Vol. 169, No. 6JOURNAL OF BACTERIOLOGY, June 1987, p. 2876-28800021-9193/87/062876-05$02.00/0Copyright e 1987, American Society for Microbiology

In Vitro Transcription of the Nitrogen Fixation Regulatory OperonnifLA of Klebsiella pneumoniae

P.-K. WONG,t D. POPHAM, J. KEENER, AND S. KUSTU*

Department of Microbiology and Immunology, University of California, Berkeley, California 94720

Received 29 December 1986/Accepted 2 March 1987

In vitro transcription from the promoter for the nitrogen fixation regulatory operon nifLA ofK. pneumoniaerequires four protein fractions: (i) the core form of RNA polymerase; (ii) NTRA, an alternate sigma factor; (iii)NTRC, an auxiliary DNA-binding protein; and (iv) NTRB, a bifunctional enzyme that cofltrols the activity ofNTRC by covalent modification (A. J. Ninfa and B. Magasanik, Proc. Nati. Acad. Sci. USA 83:5909, 1986).Two DNA-binding sites for NTRC lie -150 base pairs upstream of the nifLA promoter.

In enteric bacteria three proteins, the products of genesntrA, ntrC, and ntrB (designated NTRA, NTRC, and NTRB,respectively), are specifically required to transcribe geneswhose expression is regulated by availability of combinednitrogen (revieWed in references 20 and 22; J. Keener, P.Wong, D. Popham, 1. Wallis, and S. Kustu, in W. S.Reznikoff, R. R. Burgess, J. E. Dahlberg, C. A. Gross, M. T.Record, and M. P. Wickens, ed., RNA Polymerase and theRegulation of Transcription, in press). Such genes includeglnA, the structural gene for glutamine synthetase, and thenifL and nifA genes, which constitute the nifLA operon andencode proteins that are specifically required to regulatetranscription of the other six or seven nitrogen fixation (nif)operons of K. pneumoniae (reviewed in references 2, 12, 24,and 32). The nifoperons encode proteins that are needed forbiological nitrogen fixation; for example, the nifHDK operonencodes nitrogenase and nitrogenase reductase (32).NTRA is an alternate sigma factor for RNA polymerase-

that is, it confers a different promoter specificity on the coreform of RNA polymerase than does a70, the most abundanta factor in enteric bacteria (18-20; Keener et al., in press), or(TY32, the alternate ca factor required for the heat shockresponse (17). NTRA + core RNA polymerase (a2 OB'),which we designate NTRA holoenzyme, protects the glnApromoter from digestion by DNase I and from methylationby dimethylsulfate (20; Keener et al., in press). Conservedsequences in the glnA promoter and other nitrogen-regulatedpromoters including the inif promoters (Fig. 1) are centeredat - -24 and -14 with respect to the start point of transcrip-tion (reviewed in references 2, 10, and 12; 3, 4, 6, 28, 29, 33);a recent formulation of the consensus sequence for thesepromoters is 5'-CTGGCACN5TTGCA-3' (10).NTRC is an auxiliary DNA-binding protein that is re-

quired to activate transcription by NTRA holoenzyme(18-20, 26; Keener et al., in press). NTRC binds to five sitesin the ginA promoter-regulatory region that lie upstream ofthe major glnA promoter, between -34 and -144 withrespect to the startpoint of transcription (18; unpublisheddata). Reitzer and Magasanik have demonstrated that thetwo most upstream binding sites for NTRC, which arecentered at -137 and -105, are required for the activation ofglnA transcription by low concentrations of NTRC in vivo(30); these sites have properties of transcriptional enhancers

* Corresponding author.t Present address: Department of Biology, The Chinese Univer-

sity of Hong Kong, Shatin, N.T., Hong Kong.

