translational control of the xenopus laevis connexin41 5 ... · injection of transcripts into one...

Translational control of the Xenopus laevis Connexin41

5’UTR by three upstream open reading frames

Hedda A. Meijer, Wim J.A.G. Dictus, Eelco D. Keuning, and Adri A.M. Thomas

Department of Developmental Biology, Utrecht University, Padualaan 8, 3584 CH Utrecht, The

Netherlands

Running title: Translational control of Xenopus Cx41

Corresponding author: Adri A.M. Thomas, Department of Developmental Biology, Utrecht

University, Padualaan 8, 3584 CH Utrecht, The Netherlands; tel. +3130-2533971; fax +3130-

2542219; e-mail: [email protected].

Abbreviations:ORF Open Reading FrameuORF upstream Open Reading FrameUTR Untranslated RegionIRES Internal Ribosome Entry SiteGJ Gap JunctionGJC Gap Junctional CommunicationCx ConnexinGFP Green Fluorescent ProteineIF4A eukaryotic Initiation Factor 4AXH3 Xenopus Histon 3RACE Rapid Amplification of cDNA EndsWT Wildtype

1

Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on July 13, 2000 as Manuscript M005531200 by guest on A

pril 3, 2020http://w

ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

SUMMARY

The Xenopus laevis Connexin41 (Cx41) mRNA contains three upstream open reading

frames (uORFs) in the 5’ untranslated region (UTR). We analyzed the translation

efficiency of constructs containing the Cx41 5’UTR linked to the GFP reporter after

injection of transcripts into one cell-stage Xenopus embryos. The translational efficiency

of the wildtype Cx41 5’UTR was only 2% compared to that of the β-globin 5’UTR.

Mutation of each of the three uAUGs into AAG codons enhanced translation 82-, 9-,

and 4-fold compared to the wild-type Cx41 5’UTR. Based on these increased

translation efficiencies the percentages of ribosomes that recognized the uAUGs were

calculated. Only 0.03% of the ribosomes that entered at the cap-structure scanned the

entire 5’UTR and translated the main ORF. The results indicate that all uAUGs are

recognized by the majority of the scanning ribosomes and that the three uAUGs strongly

modulate translation efficiency in Xenopus laevis embryos. Based on these data, a

model of ribosomal flow along the mRNA is postulated. We conclude that the three

uORFs may play an important role in the regulation of Cx41 expression.

2

by guest on April 3, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

INTRODUCTION

Gap junctions (GJ) are cell-to-cell channels that enable adjacent cells to share ions,

second messengers, and small metabolites up to a molecular mass of about 1500 Da.

They play an important role in many cellular processes, e.g. in contraction of muscles,

exocrine and endocrine secretion by the pancreas, and in transmission of neuronal

signals in synapses. Besides a role of gap junctional communication (GJC) in fully

differentiated cells, GJC is also essential in early developmental signaling and pattern

formation (1).

A complete GJ channel spans the plasma membranes of two adjacent cells and

is the result of the association of two half-channels or connexons. Each connexon is a

multimeric assembly of 6 proteins, the connexins. A connexin (Cx) contains 4

transmembrane domains and cytoplasmic N- and C-tails (2). Connexins form a multi-

gene family comprised of at least 17 members in mouse, with orthologues in other

vertebrate species (3). It has been suggested that the different family members are

created by gene duplications (4). Connexins are highly related, i.e. 50 to 80% identical at

amino acid level, with the most conserved sequences located in the transmembrane

domains (5). Nearly all connexins studied so far, have a common gene structure. Each

gene consists of two exons, with a 5’ untranslated region (UTR) in the first exon and an

uninterrupted open reading frame (ORF) and the 3’UTR in the second exon (6, 7). The

only exception known is the Cx35/36 subgroup that contains two introns (8, 9).

Cell-cell communication via gap junctions is dynamically regulated at different

levels: transcription, translation, intracellular trafficking, oligomerization, docking, and

gating (10). The best-studied mechanism is phosphorylation, which has an effect on the

3


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

latter four levels. Regulation of gap junctional communication by phosphorylation is

kinase- and connexin-specific, which makes it a very complex phenomenon (10). The

turnover rate of Cx proteins is rather high: 1 to 5 hours (11, 12). This enables regulation

at the transcriptional and translational levels.

Several lines of evidence indicate that at least some connexins can be regulated

at the mRNA level. (i) Cx43 expression is transcriptionally as well as translationally

regulated in PC12 cells by Wnt1 (13). (ii) Translational control of rat Cx32 and Cx43

expression was suggested after discovery of an internal ribosome entry site (IRES)

enabling translation of these mRNAs under conditions when cap-binding is

compromised (14). (iii) The stability of the rat Cx43 messenger is mediated by the

binding of neuronal-specific proteins to its 3’UTR (15). (iv) The existence of different

mRNAs encoding mouse Cx26 (16) and Cx32 (17), different in the 5’UTR only, suggests

translational control.

The ribosomal scanning model can explain translational control of most cellular

messengers (18). The 43S preinitiation complex binds at the 5’ terminal cap structure

and scans the 5’UTR until the complex recognizes an AUG codon. Subsequently, the

60S subunit joins and protein synthesis starts. Recognition of the AUG codon is

dependent on the surrounding sequences and on the secondary structure of the mRNA

(19). Usually, translation starts at the most 5’ AUG codon. When the 5’UTR contains

upstream AUGs (uAUGs), the main ORF can be translated by (i) ribosomes entering on

an internal ribosome entry site (IRES), (ii) by termination at the upstream ORF and

reinitiation at the next AUG, (iii) by leaky scanning, i.e. uAUGs are not recognized by all

scanning ribosomal complexes, or (iv) by a combination of these processes (20).

