tumor necrosis factor receptor superfamily member taci is a
TRANSCRIPT
Tumor Necrosis Factor Receptor Superfamily Member TACI is a High
Affinity Receptor for TNF Family Members APRIL and BLyS.
Youmei Wu1, Dana Bressette1, Jeff A. Carrell2 , Thomas Kaufman2, Ping Feng1, Kara
Taylor1, Yuxiang Gan4, Yun Hee Cho4, Andy D.Garcia1, Elisa Gollatz1, Donna Dimke3,
David LaFleur1, Thi Sau Migone2, Bernardetta Nardelli2, Ping Wei1, Steve M. Ruben1,
Stephen J. Ullrich4, Henrik S. Olsen1, Palanisamy Kanakaraj2, Paul A. Moore1, Kevin P.
Baker1*
Running Title: TACI is the receptor for BLyS and APRIL.
1Department of Molecular Biology,
2Department of Cell Biology,
3Department of Gene Discovery,
4Department of Protein Development,
Human Genome Sciences, Inc.
9410 Key West Ave
Rockville, MD 20850
*To whom correspondence should be addressed:
e-mail: [email protected]
Tel: 301-610-5790 ext. 3554
Fax: 301-340-7159
- 1 -
8/18th/00
Copyright 2000 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on August 23, 2000 as Manuscript M005224200 by guest on February 13, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Summary.
An expression cloning approach was employed to identify the receptor for B-
lymphocyte stimulator (BLyS) and identified the TNFR superfamily member TACI as a
BLyS-binding protein. Expression of TACI in HEK293T cells confers on the cells the
ability to bind BLyS with sub-nanomolar affinity. Furthermore, a TACI-Fc fusion protein
recognizes both the cleaved, soluble form of BLyS as well as the membrane BLyS
present on the cell surface of a recombinant cell line. TACI mRNA is found
predominantly in B cells and correlates with BLyS binding in a panel of B-cell lines. We
also demonstrate that TACI interacts with nanomolar affinity with the BLyS-related TNF
homologue APRIL for which no clear in vivo role has been described. BLyS and APRIL
are capable of signaling through TACI to mediate NF-κB responses in HEK293 cells.
We conclude that TACI is a receptor for BLyS and APRIL and discuss the implications
for B-cell biology.
- 2 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
Introduction .
Members of the tumor necrosis factor superfamily of cytokines play diverse roles in the
regulation of cell proliferation, differentiation and survival. Notably, several members of
this family play key roles in the regulation of the immune system (1). We and others
have previously identified a novel TNF-related ligand, BLyS (also known as BAFF,
TALL-1, THANK, TNFSF20 and zTNF4) which is expressed on monocytes and induces
B cell proliferation and immunoglobulin secretion in vitro and in vivo (2-6). Like many
members of the TNF family, BLyS has activity in vitro as a 152-amino-acid soluble
molecule and as a 258-amino-acid transmembrane form (3). However, the biological
significance of these two forms and their relative contributions in vivo remain to be
resolved. More recently, transgenic mice that ectopically overexpress BLyS were shown
to develop autoimmune-like phenotypes reminiscent of those observed in systemic
lupus erythematosus (SLE) (7-9). These findings suggest that BLyS plays an important
role in the regulation of B cell growth and humoral immunity.
In order to understand the precise mechanism by which BLyS activates B-cells, the
range of cell types BLyS may affect, and the potential role of BLyS as a therapeutic
agent or target, we have used expression cloning to identify the receptor for BLyS. We
have identified the orphan receptor TACI (10), previously characterized as being present
on B cells and a subset of T cells, as the receptor for BLyS and show that this receptor is
capable of mediating NF-κB signaling in response to ligand binding. We also show that
TACI interacts with another TNF family member, APRIL, which is closely related to
BLyS. Parallel work by others has recently shown that TACI and a second TNFR family
member, BCMA, are BLyS receptors (9) (11) (12) (13) (14).
Experimental Procedures.
- 3 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
Cell culture and media. HEK293T cells were cultured in Dulbecco’s modified Eagle’s
Medium (DMEM¶ ) containing 10% fetal bovine serum (FBS) and transfected using
Lipofectamine Plus (Life Technologies, Gaithersburg, MD) according to the
manufacturer’s protocol. For expression cloning screens, cells were attached to plates
with poly-D-Lysine.