in eucaryotes (30). When all five binding sites for NTRC aredeleted, the protein can still activate transcription from theglnA promoter both in vitro (Keener et al., in press) and invivo (10, 30), implying that it is capable of interactingdirectly with NTRA holoenzyme at the glhA promoter.Higher concentrations of NTRC (ca. fourfold) are requiredfor the same level of transcription from a glnA template thatlacks NTRC-binding sites as from one that has them (Keeneret al., in press).NTRB is not directly required for transcription of nitro-

gen-regulated genes. Rather, it controls the function ofNTRC in activating transcription (26; Keener, et al., inpress). NTRB is bifunctional-it can both increase anddecrease the ability of NTRC to activate glnA transcription(26; Keener et al., in press). Ninfa and Magasanik demon-strated (26) and we have confirmed that NTRB has twoopposing enzymatic activities-protein kinase and phospho-protein phosphatase activities. As a protein kinase NTRBphosphorylates NTRC and thereby converts it to a form thatcan activate glnA transcription. As a phosphoprotein phos-phatase NTRB removes phosphate residues from NTRC anddecreases its ability to activate glnA transcription. Theenzymatic activities ofNTRB are metabolically regulated bythe availability of combined nitrogen (7, 26; Keener et al., inpress). Unlike wild-type NTRC, which can activate ginAtranscription only in the presence of NTRB (19, 26; Keeneret al., in press), some mutant forms ofNTRC can activate inthe absence of NTRI; these mutant forms were selected toactivate transcription of nitrogen-regulated genes in vivo in astrain that lacked the NTRB product (20).We here demonstrate that in vitro transcription from the

nifLA promoter is dependent on NTRA, NTRC, and NTRB;NTRA and NTRC were known to control transcription fromthis promoter in vivo (2, 5, 12, 13, 21, 25, 27, 32). We alsodemonstrate that there is transcription from the nifHDKpromoter in vitro in the presence of the three NTR proteins.Although NTRC stimulates transcription from the nifHDKpromoter weakly in vivo (6), strong transcription requiresthe product of the nifA gene (2, 5, 12, 24, 31, 32), a proteinthat is functionally and evolutionarily related to NTRC (2, 8,12, 13, 14, 25, 27). In both cases transcription in vivo isNTRA dependent (2, 9, 12, 25, 27, 33).To make a template pNIFL (pJES141) suitable for assay-

ing transcription from the nifLA promoter of K. pneumoniae(Fig. 1), we cloned into plasmid pTE102 (16) a fragmentspanning the intergenic region between nifF and nifLA (J. J.Collins, Ph.D. thesis, University of Wisconsin, Madison,

2876

on March 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

NOTES 2877

nifLA Promoter-Regulatory Region

HincII 40 80...I

GTTGACCGGGGCATCCGCCAGCTCGCCCAGTTGCTrATGGATCACGATTTGCGGGTTTACCGGTATCGTGCCACTGGCCCCGTAGGCGGTCGAGCGGGTCAACGAATACCTAGTAAAAGCGCTAAAACGCCCA GGCCATAGCCACG

120 MluI 160

ICAAAGAAAATACCAATGTTCGCCATGTTGCGCTCCTGTCGGtAAAAGGGGGTTGAAAATACGCGTTCTCGCAGGGGTATTG;GTTCTTTTATGGTTACAAGCGGTACAACGCGAGGACAGCCTTTTCCCCCAACTTTTATGCGCAAGAG CGTCCCCATAAC

SstII 200 PvuI 240

CGAAGGCTGTGCCAGGTTG CACTACCGCGGCCCATCCCTGCCCCAAAACGATCGCTT CCCTCTCCCGCCGCGGCTTCCGACACGGTCCAACGAAACGTGATGGCGCCGGGTAGGGACGGGGTTTTGCTAGICGAAGTCGGGAGAGGGCGGCGC

TTTGCAc00AGCGGAGGGcccI280 320

* * * * *CGCGGCGGGGCTGGCGGGGCGCrTAAAATGCAAAAMGCGCCi,u.TGTTCCCCTACCGGATCAATGTTCTGCACATCACGuGCGCCGCCCCGACCGCCCCGCGAATTTACGTTTTTCGCGGACGAAAAGGGGATGGCCTAGTTACAAAGACGTGTAGTG C

360 SstII 400* * I *

CCGATAAGGGCGCACGGTTTGCATGGTTATCACCGTTCGuGAAAACACCGCGGCGTCCCTGTCACGGTGTCGGACAAATTtiGGCTATTCCCGCGTGCCAAACGTACCAATAGTGGCAAGCCTMGTGGCGCCGCAGGGACAGTGCCACAGCCTGTrTMC