Four Xenopus laevis connexins are known: Cx30, Cx38, Cx41, and Cx43 (21-

4


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

23). The latter three connexins are expressed in the ovary. Only maternal Cx38 mRNA

remains during early embryonic development (until stage 11). The first embryonic

messenger is Cx30 (from stage 11 onwards), while embryonic Cx41 and Cx43

transcripts appear at stage 25. The Cx41 transcript is expressed at a very low level (23,

24).

This paper describes the study on the translational control of Xenopus Cx41. The

Cx41 5’UTR contains three small open reading frames (uORFs), that might be involved

in translational regulation of Cx41 expression. The effect of the three individual upstream

AUG codons on translation efficiency was analyzed by mutating each of them into an

AAG triplet. The presence of the three uAUGs strongly decreased the flow of ribosomes

towards the initiation codon of the main ORF of the Cx41 mRNA. The effects of the

single mutations of the uAUGs on reporter gene expression enabled us to calculate the

efficiency of uAUG recognition by the ribosome.

EXPERIMENTAL PROCEDURES

Plasmid construction

The Cx41 5’UTR was amplified with a 5’/3’RACE Kit (Boehringer Mannheim). Ovaria of

adult Xenopus laevis were dissected out of the animals after a 20 minutes anaesthesia

on ice, total RNA was isolated and used for the synthesis of cDNA. The Cx41 specific

reverse primers (Table 1) Cx41-OR2, Cx41-OR1 and Cx41-5R1 were designed based

on the published sequence (23). The latter primer mutates the sequence around the

ATG into an NcoI restriction site. The PCR cycling conditions were dependent on the

5


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

primers used. In the first PCR, using Cx41-OR2, after the initial denaturation (5 min,

95ÚC) 40 cycles were performed of denaturation (1 min, 95ÚC), annealing (2 min,

55ÚC), and elongation (2 min, 72ÚC), followed by an extra elongation period of 10

minutes (72ÚC). In the PCR with primer Cx41-OR1 the conditions were the same,

except for the annealing temperature (5 cycles at 40ÚC and 35 cycles at 45ÚC). The

PCR product was cloned into pBluescript SK+ provided with a NcoI site (kindly provided

by A. Buchel, Leiden University, The Netherlands). After confirmation of the sequence

(T7 Sequencing Kit, Pharmacia Biotech) a forward primer (Cx41-5F1) was designed,

consisting of a HindIII restriction site and nucleotides 1-18. A PCR was setup with this

primer to facilitate the cloning of the PCR product into pT7TS. This vector was a gift of

P.A. Krieg (University of Texas, USA) and contains the Xenopus β-globin 5’UTR (45 nt),

3’UTR (157 nt) and a track of 30 A and C residues behind the 3’UTR. The GFP ORF

was inserted between the 5’ and 3’ UTR (see also Fig. 2A).

Based on the newly designed construct (pT7TS-Cx41-GFP-glob-A30C30) four

different Cx41 constructs were made (see also Fig. 4A). In each construct one or all

upstream ATGs were mutated to AAG. Three subsequent PCRs were performed. In the

first PCR the WT Cx41 clone was used as template and Cx41-5F3 and Cx41-5R1 as

primers to create the two downstream AAG triplets. After the initial denaturation (5 min,

95ÚC) 5 cycles were performed of denaturation (20 sec., 95ÚC), annealing (40 sec.,

34ÚC) and elongation (40 sec., 72ÚC), followed by 35 cycles with an annealing

temperature of 62ÚC and a final elongation period of 10 minutes (72ÚC). The resulting

PCR product was isolated and used as reverse primer in the second PCR with Cx41-

5F2. Annealing was performed at 44ÚC and 72ÚC respectively. The PCR product was

then used as primer in a PCR with primer Cx41-5F1 at the same annealing

6


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

temperatures, creating a fragment linked by a HindIII and an NcoI restriction site. This

fragment was cloned into pT7TS. Clones with the desired mutation combinations were

selected after sequencing.

In vitro transcription and translation

Plasmid DNA was linearized with BamHI and purified by

phenol/chloroform/isoamylalcohol extraction and subsequent ethanol precipitation.

Capped synthetic mRNA was generated using the mMessage mMachine kit (Ambion).

The mRNA was deproteinized and purified on a Sephadex G50 fine column (Pharmacia

Biotech) followed by ethanol precipitation. Amount and integrity of the mRNA was

checked by spectrophotometry and ethidiumbromide-agarose gel electrophoresis. Equal

amounts of transcript were translated in a reticulocyte lysate system in the presence of

[35S]-methionine (25). Labeled proteins were separated on a 12.5% acrylamide gel and

detected by exposure to Hyperfilm MP (Amersham Life Science). Signals were

quantified after overnight exposure to a Phosphor Screen and subsequently analyzed

using a Phosphor Imager and Image Quant software (Molecular Dynamics). Small

peptides were visualized after incorporation of labeled [35S]-methionine/cysteine and

separation on a Tris-tricine acrylamide gel (26).