Flow Cytometry. Cells were stained with monoclonal antibodies raised against BLyS at
the indicated protein concentrations, with biotinylated BLyS as previously described (2),
with recombinant TACI-Fc fusion protein or with recombinant Flag tagged proteins
which were subsequently detected by the M2 anti-Flag monoclonal antibody (Sigma, St.
Louis, MO). Flow cytometry was performed using a FACScan instrument and
associated CellQuest software (Becton Dickinson, San Jose, CA).
Library Preparation, Screening and other DNA Manipulations: All common DNA
manipulations such as restriction, ligation and PCR were as previously described (15).
Human tonsillar B-cell cDNA, size-selected to enrich for potential cDNA clones of > 1.5
Kb, was ligated into expression vector pCMV-Sport3 (Life Technologies) to generate a
library of approximately 5 million independent clones. To facilitate library screening,
wells containing 150 clones in a 96-well format were generated, and plasmid DNA was
purified from these using the Qiagen biorobot 9600 (Qiagen, Valencia CA). Pools of
approximately 1200 cDNAs (8 wells) were used to transfect HEK293 cells. At 40-48
hours post transfection, cells were washed once with PBS and incubated for 2 hours at
37 °C with 300 pM I-125-radiolabeled BLyS (17-35 µCi/µg) in binding buffer (DMEM,
10% FBS, 25 mM HEPES pH 7.4). Subsequently, cells were washed three times with
PBS, and fixed with glutaraldehyde (2.5% v/v). The bottoms of the plates were removed
as previously described (16) and subjected to autoradiography. Pools that bound
- 4 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
radiolabeled BLyS were subsequently partitioned into the individual eight wells of 150
clones that composed the initial positive pool and used for transfection. 600 clones from
positive wells of 150 clones were end-sequenced. Full length TACI was generated by a
2-step PCR reaction using the primers
ATGAGTGGCCTGGGCCGGAGCAGGCGAGGTGGCCGGAGCCGTGTGGACCAGG and
AAGCTTAGATCTGCCACCATGAGTGGCCTGGGCCGGAGC sequentially at the 5’ end together with the
reverse primer GAATTCTCTAGACCCCCATTTATGCACCTGG. The PCR product was cut with BglII
and XbaI and subcloned to the CMV-based expression vector pC4 (Human Genome
Sciences, Inc.) Full length TACI-Fc construction was created by 2-step PCR using the
following 5’ primers to sequentially add on the signal sequence of MPIF:
CCCTCTCCTGCCTCATGCTTGTTACTGCCCTTGGATCTCAGGCCATGAGTGGCCTGGGCCGGAGCAGG and
GAATTCAGATCTGCCACCATGAAGGTCTCCGTGGCTGCCCTCTCCTGCCTCATGCTTGTTACTGCC and
the 3’ primer AAGCTTTCTAGACTGATCTGCACTCAGCTTCAGCCC. Truncated TACI(M31-
Q159)-Fc was generated similarly but using the 5’ primer
CTGCCTCATGCTTGTTACTGCCCTTGGATCTCAGGCCATG AGATCCTGCCCCGAAGAGCAG to fuse the 3’ region
of the MPIF signal sequence to TACI. The PCR products were cut with Bgl II and Xba I
and ligated into BamHI-Xba I linearized expression vector pC4-Fc (Human Genome
Sciences Inc). Full-length BLyS cDNA was subcloned into the pCDNA3.0 vector
(Invitrogen, Carlsbad, CA) and transfected into HEK293F cells (Life Technologies) using
Lipofectamine Plus. Stable transfectants were selected that were resistant to genticin
and clones that demonstrated cell surface binding to BLyS antibodies by FACS were
used for further study. RANK (17) was also amplified by PCR and subcloned into vector
pC4. All constructs were confirmed by DNA sequencing. To monitor NF-κB activation, a
reporter plasmid that contains 4 tandem repeats of a consensus NF-κB binding site
(GGGACTTTCCC) upstream of the pro-SEAP reporter plasmid (Clontech, Palo Alto,
- 5 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
CA) was employed. HEK 293T (1 x 105 cells) were transiently co-transfected with the
reporter plasmid (0.5 µg/ml) together with the indicated amounts of either expression
vector alone or the expression vector containing TACI. Ligand was provided either by
the addition of recombinant protein or by cotransfection of expression plasmids for
soluble BLyS or soluble APRIL. In all cases the total plasmid DNA concentration was
adjusted to 2 µg/ml with empty vector and transfections performed in duplicate At 18 hrs
post-transfection, supernatants were collected and SEAP levels determined following
manufacturer’s recommendations (Roche Bioscience, Indianopolis, IN ) and counted in a
Dynax luminometer.