FIG. 1. DNA sequence of the nifLA promoter-regulatory region of K. pneumoniae as determined by Drummond et al. (13). The sequenceshown includes that for the N terminus of NIFF at position 105 (13, 15) and a portion of the intergenic region between nifF and nifLA; thesequence for the N terminus of NIFL lies at position 427, which is not shown (the numbering system is that of reference 13). The wavy lineat 354 indicates the start of the nifLA transcript as determined by Si nuclease mapping in vitro (see Fig. 4) and in vivo (13, 28). Overliningbetween 327 and 343 indicates a nitrogen fixation (nij) promoter for nifLA, with conserved sequences centered at positions -14 and -24 withrespect to the transcriptional startpoint (2, 3, 6, 10, 28, 29). Underlining between 159 and 175 indicates a nif promoter for nifF, which istranscribed in the opposite direction from nifLA (3, 10). The brackets between 182 and 225 (upper strand) and between 178 and 218 (lowerstrand) indicate a region within which NTRC binding protects the promoter region from DNase I digestion (see Fig. 5; unpublished data).NTRC protects G residues at positions 184, 205, and 215 (top strand; see Fig. 5) and 187, 197, 198, and 208 (bottom strand; unpublished data)and enhances methylation of G residues at positions 194 (top strand; see Fig. 5) and 196, 206, and 207 (bottom strand, unpublished data). Weinterpret protection data to indicate that NTRC binds to two sites with dyad symmetry (indicated by the arrows), one centered at position191 (-163) and the other centered at position 212 (-142) (see the text). For comparison, the sequence of a high-affinity binding site for NTRCin the ginA promoter-regulatory region is 5'-GCACCN5GGTGC-3' (20).

1984; Fig. 1 and 2). The vector (kindly provided by T. Elliott)was digested with EcoRI and BamHI, and the insert wasisolated from plasmid pJC272 (kindly provided by J. J.Collins) by digestion with EcoRI and Bglll. To make atemplate pNIFH (pJES142) for assaying transcription fromthe nifHDK promoter we cloned an EcoRI-HindIII fragmentfrom pJC082 (from J. J. Collins) into pTE103 (16) that hadbeen digested with EcoRI and HindIll.The NTRA and NTRB proteins were partially purified,

and the NTRC protein was highly purified from S.typhimurium essentially as previously described (18; Keeneret al., in press). Mutant forms ofNTRC were further purifiedby chromatography on single-stranded DNA agarose (18; J.Keener, unpublished data). We have recently obtained prep-arations of the NTRA protein that were >95% pure, and invitro transcription results with these preparations were thesame as those described herein (data not shown).Using pNIFL and pNIFH as templates for the transcrip-

tion assay described previously (18; Keener et al., in press),we obtained transcription from both the nifLA and nifHDKpromoters in the presence of highly purified RNA polymer-ase core (kindly provided by R. R. Burgess), a partiallypurified NTRA fraction that was free of a70 (18) and mutantforms of NTRC (e.g., ntrC610; see above) that were knownto activate glnA transcription in vitro in the absence ofNTRB (Fig. 3, lanes 4 and 11). Both NTRA and NTRC wererequired for transcription (Fig. 3, lanes 2, 3, 9, and 10).

Transcription in the presence of mutant forms of NTRC wasstimulated by NTRB (Fig. 3, lanes 5 and 12). When wild-typeNTRC was used in place of mutant forms, NTRB wasabsolutely required for transcription (Fig. 3, lanes 6, 7, 13,and 14X. The requirements for in vitro transcription from thenifLA and nifHDK promoters were the same as those fromthe ginA promoter (18, 19, 26; Keener et al., in press). Weused Si nuclease mapping (18) to demonstrate that the startpoint of the nifLA transcript obtained in vitro (Fig. 4) was thesame as that previously reported for the in vivo transcript(13, 28; Fig. 1).