Embryo injections

Xenopus laevis frogs were reared as described (27). Female animals were injected with

800 I.E. Human Chorionic Gonadotrophin (Pregnyl, Organon) 16 hours before use. The

female animals were kept at 14ÚC after injection. Males were injected twice with 400 I.E.

Human Chorionic Gonadotrophin, once in the week prior to the experiment and once 16

7


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

hours before use. Males were anaesthesized on ice for at least 20 minutes. After

decerebration, the testes were dissected, rinsed, and stored at 4ÚC in 100% MMR (100

mM NaCl, 2 mM KCl, 2 mM CaCl2 and 5 mM Hepes, 1 mM EDTA pH 7.4). Immediately

after squeezing the female frogs, the eggs were rinsed with tap water and fertilized with

sperm squeezed out of a small piece of testis. Twenty minutes after fertilization the

embryos were dejellied in 2% cystein-HCl in tap water (pH 7.9). Embryos were reared in

3% Ficoll in 25% MMR at 18ÚC and staged according to the normal table of Xenopus

laevis (28).

Injection needles (GC150-TF10, Clark Electromedical Instruments) were pulled

(Micropipette puller, Sutter Instruments) and broken to a tip diameter of ~10 µm. Needles

were calibrated after injection of water into oil (PV830 Pneumatic Pico Pump, World

Precision Instruments), measurement of the diameter of the droplet and adjustment of

the pressure. One-cell stage embryos were injected with 0.8-1 ng RNA in 8-10 nl

water. Twenty-four hours after fertilization the embryos were pooled, rapidly frozen in

liquid nitrogen, and stored at -80ÚC for RNA or protein isolation.

Analyses of injected embryos

RNA was isolated with RNAzol B (Campro Scientific B.V.) according to the

manufacturers protocol with an extra centrifugation step after homogenization of the

embryos. Northern blots were performed with 5 µg total RNA per lane. RNA samples

were glyoxylated to melt any secondary structure and analyzed on a sodiumphosphate-

buffered 1.5% agarose gel (29). RNA was blotted on Hybond-N membrane (Amersham

Life Science) by capillary transfer and subsequently UV-crosslinked to the blot. After at

least two hours at 65ÚC in prehybridization solution (5x Denhardts, 3x SSC, 0.1% SDS,

8


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

100 mg dextran sulfate and 50 µg salmon sperm DNA per ml), a [32P]-dCTP

(Amersham Life Science) labeled GFP probe (T7 Quick Prime kit, Pharmacia Biotech)

was added and hybridization performed overnight at 65ÚC. The probe was purified by

Sephadex G50 fine filtration (Pharmacia Biotech). Excess probe was removed by

washing in 0.1x SSC, 0.1% SDS at room temperature. Signal was detected by exposure

of the blot to Hyperfilm MP (Amersham Life Science), quantified after overnight exposure

to a Phosphor Screen, by using a Phosphor Imager and Image Quant software

(Molecular Dynamics). Prior to hybridization to a Xenopus Histon 3 (XH3) probe the blot

was stripped by pouring boiling 1% SDS directly onto the blot.

Proteins were isolated by resuspending the embryos in 20 mM Tris-HCl pH 7.6,

100 mM KCl, 10% glycerol, and 0.1 mM EDTA (10 µl/embryo). After repeated freezing

and thawing, the mixture was centrifuged at 13.000 rpm at 4ÚC for 10 minutes. Fat-free

supernatant was transferred to a clean eppendorf tube. This was repeated once to

obtain a clear supernatant. Protein equivalent to one or three embryos was separated on

a 12.5% acrylamide gel and blotted onto Hybond-P (Amersham Life Science). After

Ponceau Red staining (0.2% in 1% acetic acid) the blot was cut into two parts just below

the 40 kDa marker band. Both parts of the blot were blocked in 5% fat free milkpowder in

PBS/0.2% Tween for one hour. The lower part was incubated with GFP antibody

(Clontech, 1:100 in blocking solution), the upper part was incubated with rat antibody

raised against eIF4A (1:5000 in blocking solution), for two hours at room temperature.

After another incubation in blocking solution the blots were incubated with 5000-fold

diluted peroxidase-conjugated secondary antibody for 1 hour at room temperature. After

washing in PBS/0.1% Tween the blot was developed with chemoluminescence before

exposure to film. The amounts of protein were determined by using a densitometer and

9


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Image Quant software (Molecular Dynamics). The quantification was confirmed by

loading equal amounts of GFP protein on SDS-PAGE and subsequent analysis (results

not shown).

Translation efficiency was calculated by dividing the amount of GFP protein

produced by the amount of injected GFP mRNA. The figures were corrected for the

differences in loading, determined using the eIF4A antibody and the XH3 probe.

Translation efficiency of the most efficient construct was set at 100%.

RESULTS

Cx41 5’ untranslated region

The partial sequence of Cx41 cloned earlier (23) contains a 154 nucleotides 5’UTR with

3 potential uORFs, the complete coding region (1146 nt) and a 3’UTR of 2317

nucleotides. The potential uORFs in the 5’UTR and the extremely long 3’UTR suggest

translational control of this messenger. A 5’RACE PCR was performed to obtain the

complete Cx41 5’UTR. Eight clones were sequenced and all clones contained a 5’UTR

of 174 nucleotides (Fig. 1A), slightly longer than the sequence reported before (23).