TaqMan Analysis: TACI messenger RNA levels were determined by real time
quantitative PCR using an ABI 7700 Taqman sequence detector. Amplification primers
and probe were designed to span the region from nucleotide 308 to nucleotide 392 of
the human TACI mRNA (Genbank accession # AF023614). Total RNA was prepared
from B cells, primary haematopoietic cells and B cell lines and mRNA detected by a one
step RT-PCR procedure. For quantitation of TACI mRNA the comparative delta Ct
method was used (Perkin-Elmer user bulletin #2, 1997) using a 18S ribosomal RNA
probe as endogenous reference. Expression levels are shown relative to expression
levels in B cells.
Protein Purification: BLyS was purified as previously described (2). APRIL was purified
by capture on cation exchange resin (HS-50 Poros) and the trimeric form of APRIL
isolated by size exclusion chromatography. Full length TACI(M1-Q159)-Fc or truncated
TACI(M31-Q159)-Fc were purified from transiently transfected culture supernatants by
capture on Protein A HyperD resin (Life Technologies) and eluted with 0.1 M citrate
buffer, pH 3.5. To further enrich for the dimeric TACI-Fc fusion protein the pool was
subject to size-exclusion chromatography on a Superdex S200 column (Amersham-
- 6 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
Pharmacia, Piscataway, NJ). Proteins were subjected to N-terminal sequence analysis
to verify their N-terminal sequence using a model ABI-494 sequencer (Perkin-Elmer-
Applied Biosystems, Inc., Foster City, CA). Immunoprecipitations were carried out using
the M2 anti-Flag peptide antibody (Sigma). Western blots were decorated with the M1
anti-Flag peptide antibody (Sigma) and detected using an anti-mouse IgG alkaline
phosphatase conjugate (Promega, Madison, WI).
BIAcore analysis: Ligand binding to TACI-Fc was also analyzed by BIAcore analysis.
TACI-Fc was covalently immobilized to the BIAcore sensor chip (CM5 chip) via amine
groups using N-ethyl-N’-(dimethylaminopropyl)carbodiimide/N- hydroxysuccinimide
chemistry. A total volume of 50 µl of various dilutions of BLyS or APRIL were allowed
to flow over the receptor-derivatized flow cells at 15 µl/min. The amount of bound
protein was determined during washing of the flow cell with HBS buffer (10 mM
HEPES, pH 7.4, 150 mM NaCl, 3.4 mM EDTA, 0.005% Surfactant P20). Binding
specificity of BLyS or APRIL to TACI was determined by competition with soluble
competitor in the presence of 5 µg/ml BLyS or APRIL. The flow cell surface was
regenerated by displacing bound protein by washing with 20 µl of 10 mM glycine-HCl,
pH 2.3. For kinetic analysis, the flowcells were tested at different flow rates, and the on-
and off- rates were determined using the kinetic evaluation program in BIAevaluation 3
software, using a 1:1 binding model and the global analysis method.