Since NTRC was required for transcription from the nifLApromoter, as it was from the glnA promoter, we wanted todetermine whether there was a binding site(s) for NTRC inthe nifLA promoter-regulatory region. Using protection fromDNase I digestion (18) as an assay, we detected binding ofNTRC in a region -150 base pairs (bp) upstream of thenifLA promoter (Fig. 5, lanes 1 through 4; Fig. 1). NTRCprotected some G residues in this region from methylationby dimethylsulfate and enhanced methylation of others (Fig.5, lanes 5 through 9; Fig. 1; methylation protection asdescribed previously [23; Keener et al., in press]). Weinterpret protection data to indicate that NTRC binds to twosites in the nifLA promoter-regulatory region. Based oncomparison with protections afforded by NTRC at otherhigher affinity sites (1, 18, 34; unpublished data) we hypoth-esize that sites at nifLA have dyad symmetry and that they

VOL. 169, 1987

on March 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

2878 NOTES

FIG. 2. Plasmid template pNIFL used to assay transcriptionfrom the nifLA promoter. Plasmid pNIFL (pJES141), which wasderived from pTE102 (16), is 3.9 kilobases in size and carries a957-bp insert that contains the entire 400 bp shown in Fig. 1. Theexpected length of the transcript from the nifLA promoter overlinedin Fig. 1 to the T7 terminator from pTE102 is 610 nucleotides. Toconstruct plasmid pNIFL(A), which lacks the binding sites forNTRC (Fig. 1; see the text), the region between the EcoRI and PvuIsites of pNIFL was deleted.

n if L nif H

2 3 4 5 6 7 8 9 101112 1314 15

V V

som

FIG. 3. In vitro transcription from the nifLA and nifHDK pro-moters of K. pneumoniae. Transcription from plasmid templatespNIFL (lanes 2 through 7) and pNIFH (lanes 9 through 14) wasassayed as described previously (18; Keener et al., in press), exceptthat tRNA, amino acids, and folinic acid were omitted from thereaction mixture. Highly purified RNA polymerase core from E. coliwas present in all transcription lanes. NTRA was present in lanes 3through 7 and 10 through 14. A mutant form of NTRC (ntrC610; seethe text) was present in lanes 2, 4, 5, 9, 11, and 12, and wild-typeNTRC was present in lanes 6, 7, 13, and 14. NTRB was present inlanes 5, 7, 12, and 14. The order of addition of components was (i)substrates minus CTP, (ii) template (28 nM, final concentration), (iii)NTRC (0.6 ,uM, final concentration), (iv) NTRB (0.2 ,ul), (v) RNApolymerase core (24 nM), and NTRA (1 p.l). Reactions were initiatedwith [a-32P]CTP (18). DNA size standards (lanes 1, 8, and 15) of>622 bp (faint), 527 bp, 404 bp (doublet), and 242 bp were derivedfrom pJES123 by cleavage with MspI; after treatment with calfintestinal phosphatase, fragments were labeled with [a-32P]ATP byusing polynucleotide kinase. The gel was an 8% sequencing gel; the

T GC CAG

043S!..-

-

FIG. 4. In vitro start point for nifLA transcription as determinedby Si nuclease mapping. Transcription from pNIFL (as in Fig. 3,lane 4, but in 100 1.l, four times the usual volume) was allowed toproceed for 12 min in the presence of 0.5 mM CTP. Isolation ofmRNA, hybridization to a DNA probe, and digestion with nucleaseSi were essentially as previously described (18), except that 300 Uof nuclease 51 was used. The DNA probe (-0.03 pmol, 30,000 cpm)of 457 bp was 5' labeled at an AvaI site within nifL (correspondingto position 460 of Fig. 1) and extended to the HincII site upstream OfnifL (position 4 of Fig. 1). The labeled DNA fragment protected bynifLA mRNA (right lane) was subjected to electrophoresis on an 8%polyacrylamide gel (23) next to fragments generated in Maxam-Gilbert sequencing reactions (lanes 1 through 4). After 1.5-basecorrection, the lowest band in the right lane corresponds to position354 of Fig. 1. The slight heterogeneity in length of the protectedfragments in the right lane 5 was also observed with mRNAsynthesized in vivo (13, 28).