Presumably, the cDNA library clone resulted from incomplete reverse transcription of the

mRNA (23).

The stability of the 5’UTR and of the strongest hairpin within the leader were

calculated for 18ÚC, the breeding temperature of Xenopus embryos (30). The free

energy (∆G) of the complete 5UTR was 62 kcal/mole and that of the strongest hairpin 38

kcal/mole, corresponding to 34 and 21 kcal/mole at 37ÚC. Structures with a free energy

10


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

more than 50 kcal/mole (at 37ÚC) are not a severe problem for the eukaryotic

translational machinery (31, 32). Therefore the stability of the hairpins within this 5UTR is

expected not to cause substantial translational repression. The 5UTR contains three

upstream startcodons, all followed by in frame stopcodons (Fig. 1B). The upstream open

reading frames potentially encode three small peptides of 28, 8, and 6 amino acids (Fig.

1C). These uORFs might have a function in translational control. None of the sequences

around the uAUGs conform to the Xenopus consensus sequence

(A/C)(A/C)A(A/C)(A/C)AUG(A/G) (33). In contrast, the region around the startcodon of

the Cx41 open reading frame contains the best conserved nucleotides, i.e. the A at –3

and the G at +1 relative to the AUG (34).

Translation efficiency of the Cx41 5’UTR

To investigate the translational capacity of the Cx41 5’UTR, constructs containing the

5’UTR of either Cx41 or Xenopus β-globin, the ORF of the Green Fluorescent Protein

(GFP) reporter, and the 3’UTR of β-globin were made (Fig. 2A). DNA was cut after the

A30C30 sequence and used to make transcripts for in vivo and in vitro translation.

Addition of the A30C30 tail supports stability and thereby translation of the transcript

(unpublished results A.W. van der Velden). The construct with the β-globin 5’UTR was

used as a positive control since this 5’UTR enables very efficient translation of the

downstream ORF (35). The in vitro translation of these transcripts in the reticulocyte

lysate system showed that the Cx41 5’UTR was about three-fold less efficient than the

globin 5’UTR construct (Fig. 2B and C). This indicates that, in spite of the three uORFs,

the Cx41 5’UTR does not cause strong translational repression in vitro. Apparently, the

reticulocyte system is relatively insensitive to the presence of three potential upstream

11


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

initiation codons.

The same constructs were injected into one-cell stage Xenopus laevis embryos.

In each embryo 0.8-1 ng mRNA was injected. This is the smallest amount of transcript

resulting in a detectable amount of GFP with the wildtype Cx41 5’UTR (data not shown).

Injected embryos were pooled 24 hours after fertilization (stage 13-14) for protein and

RNA isolation. GFP protein production was visualized by Western blotting. The amount

of GFP protein (Fig. 3A) was corrected for the amount of injected GFP mRNA (Fig. 3C),

while both signals were corrected for the loading controls (eIF4A and Xenopus Histon 3,

Fig. 3B and D). In vivo translation efficiency of the Cx41 5’UTR was only 2%, compared

to the β-globin 5’UTR. Apparently, the replacement of the efficient β-globin 5’UTR for

the Cx41 5’UTR strongly reduces translation. The relative translation efficiencies were

also analyzed eight hours after fertilization (stage 8-9). They appeared to be similar

compared to 24 hours after fertilization (data not shown).

Peptide uORF1

Since the uORFs were expected to be the cause of the translational repression, the

uAUGs were mutated into AAG. To facilitate the analysis of the contribution of each

individual startcodon, four different constructs were made with either one or with all

uAUGs mutated (Fig. 4A). The translation efficiency of the transcripts with single

mutations (∆1, ∆2, and ∆3) was compared to the wildtype Cx41 5’UTR (WT) and the

triple mutant (∆123) in reticulocyte lysate. In this assay, no remarkable differences were

found (Fig. 4B).

The in vitro translation assay was also performed with a mixture of [35S]-

methionine and [35S]-cysteine and analyzed on tris-tricine gels to enable the

12


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

visualization of small peptides (Fig. 5). Three transcripts were analyzed: the wildtype

(WT), the single mutant ∆1, and the triple mutant (∆123). Translation of the wildtype

5’UTR produced a small peptide, that migrated slightly slower than a 20 amino acid

residue control peptide (2.3 kDa). No peptides were detected with the ∆1 and the ∆123

mutant transcripts. Therefore, the peptide produced was due to the presence of uAUG1.

Note that the exposure times for GFP (16 hours) and the peptide (2 weeks) were very

different (Fig. 5). Even taking into account the number of cysteines and methionines in

GFP and the 28 amino acid peptide, the amount of peptide formed was very low. The

results are in agreement with the moderate translational repression in vitro of the WT

Cx41 5’UTR compared to the globin 5’UTR and with the lack of differences in in vitro

translational capacities between the Cx41 mutants.

Effect of the three upstream AUG triplets on translation efficiency

Wildtype or mutant Cx41 transcripts were injected into one-cell stage Xenopus embryos.

The embryos were pooled 24 hours after fertilization. Extracts were made and analyzed

for the amount of GFP protein and mRNA present at the time of harvesting. The amount

of produced GFP protein was corrected for the amount of injected GFP mRNA and for

loading differences (Fig. 6).

