cell surface. Mol. Biochem.Parasitol. 83:201–210.

17. Grimwood, J., and J. E. Smith. 1996. Toxoplasma gondii: the role of parasitesurface and secreted proteins in host cell invasion. Int. J. Parasitol. 26:169–173.

18. Hehl, A., T. Krieger, and J. C. Boothroyd. 1997. Identification and charac-terization of SRS1, a Toxoplasma gondii surface antigen upstream of andrelated to SAG1. Mol. Biochem. Parasitol. 89:271–282.

19. Hehl, A., I. D. Manger, and J. C. Boothroyd. 1997. Genetic analysis inToxoplasma: gene discovery with expressed sequence tags and rapid map-

FIG. 8. Antibodies against recombinant TgAMA1 inhibit infection of HFF.Invasion in the presence of different concentrations of MBP-LF antiserum frommouse 1 (black column) and mouse 2 (stippled column) and MBP-SF antiserumfrom mouse 3 (white column) is shown as a percentage of invasion in thepresence of pooled normal mouse serum as measured by uracil incorporation.Error bars represent the standard deviation for duplicate wells.

VOL. 68, 2000 T. GONDII HOMOLOGUE OF PLASMODIUM AMA1 7085

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

ping of natural polymorphisms. Methods 13:89–102.20. Hodder, A. N., P. E. Crewther, M. L. Matthew, G. E. Reid, R. L. Moritz, R. J.

Simpson, and R. F. Anders. 1996. The disulfide bond structure of Plasmo-dium apical membrane antigen-1. J. Biol. Chem. 271:29446–29452.

21. Kasper, L. H., and P. L. Ware. 1985. Recognition and characterization ofstage-specific oocyst/sporozoite antigens of Toxoplasma gondii by humanantisera. J. Clin. Investig. 75:1570–1577.

22. Leriche, M. A., and J. F. Dubremetz. 1991. Characterization of the proteincontents of rhoptries and dense granules of Toxoplasma gondii tachyzoitesby subcellular fractionation and monoclonal antibodies. Mol. Biochem. Para-sitol. 45:249–259.

23. Leriche, M. A., and J. F. Dubremetz. 1990. Exocytosis of Toxoplasma gondiidense granules into the parasitophorous. Parasitol. Res. 76:559–562.

24. Liu, C., V. Vigdorovich, V. Kapur, and M. S. Abrahamsen. 1999. A randomsurvey of the Cryptosporidium parvum genome. Infect. Immun. 67:3960–3969.

25. Manger, I. D., A. Hehl, S. Parmley, L. D. Sibley, M. Marra, L. Hillier, R.Waterston, and J. C. Boothroyd. 1998. Expressed sequence tag analysis ofthe bradyzoite stage of Toxoplasma gondii: identification of developmentallyregulated genes. Infect. Immun. 66:1632–1637.

26. Medina-Acosta, E., and G. A. Cross. 1993. Rapid isolation of DNA fromtrypanosomatid protozoa using a simple “mini-prep” procedure. Mol. Bio-chem. Parasitol. 59:327–329.

27. Morrissette, N. S., V. Bedian, P. Webster, and D. S. Roos. 1994. Character-ization of extreme apical antigens from Toxoplasma gondii. Exp. Parasitol.79:445–459.

28. Narum, D. L., and A. W. Thomas. 1994. Differential localization of full-length and processed forms of PF83/AMA-1 an apical membrane antigen ofPlasmodium falciparum merozoites. Mol. Biochem. Parasitol. 67:59–68.

29. Ngo, H. M., H. C. Hoppe, and K. A. Joiner. 2000. Differential sorting andpost-secretory targeting of proteins in parasitic invasion. Trends Cell Biol.10:67–72.

30. Nichols, B. A., M. L. Chiappino, and G. R. O’Connor. 1983. Secretion fromthe rhoptries of Toxoplasma gondii during host-cell invasion. J. Ultrastruct.Res. 83:85–98.

31. Pennisi, E. 1999. Malarial genome comes into view. Science 286:1263–1265.32. Perkins, M. E. 1984. Surface proteins of Plasmodium falciparum merozoites

binding to the erythrocyte receptor, glycophorin. J. Exp. Med. 160:788–798.33. Pfefferkorn, E. R., and L. C. Pfefferkorn. 1977. Toxoplasma gondii: specific

labeling of nucleic acids of intracellular parasites in Lesch-Nyhan cells. Exp.Parasitol. 41:95–104.

34. Pfefferkorn, E. R., L. C. Pfefferkorn, and E. D. Colby. 1977. Development ofgametes and oocysts in cats fed cysts derived from cloned trophozoites ofToxoplasma gondii. J. Parasitol. 63:158–159.

35. Riggs, P. 1994. Expression and purification of maltose-binding protein fu-sions, p. 16.6.1–16.6.14. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D.Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols inmolecular biology, vol. 2. John Wiley and Sons, Inc., New York, N.Y.

36. Sabin, A. B. 1941. Toxoplasmic encephalitis in children. J. Am. Med. Assoc.116:801–807.

37. Sam-Yellowe, T. Y., H. Shio, and M. E. Perkins. 1988. Secretion of Plasmo-dium falciparum rhoptry protein into the plasma membrane of host eryth-rocytes. J. Cell Biol. 106:1507–1513.

38. Spano, F., and A. Crisanti. 2000. Cryptosporidium parvum: the many secretsof a small genome. Int. J. Parasitol. 30:553–565.

39. Spano, F., L. Putignani, S. Naitza, C. Puri, S. Wright, and A. Crisanti. 1998.Molecular cloning and expression analysis of a Cryptosporidium parvumgene encoding a new member of the thrombospondin family. Mol. Biochem.Parasitol. 92:147–162.

40. Strong, W. B., and R. G. Nelson. 2000. Preliminary profile of the cryptospo-ridium parvum genome: an expressed sequence tag and genome surveysequence analysis. Mol. Biochem. Parasitol. 107:1–32.

41. Suarez, C. E., T. F. McElwain, E. B. Stephens, V. S. Mishra, and G. H.Palmer. 1991. Sequence conservation among merozoite apical complex pro-teins of Babesia bovis, Babesia bigemina and other apicomplexa. Mol. Bio-chem. Parasitol. 49:329–332.

42. Taylor, D. W., C. B. Evans, S. B. Aley, J. R. Barta, and H. D. Danforth. 1990.Identification of an apically-located antigen that is conserved in sporozoanparasites. J. Protozool. 37:540–545.

43. Thomas, A. W., J. A. Deans, G. H. Mitchell, T. Alderson, and S. Cohen. 1984.The Fab fragments of monoclonal IgG to a merozoite surface antigen inhibitPlasmodium knowlesi invasion of erythrocytes. Mol. Biochem. Parasitol.13:187–199.

44. Wan, K. L., V. B. Carruthers, L. D. Sibley, and J. W. Ajioka. 1997. Molecularcharacterisation of an expressed sequence tag locus of Toxoplasma gondiiencoding the micronemal protein MIC2. Mol. Biochem. Parasitol. 84:203–214.

45. Waters, A. P., A. W. Thomas, J. A. Deans, G. H. Mitchell, D. E. Hudson,L. H. Miller, T. F. McCutchan, and S. Cohen. 1990. A merozoite receptorprotein from Plasmodium knowlesi is highly conserved and distributedthroughout Plasmodium. J. Biol. Chem. 265:17974–17979.

Editor: W. A. Petri, Jr.

7086 HEHL ET AL. INFECT. IMMUN.

on Decem

ber 9, 2020 by guesthttp://iai.asm

.org/D

ownloaded from