are centered at positions 191 (-163) and 212 (-142) (Fig. 1),two turns of the DNA helix apart. We obtained no evidencefor binding of NTRC closer to the nifLA promoter (data notshown).To determine whether NTRC-binding sites upstream of

the nifLA promoter played a role in activation of nifLAtranscription, we deleted them from plasmid pNIFL togenerate plasmid pNIFL(A) (pJES137). pNIFL was digestedwith EcoRI and PvuI (Fig. 1 and 2), treated with the Klenowfragment of DNA polymerase I to fill in the EcoRI site andremove the 3' overhang from the PvuI site, and ligated. Wethen compared transcription from the two templates atdifferent concentrations of NTRC (Fig. 6). Higher concen-trations of NTRC (ca. fourfold) were required to obtain the

top portion is shown. The expected length of the nifH7DK transcriptfrom pNIFH was -1,100 nucleotides. The transcript obtained,which was shorter than the nifLA transcript of 610 nucleotides,apparently terminated within the insert (perhaps at the terminatorfor the tetracycline gene of pBR322) rather than at the T7 terminatorof the vector. When this region ofpBR322 was deleted from pNIFH,the transcript obtained had the predicted length for a transcript thatterminated at the T7 terminator (P. Wong, unpublished).

J. BACTERIOL.

on March 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

NOTES 2879

o o

DNA seI O O METHYLATIONo 0

2 3 4 G fA' c 5 6 7 8 9

-215

-194

^,._......

FIG. 5. Binding of NTRC in the nifLA promoter-regulatoryregion. DNase I digestion of a nifLA promoter fragment in thepresence or absence of wild-type NTRC (lanes 1 through 4) wasperformed essentially as described previously (18); methylation(lanes 5 through 9) was performed essentially as described previ-ously (23; Keener et al., in press), except that the buffer alsocontained NaCl (final concentration, 40 mM) and MgCl2 (8 mM).The nifLA promoter fragment of 320 bp was 5' labeled at position140 (-214; MluI site) and extended to an AvaI site that would lie atposition 460 (+107) of Fig. 1. Before DNase I digestion or methyla-tion, the probe (50,000 cpm, 0.05 pmol) was incubated with wild-type NTRC for 10 min at 23°C. Final concentrations of NTRC were75 nM (lane 1), 15 nM (lane 2), 3 nM (lane 3), 0 nM (lanes 4 and 5,controls), 24 nM (lane 6), 40 nM (lane 7), 72 nM (lane 8), and 96 nM(lane 9). The bracket at left shows the boundaries of DNase Iprotection (positions 182 to 225 of the upper strand of Fig. 1). Thenumbers to the right indicate positions at which NTRC inhibited orenhanced methylation of G residues. Lanes so labeled are Maxam-Gilbert sequencing ladders for C, CT, GA, and G. The gel was an 8%sequencing gel; the middle portion is shown.

same amount of transcript from pNIFL(A) as from pNIFL(Fig. 6), consistent with the view that NTRC binding up-stream of nifLA does stimulate transcription from the nifLApromoter.

Deletion analysis of the nifLA promoter-regulatory regionin vivo indicated that a region upstream of position 196(-157) of Fig. 1 was required for normal activation of nifLAtranscription by NTRC (13). When the region upstream ofposition 196 was deleted from a 41 (nifL'-'lacZ) fusionplasmid, transcription from the nifLA promoter was de-

nif LA nif LA(A)

MO 1 2 4 0 1 2 4 M

FIG. 6. Effect of NTRC concentration on transcription fromplasmid templates pNIFL and pNIFL(A), which lacks bindng sitesfor NTRC (see the text). Transcription was assayed as describedpreviously (18, Keener et al., in press; see legend to Fig. 3). Asindicated above the lanes, templates were pNIFL or pNIFL(A&) (finalconcentration, -30 nM). The relative concentrations of NTRC (thentrC6lO mutant form-see the text), which are given above thelanes, were 0, 1, 2, and 4 where 1 corresponded to 135 nM. RNApolymerase core from E. coli (24 nM, final concentration) andpartially purified NTRA (1 pJ) were present in all transcriptionreactions. DNA size markers (M) and the gel were as in Fig. 3.

creased ca. fourfold if the level of NTRC was set by a singlechromosomal copy of its gene (13). We propose that thedecrease in transcription may be accounted for by loss of theupstream binding site for NTRC (Fig. 1). In vivo NTRCcontinues to activate nifLA transcription to some extentfrom deletion plasmids that leave only the nifLA promoterintact (e.g., upstream deletions that extend to position 321[-33] or 326 [-28] of Fig. 1 [13]). Drummond et al. (13)interpreted these results, which are confirmed by our in vitroresults, to indicate that NTRC can activate nifLA transcrip-tion by interacting directly with RNA polymerase-nowknown to be the NTRA holoenzyme form-at the nifLApromoter. Both in vivo and in vitro results imply that higherconcentrations of NTRC are required for direct interactionwith NTRA holoenzyme than are required when NTRC firstbinds to its upstream sites. This is also the case at ginA (10,30; Keener et al., in press).