The translation efficiency of the triple mutant (∆123) was remarkably high

compared to the wildtype transcript. The efficiency of ∆123 was set at 100%. Only 1% of

GFP was formed by the wildtype transcript. The mutation of the three uAUGs enhanced

translation efficiency 82- (∆1), 9- (∆2), and 4-fold (∆3) compared to the wild-type Cx41

5’UTR. Calculation of the efficiency of translational repression by each AUG will be

discussed in detail later. When the embryos were collected eight hours after fertilization

13


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

the results were similar (data not shown). The results show that the presence of the

uAUGs in the leader of Cx41 strongly represses translation of the downstream GFP ORF

in young Xenopus embryos.

One of the differences between the analyses of translation efficiency in

reticulocyte lysate and analyses after injection of Xenopus laevis embryos is the

incubation temperature. The in vitro translation was performed at 30ÚC, whereas the

injected embryos were cultured at 18ÚC. The results might reflect a difference in a

temperature-dependent mechanism. For example, the secondary structure of an mRNA

is dependent on temperature, and alteration in the secondary structure may influence

recognition of uAUGs. To test whether the difference between the in vitro and in vivo

results was the result of difference in temperature at which the analyses were done, the

in vitro translation was performed at 18, 24, and 30ÚC. The Cx41 WT and the ∆1

transcripts as well as the globin-GFP mRNA were analyzed (Fig. 7). Translation

efficiency in reticulocyte lysate was strongly dependent on the temperature. However, at

each temperature tested, the ratio of the translation efficiency of Cx41 WT, ∆1 and the

globin 5’UTR transcripts was similar (see also Fig. 2). The differences between in vitro

and in vivo translation efficiencies were apparently not caused by a temperature

dependent recognition of the uAUGs. Therefore, the scanning rate and translation

initiation complex formation were not different at the measured temperatures with regard

to the relative translation efficiencies of the three RNAs. Probably, regulation of

translation by co-factors modulating uAUG recognition is different in young Xenopus

embryos and in reticulocyte lysate. The striking difference in upstream AUG recognition

between in vitro and in vivo assays was noticed before (36).

14


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

DISCUSSION

After mutation of the uAUGs in the Cx41 5’UTR the translation efficiency increased.

Based on this increased translation the percentage of Xenopus ribosomes that

recognized the uAUGs after RNA injection was calculated (Fig. 8). Mutation of uAUG3

into an AAG codon caused a four-fold increase in translation efficiency. According to the

leaky scanning model, this implies that for each ribosome that recognized the AUG of

the main ORF four times more scanning ribosomal complexes must be present on the

5’UTR upstream of uAUG3. When there are four scanning complexes present upstream

of uAUG3, the 9-fold increase due to mutation of uAUG2 means the presence of 36

(9x4) scanning complexes upstream of uAUG2. Mutation of uAUG1 enhanced the

translation efficiency 82-fold, so for each ribosome that reached the main ORF, about

3000 (82x36) ribosomal complexes should enter the mRNA at the cap at the 5’ end. The

number of cap-binding ribosomal complexes was set at 100% which means that only

0.03% of these complexes scan the entire 5’UTR and translate the main ORF.

The model in Fig. 8 accounts for all observations and is fully consistent with the

ribosomal scanning model (18). The presented data do not suggest any involvement of

the secondary or higher-order structure of the mRNA. Furthermore, the minor amino

acid changes due to the AUG to AAG mutations are most likely not responsible for the

increase in translation efficiency. We have made a mutant construct in which

approximately 40% of the amino acid residues was changed. Preliminary data indicate

that ablation of uAUG1 had the same effect in this severely mutated 5’UTR as in a

wildtype 5’UTR (data not shown).

The number of ribosomes leaving the mRNA is a subtraction of the number of

15


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ribosomes upstream and downstream of the corresponding uAUG (Fig. 8). By dividing

the number of ribosomes leaving the mRNA after recognition of an uAUG by the number

of ribosomes scanning the 5’UTR upstream of the same uAUG, the percentage of

ribosomes leaving the mRNA before arrival at the GFP initiation codon, was calculated.

This calculation shows that all uAUGs were recognized by the majority of the scanning

complexes (99%, 89%, and 75%). If reinitiation may have occurred, ribosomes must

have recognized the uAUGs even more efficiently. Note that reinitiation can only occur at

the main ORF, because of the overlapping uORFs.

Simultaneous mutation of all uAUGs increased translation 100-fold, whereas the

proposed model (Fig. 8) predicts a 3000-fold (82x9x4) increase. The replacement of the

wildtype Cx41 5’UTR by the 5’UTR of β-globin increased translation 50-fold. The β-

globin is among the most efficiently translated messengers (35). We suggest that the β-

globin mRNA as well as the ∆123 transcript are maximally loaded with translating

ribosomes, and that therefore a more than 100-fold increase in the expression level is

not possible. Fig. 8 presents the working model of our data, but certain predictions of this

model can be studied further, such as by making in-frame fusions of the uORFs with

GFP.

We assumed that all scanning complexes that reached the AUG of the main ORF

produced GFP. The sequence flanking this AUG conformed to the consensus sequence

of Xenopus laevis (A/C)(A/C)A(A/C)(A/C)AUG(A/G) (33) with respect to the most conserved

nucleotides at –3 and +1 (34). The sequence flanking uAUG1 showed this consensus

with respect to the G at +1, while uAUG2 and uAUG3 were not flanked by one of the

conserved nucleotides. However, the Xenopus consensus sequence has not been

experimentally investigated, and was deduced from the nucleotides that flank initiation

16


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

codons of known open reading frames (33). The hypothesis that occurrence of

nucleotides at specific sites surrounding the AUG is linked to translational efficiency

proved correct in higher vertebrate mRNAs (34), but may not be true for Xenopus

mRNAs.

Some examples of translational control by upstream ORFs have been described.

The most well studied examples are the 5’UTRs of GCN4, CMV (cytomegalovirus), and

AdoMetDC (S-adenosylmethionine decarboxylase) mRNA (37-41). An extensive set of

mutants allowed the unraveling of a mechanism in which growth-limitations regulate the

recognition of uAUGs and thereby translation of GCN4 (37,38). Stalling of ribosomes at

uORFs reduced translation of CMV and AdoMetDC (39-41). Regulation of annihilation

of stalling is not yet understood. A similar case is true for the results shown here:

although the uORFs clearly down-regulate expression of the main ORF, reversal of this

down-regulation is required to allow more efficient Cx41 synthesis.

In young Xenopus embryos, the Cx41 messenger is present in low amounts (24).

From stage 15 onwards, messenger is detected by RT-PCR analysis, while Northern

blotting showed the presence from stage 25 onwards. After injection of Xenopus

embryos with constructs containing the wildtype Cx41 5’UTR, translation was strongly

repressed due to the presence of three uORFs (Fig. 3). Obviously the production of

Cx41 protein in young embryos is strongly inhibited by transcriptional and translational

control. The amount of Cx41 messenger increases in older embryos, suggesting a

requirement for more Cx41 protein. To allow for increased Cx41 protein levels,

translational derepression has to occur simultaneously. A similar combined control of

gene expression was described for PDGF 2 mRNA during megakaryocytic differentiation

(42). Translational control allows for fast adaptation to changing conditions as occurs

17


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

during development, because the mRNA is already present. Translational derepression

may occur at certain stages of development, possibly by proteins masking the uAUGs,

thereby allowing more efficient translation initiation.

Of all connexin mRNAs from Genbank which have a recognizable -- although

often incomplete -- 5’UTR, more than 40% contain at least one upstream AUG or ORF

in contrast to a random analysis of about 700 vertebrate mRNAs, of which only 9%

contain an uAUG codon (34). This suggests that the translational control as described

here for Xenopus Cx41 may be more general among connexin mRNAs.

We were not able to detect the 28 amino acid peptide produced by translating

uORF1 after in vivo translational analyses (data not shown). Currently we are making

tagged constructs enabling the visualization of this peptide in vivo. This should facilitate

further analyses of the mechanism of translational control of Xenopus Cx41 and provide

further evidence for the proposed model.

ACKNOWLEDGMENTS

We thank A. Buchel (Leiden University, The Netherlands) for the pBluescript SK+ clone

with an NcoI site, P.A. Krieg (University of Texas, USA) for the pT7TS clone, and C.

Kuhlemeier (Berne University, Switzerland) for the eIF4A antibody. We thank M.A.M.

Kasperaitis for technical assistance, the Department for Image Processing and Design

for help in artwork, H.O. Voorma for critical reading of the manuscript (all Utrecht

University, The Netherlands) and the Hubrecht Laboratory (Utrecht, The Netherlands) for

providing Xenopus laevis embryos.