Interestingly, deletion of a region between the upstreamNTRC binding sites and the nifLA promoter decreases nifLAtranscription in vivo ca. fourfold (13). (The deletion, whichcovers positions 219 through 301 of Fig. 1 [13], leaves theNTRC sites intact except that the last G of the downstreamsite is converted to an A.) The region between the NTRCsites and the promoter may be required to maintain sufficientseparation (30) or the correct orientation between them toallow efficient interaction of NTRC with NTRA holoenzyme(see reference 13 for other possibilities).

We thank Daniel Szeto for excellent technical assistance.This work was supported by Public Health Service grant

GM21307 to S.K. from the National Institutes of Health and aNational Science Foundation graduate fellowship to J.K.

LITERATURE CITED

1. Ames, G. F.-L., and K. Nikaido. 1985. Nitrogen regulation inSalmonella typhimurium. Identification of an ntrC protein-binding site and definition of a consensus binding sequence.EMBO J. 4:539-547.

2. Ausubel, F. M. 1984. Regulation of nitrogen fixation genes. Cell37:5-6.

3. Beynon, J., M. Cannon, V. Buchanan-Woliaston, and F. Cannon.

VOL. 169, 1987

::.' 'W.

on March 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

2880 NOTES

1983. The nif promoters of Klebsiella pneumoniae have acharacteristic primary structure. Cell 34:665-671.

4. Brown, S. E., and F. M. Ausubel. 1984. Mutations affectingregulation of the Klebsiella pneumoniae nifH (nitrogenasereductase) promoter. J. Bacteriol. 157:143-147.

5. Buchanan-Wollaston, V., M. C. Cannon, J. L. Beynon, and F. C.Cannon. 1981. Role of the nifA gene product in the regulation ofnif expression in Klebsiella pneumoniae. Nature (London)294:776-778.

6. Buck, M., H. Khan, and R. Dixon. 1985. Site directed mutagen-esis of the Klebsiella pneumoniae nifL and nifH promoters andin vivo analysis of promoter activity. Nucleic Acids Res.13:7621-7638.

7. Bueno, R., G. Pahel, and B. Magasanik. 1985. Role of glnB andglnD gene products in regulation of the glnALG operon ofEscherichia coli. J. Bacteriol. 164:816-822.

8. Buikema, W. J., W. W. Szeto, P. V. Lemley, W. H. Orme-Johnson, and F. M. Ausubel. 1985. Nitrogen fixation specificregulatory genes of Klebsiella pneumoniae and Rhizobiummeliloti share homology with the general nitrogen regulatorygene ntrC of K. pneumoniae. Nucleic Acids Res. 13:4539-4555.

9. de Bruin, F. J., and F. M. Ausubel. 1983. The cloning andcharacterization of the glnF (ntrA) gene of Klebsiella pneumo-niae. Role of glnF (ntrA) in the regulation of nitrogen fixation(nif) and other nitrogen assimilation genes. Mol. Gen. Genet.192:342-353.

10. Dixon, R. 1984. Tandem promoters determine regulation of theKlebsiella pneumoniae glutamine synthetase (gInA) gene. Nu-cleic Acids Res. 12:7811-7830.

11. Dixon, R., R. R. Eady, G. Espin, S. Hill, M. laccarino, D. Kahn,and M. Merrick. 1980. Analysis of regulation of Klebsiellapneumoniae nitrogen fixation (nif) gene cluster with gene fu-sions. Nature (London) 286:128-132.

12. Dixon, R. A. 1984. The genetic complexity of nitrogen fixation.J. Gen. Microbiol. 130:2745-2755.

13. Drummond, M., J. Clements, M. Merrick, and R. Dixon. 1983.Positive control and autogenous regulation of the nifLA pro-moter in Klebsiella pneumoniae. Nature (London) 301:302-307.

14. Drummond, M., P. Whitty, and J. Wooton. 1986. Sequence anddomain relationships of ntrC and nifA from Klebsiella pneumo-niae: homologies to other regulatory proteins. EMBO J. 5:441-447.