18


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

REFERENCES

1. Green, C.R. (1998) Principles Med. Biol. 11, 103-121

2. Sosinsky, G. (2000) Curr. Topics Membranes 49, 1-22

3. Kumar, N.M. (1999) Novartis Found. Symp. 219, 6-16

4. Bruzzone, R., White, T.W., and Paul, D.L. (1996) Eur. J. Biochem. 238, 1-27

5. Goodenough, D.A., Goliger, J.A., and Paul, D.L. (1996) Annu. Rev. Biochem. 65,

475-502

6. Hennemann, H., Kozjek, G., Dahl, E., Nicholson, B., and Willecke, K. (1992) Eur. J.

Cell. Biol. 58, 81-89

7. Sullivan, R., Ruangvoravat, C., Joo, D., Morgan, J., Wang, B.L., Wang, X.K., and Lo,

C.W. (1993) Gene 130, 191-199

8. O’Brien, J., Bruzzone, R., White, T.W., AL-Ubaidi, M.R., and Ripps, H. (1998) J.

Neurosci. 18, 7625-7637

9. Belluardo, N., Trovato-Salinaro, A., Mudò, G., Hurd, Y.L., and Condorelli, D.F.

(1999) J. Neurosci. Res. 57, 740-752

10. Sáez, J.C., Martínez, A.D., Brañes, M.C., and González, H.E. (1998) Braz. J. Med.

Biol. Res. 31, 593-600

11. Laing, J.G., Tadros, P.N., Westphale, E.M., and Beyer, E.C. (1997) Exp. Cell. Res.

236, 482-492

12. Beardslee, M.A., Laing, J.G., Beyer, E.C., and Saffitz, J.E. (1998) Circ. Res. 83,

629-635

13. Van der Heyden, M.A.G., Rook, M.B., Hermans, M.M.P., Rijksen, G., Boonstra, J.,

Defize, L.H.K., and Destrée, O.H.J. (1998) J. Cell. Sci. 111, 1741-1749

19


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

14. Schiavi, A., Hudder, A., and Werner, R. (1999) FEBS Letters 464, 118-122

15. Neve, R.L., Ivins, K.J., Tsai, K-C., and Rogers, S.L., Perrone-Bizzozero, N.I. (1999)

Mol. Brain Res. 65, 52-60

16. Hennemann, H., Kozjek, G., Dahl, E., Nicholson, B., and Willecke, K. (1992) Eur. J.

Cell Biol. 58, 81-89

17. Söhl, G., Gillen, C., Bosse, F., Gleichmann, M., Müller, H.W., and Willecke, K. (1996)

Eur. J. Cell Biol. 69, 267-275

18. Kozak, M. (1989) J. Cell. Biol. 108, 229-241

19. Kozak, M. (1990) Proc. Natl. Acad. Sci. USA 87, 8301-8305

20. Kozak, M. (1992) Crit. Rev. Biochem. Mol. Biol. 27, 385-402

21. Gimlich, R.L., Kumar, N.M., and Gilula, N.B. (1988) J. Cell. Biol. 107, 1065-1073

22. Gimlich, R.L., Kumar, N.M., and Gilula, N.B. (1990) J. Cell. Biol. 110, 597-605

23. Yoshizaki, G. and Patiño, R. (1995) Mol. Reprod. Dev. 42, 7-18

24. Houtzager, E., ed. (1998) The role of connexins and the function of dorsal endoderm

in embryogenesis of Xenopus laevis, Thesis Utrecht University, Utrecht, The

Netherlands, pp 67-92

25. Scheper, G.C., Voorma, H.O., and Thomas, A.A.M. (1992) J. Biol. Chem. 267, 7269-

7274

26. Schägger, H. and Von Jagow, G. (1987) Anal. Biochem. 166, 368-379

27. Wu, M. and Gerhart, J. (1991) Meth. Cell. Biol. 36, 3-18

28. Nieuwkoop, P.D. and Faber, J., eds. (1956) Normal table of Xenopus laevis

(Daudin). A systematical and chronological survey of the development from the

fertilized egg till the end of metamorphosis, North-Holland Publishing Company,

Amsterdam, The Netherlands, pp 162-188

20


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

29. Van Oers, M.M., Vlak, J.M., Voorma, H.O., and Thomas, A.A.M. (1999) J. Gen. Virol.

80, 2253-2262

30. Zuker, M. (1994) Methods Mol. Biol. 25, 267-294

31. Kozak, M. (1986) Proc. Natl. Acad. Sci. USA 83, 2850-2854

32. Kozak, M. (1989) Mol. Cell. Biol. 9, 5134-5142

33. Brown, C.M., Dalphin, M.E., Stockwell, P.A., and Tate, W.P. (1993) Nucl. Acids Res.

21, 3119-3123

34. Kozak, M. (1987) Nucl. Acids Res. 15, 8125-8148

35. Krieg, P.A. and Melton, D.A. (1984) Nucl. Acids Res. 12, 7057-7070

36. Wang, L. and Wessler, S.R. (1998) Plant Cell 10, 1733-1745

37. Hinnebusch, A.G., Jackson, B.M., and Mueller, P.P. (1988) Proc. Natl. Acad. Sci.

USA 85, 7279-7283

38. Abastado, J.-P., Miller, P.F., and Hinnebusch A.G. (1991) New Biol. 3, 511-524

39. Cao, J. and Geballe, A.P. (1996) Mol. Cell. Biol. 16, 7109-7114

40. Cao, J. and Geballe, A.P. (1998) RNA 4, 181-188

41. Ruan, H., Shantz, L.M., Pegg, A.E., and Morris D.R. (1996) J. Biol. Chem. 271,

29576-29582

42. Bernstein, J., Shefler, I., and Elroy-Stein, O. (1995) J. Biol. Chem. 270, 10559-

10565

21


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

FIGURE LEGENDS

Figure 1 Sequence of the Cx41 5 ’UTR

A) Sequence of the 5’UTR of Cx41 (Genbank Accession number AF238222). Upstream

AUG codons are underlined, the startcodon of the main open reading frame is in bold,

and in frame termination triplets are in italics. B) Schematic drawing of the Cx41 5’UTR.

Upstream and main open reading frames are boxed. C) Amino acid sequence of the

putative peptides, encoded by the three potential upstream open reading frames.

Figure 2 In vitro translation of Cx41 and β-globin 5’UTR containing transcripts

A) Schematic drawing of the constructs used in translation analyses. The transcripts

contain either the Cx41 or the β-globin 5’UTR, the GFP ORF, the β-globin 3’UTR, and

an A30C30 tail. B) Translational analysis of Cx41 transcripts in reticulocyte lysate.

Different amounts of transcript were translated in reticulocyte lysate in the presence of

[35S]-labeled methionine. Products were separated on a 12.5% acrylamide gel, and the

resulting gel was dried and exposed to an X-ray film. C) The amount of produced

protein was quantified as described in Materials and Methods.

Figure 3 Translational analysis of the Cx41-GFP transcript after injection into

Xenopus embryos

One-cell stage Xenopus laevis embryos were injected with the transcripts shown in Fig.

2A. Embryos were pooled 24 hours after fertilization for protein and RNA isolation.

Panels A and B: Protein expression analysis of injected embryos. Protein derived from

an equivalence of three embryos was separated on a 12.5% acrylamide gel and blotted.