15. Drummond, M. H. 1985. The base sequence of the nifF gene ofKlebsiella pneumoniae and homology of the predicted aminoacid sequence of its protein product to other flavodoxins.Biochem. J. 232:891-896.

16. Elliott, T., and P. Geiduschek. 1984. Defining a bacteriophage T4late promoter: absence of a "-35" region. Cell 36:211-219.

17. Grossman, A. D., J. W. Erikson, and C. A. Gross. 1984. ThehtpR gene product of E. coli is a sigma factor for heat-shockpromoters. Cell 38:383-390.

18. Hirschman, J., P.-K. Wong, K. Sei, J. Keener, and S. Kustu.1985. Products of nitrogen regulatory genes ntrA and ntrCactivate glnA transcription in vitro: evidence that the ntrAproduct is a sigma factor. Proc. Natl. Acad. Sci. USA 82:

7525-7529.19. Hunt, T. P., and B. Magasanik. 1985. Transcription of glnA by

purified Escherichia coli components: core RNA polymeraseand the products of glnF, ginG and glnL. Proc. Natl. Acad. Sci.USA 82:8453-8457.

20. Kustu, S., K. Sei, and J. Keener. 1986. Nitrogen regulation inenteric bacteria, p. 139-154. In I. Booth and C. Higgins (ed.),Symposium of the Society for General Microbiology. Regula-tion of gene expression. Cambridge University Press, Cam-bridge.

21. MacNeil, D., and W. J. Brili. 1980. Mutations in nifgenes thatcause Klebsiella pneumoniae to be derepressed for nitrogenasesynthesis in the presence of ammonium. J. Bacteriol. 144:744-751.

22. Magasanik, B. 1982. Genetic control of nitrogen assimilation inbacteria. Annu. Rev. Genet. 16:135-168.

23. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

24. Merrick, M. J. 1982. A new model for nitrogen control. Nature(London) 297:362-363.

25. Merrick, M. J. 1983. Nitrogen control of the nif regulon inKlebsiella pneumoniae: involvement of the ntrA gene andanalogies between ntrC and nifA. EMBO J. 2:39-44.

26. Ninfa, A. J., and B. Magasanik. 1986. Covalent modification ofthe glnG product NRI, by the glnL product, NR1I, regulates thetranscription of the glnALG operon in Escherichia coli. Proc.Natl. Acad. Sci. USA 83:5909-5913.

27. Ow, D. W., and F. M. Ausubel. 1983. Regulation of nitrogenmetabolism genes by nifA gene product in Klebsiella pneumo-niae. Nature (London) 301:307-313.

28. Ow, D. W., V. Sundaresan, D. Rothstein, S. E. Brown, and F. M.Ausubel. 1983. Promoters regulated by the glnG (ntrC) and nifAgene products share a heptameric consensus sequence in the-15 region. Proc. Natl. Acad. Sci. USA 80:2524-2528.

29. Ow, D. W., Y. Xiong, Q. Gu, and S.-C. Shen. 1985. Site-directedmutagenesis of the Klebsiella nitrogenase promoter: sequencesessential for positive control by nifA and ntrC (glnG) products.J. Bacteriol. 161:868-874.

30. Reitzer, L. J., and B. Magasanik. 1986. Transcription of glnA inE. coli is stimulated by activator bound to sites far from thepromoter. Cell 45:785-792.

31. Roberts, G. P., and W. J. Brill. 1980. Gene-product relation-ships of the nif regulon of Klebsiella pneumoniae. J. Bacteriol.144:210-216.

32. Roberts, G. P., and W. J. Brill. 1981. Genetics and regulation ofnitrogen fixation, Annu. Rev. Microbiol. 35:207-235.

33. Sundareson, V., D. W. Ow, and F. M. Ausubel. 1983. Activationof Klebsiella pneumoniae and Rhizobium meliloti nitrogenasepromoters by gln (ntr) regulatory proteins. Proc. Natl. Acad.Sci. USA 80:4030-4034.

34. Ueno-Nishio, S., S. Mango, L. J. Reitzer, and B. Magasanik.1984. Identification and regulation of the glnL operator-promoter of the complex gInALG operon of Escherichia coli. J.Bacteriol. 160:379-384.

J. BACTERIOL.

on March 18, 2020 by guest

http://jb.asm.org/

Dow

nloaded from