22


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

The blot was cut into two parts; the lower part was incubated with GFP antibody (panel

A) while the upper part was incubated with eIF4A antibody (panel B) as a control for

loading. Panels C and D: Northern blot analysis of injected embryos. Five µg of total

RNA was glyoxylated and analyzed on a sodiumphosphate-buffered 1.5% agarose gel.

The blot was subsequently hybridized to a GFP (panel C) and a Xenopus Histon-3

probe (XH3, panel D). Translation efficiency was calculated by dividing the amount of

GFP protein produced by the amount of injected GFP mRNA. These figures were

corrected for the loading controls (eIF4A and XH3 respectively).

Figure 4 Effect of 5 ’UTR AUG mutations on translation in vitro

Panel A: Schematic presentation of the upstream AUG mutants. All constructs contain

the Cx41 5’UTR, the GFP ORF, the β-globin 3’UTR, and an A30C30 tail. The presence

(+) or absence (-) of the respective uAUGs is shown. Panel B: Different amounts of

transcript were translated in a reticulocyte lysate in the presence of [35S]-labeled

methionine. Products were separated on a 12.5% acrylamide gel, and the resulting gel

was dried and exposed to an X-ray film.

Figure 5 In vitro translation of uORF1

Three different Cx41 constructs (WT, ∆1, and ∆123; see also Fig. 4A) were translated in

a reticulocyte lysate for 10 and 20 min in the presence of [35S]-labeled methionine and

cysteine. Analysis of produced peptides on tris-tricine gels was as described in

Materials and Methods. Due to the high amount of hemoglobin in the assays, migration

of the peptides is slightly distorted. Panel A: 16 hours exposure, panel B: 2 weeks

23


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

exposure. Protein size markers are indicated.

Figure 6 In vivo translation of Cx41 mutant 5’UTRs

One-cell stage Xenopus laevis embryos were injected with one of the transcripts listed

in Fig. 4A. The embryos were pooled 24 hours after fertilization for protein and RNA

isolation. Panels A and B: Protein corresponding to one embryo was separated on a

12.5% acrylamide gel and blotted onto Hybond-P. Panels C and D: Five µg of total RNA

was glyoxylated and analyzed on a sodiumphosphate-buffered 1.5% agarose gel.

Analysis was done as in Fig. 3. Panel A: GFP antibody, panel B: eIF4A antibody, panel

C: GFP probe, panel D: Histon-3 probe (XH3).

Figure 7 Effect of incubation temperature on in vitro translation efficiency

Two different Cx41 constructs (WT and ∆1) and the globin construct (see also Figs. 2A

and 4A) were translated in a reticulocyte lysate in the presence of [35S]-labeled

methionine. Products were analyzed (panel A) and quantified (panel B) as in Fig. 2.

Figure 8 Ribosome flow on Cx41 5 ’UTR

Based on the increased translation due to mutation of each one of the uAUGs the

percentage of ribosomes leaving the mRNA after recognition of an uAUG was calculated

as described in the text. Note that in spite of the differences in translation increase due

to the mutation of the different uAUGs, all uAUGs were recognized by the majority of the

scanning complexes. Therefore only 0.03% of the ribosomes, entering the transcript,

scan the entire 5’UTR and translate the main ORF.

24


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Table 1

Primers used for plasmid construction

Name Sequence (5’-3’)* Position Remarks

_____________ __________________________________________ _____________ ________

______

Cx41-5F1 CGGCCAAGCTTGCTCTCTTATCACACAGC 1-18 HindIII

Cx41-5F2 GGCACATACGGAATTTATAAGGCTTTACCA - 23-58 mutagenesis

GTGAAG uATG1

Cx41-5F3 CTACACACAATTTCTGGGCAWGCCAAWGC - 78-118

mutagenesis AGGTGGGGTGCC

uATG2+3

Cx41-5R1 CAGTCTCCCATGGTGCTTTGATCTTAG 185-159 5’RA

CE, NcoI

Cx41-OR1 AGCACCATAAGCCAGATCTTCC 260-239 5’RA

CE

Cx41-OR2 CCAGGCTGCTGCTCTGTATTACAAG 353-332 cDN

A synthesis

* Restriction sites are underlined

25


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

A GCTCTCTTAT CACACAGCTC TTGGCACATA CGGAATTTAT ATGGCTTTAC CAGTGAAGAT 60TGGCATTACA ACTAGCTCTA CACACAATTT CTGGGCATGC CAATGCAGGT GGGGTGCCTA 120TAGCTAGAAG ATCTACTTTG ATTATTGCTG GGGGAATACT AAGATCAAAG CACTATGG 174

B

C peptide 1: MALPVKIGITTSSTHNFWACQCRWGAYS 28 aapeptide 2: MPMQVGCL 8 aapeptide 3: MQVGCL 6 aa

Meijer et al, Figure 1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Hedda A. Meijer, Wim J.A.G. Dictus, Eelco D. Keuning and Adri A.M. Thomasopen reading frames

UTR by three upstream′Translational control of the Xenopus laevis Connexin41 5

published online July 13, 2000J. Biol. Chem.

10.1074/jbc.M005531200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M005531200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M005531200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/07/13/jbc.M005531200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2000/07/13/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2000/07/13/jbc.M005531200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

translational control of the xenopus laevis connexin41 5 ... · injection of transcripts into one...

Documents