Preparation of radiolabeled BlyS and binding assays: Radioiodination of BLyS was
performed using the Iodobead method. Briefly, one Iodobead (Pierce, Rockford, IL) per
reaction was pre-washed with PBS and added to 1 mCi of NaI125 in 80 µl of PBS pH
6.5. The reaction was allowed to proceed for 5 minutes and then10 µg of BLyS was
- 7 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
added and incubated for 5 minutes at room temperature. Iodinated protein was
separated from unbound radioactivity using a G-25 Sephadex quick-spin column
previously equilibrated with PBS containing 0.1% BSA. Protein concentration and
specific radioactivity of I125-BLyS were determined by TCA precipitation of pre-column
and post-column samples. The specific activity of I125-labeled BlyS used in the
experiment was 17-35 µCi/µg. Binding of I125-labeled BLyS to TACI was performed
with 1x106 vector alone or with TACI-transfected HEK293T cells in 100 µl of binding
buffer containing 0.3 nM I125-BLyS (specific activity 34.6 µCi/µg), in the absence or
presence of increasing concentrations of unlabeled BLyS. The incubation was allowed
to proceed for 2 hr at room temperature. The cell-bound BlyS was separated from
unbound free I125-BlyS by centrifugation through 200 µl of 1,5-dibutylphthlate/1.0 bis
(2-ethyl-hexyl) phthalate oil mixture in polyethylene microfuge tubes (Bio-Rad,
Hercules, CA) for 20 sec at 12,000 RPM. The tubes were frozen quickly in liquid
nitrogen and the bottoms of the tubes were cut off using a tube cutter. Radioactivity in
the bottoms of the tubes containing the cell pellet (bound) and in the top (unbound) was
determined with a gamma counter. The saturation binding analysis was performed
under similar conditions using varying concentrations of I125-labeled BLyS (0.01 to 9
nM) in the absence or presence of 100-fold excess of unlabeled BLyS. The data was
analyzed by Prizm software (GraphPad Software, San Diego, CA) to determine
dissociation constant (Kd) and number of binding sites.
Results.
To identify the BLyS receptor, we developed an expression cloning system using
biologically active, radioiodinated BLyS. The labeled BLyS was used to screen an
- 8 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
expression library that was generated from human tonsillar B cells previously
demonstrated to bind BLyS and proliferate in response to costimulation with BLyS and
SAC. Library pools of approximately 1200 cDNAs were screened. One pool from 96
screened resulted in reproducible binding of radiolabeled BLyS above background
levels. This pool was partitioned into sub-pools of 150 clones and a positive sub-pool
identified. Clones from a positive sub-pool of 150 clones were subject to end-
sequencing using the HGS high-capacity sequencing facility, and sequences screened
for homology to known TNFRs using a Hidden Markow model based on the cysteine-
rich motif present in this family (18). This approach identified one clone that contained
such a motif. DNA from this single clone was transfected into HEK293T cells and
resulted in specific binding of BLyS to the cells that was competed with excess cold
ligand (not shown). The insert of the positive clone was sequenced in full to reveal the
presence of a 263-amino-acid open reading frame which, when compared to known
TNFRs, identified this clone as an amino terminal truncation of the previously
characterized TNFR superfamily member TACI (10). Translation of the TACI protein
from the isolated clone must initiate at a downstream ATG (Met-31 in the previously
published sequence) to encode a protein which was still capable of being transported to
the cell surface and binding ligand. The clone contains both of the cysteine-rich
domains which are important for TNF-ligand binding (19). We created a full-length
TACI clone by PCR and used this for further analysis.
BLyS binds TACI with high affinity.
In order to show that the BLyS-TACI interaction is physiologically relevant we
determined the specificity and affinity of BLyS binding to TACI. Saturation binding
analysis was performed using various concentrations of I125 labeled BLyS on HEK293T
cells that had been transfected with full-length TACI. Analysis of binding data revealed
- 9 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
that BLyS binds to TACI with high affinity with a Kd of 0.1- 0.3 nM (Figure 1a). This is
similar to the affinity of BLyS for its receptor on tonsillar B cells and other B-cell lines
(20). The affinity of the truncated TACI was 5-10 lower when compared to the full length
protein as determined by competitive binding assays using various concentrations of
unlabeled BLyS (Figure 1b)
(Figure 1)
TACI mediates binding to soluble and membrane BLyS.
We confirmed binding of BLyS to HEK293 transfected with TACI by FACS" analysis
using biotinylated BLyS; transient transfection of TACI results in a population of cells
which bind BLyS in contrast to vector-transfected HEK293 cells. (Figure 2a). The
TNFrelated ligand LIGHT/HVEM-L (21,22) failed to bind to the TACI transfected cells
(Figure 2c). To further explore the TACI-BLyS interaction we created a TACI-Fc fusion
protein in which the extracellular domain of TACI is fused to the Fc domain of human
IgG1. This fusion protein was used to effectively compete for soluble biotinylated BLyS
binding to the B-cell derived line IM-9 (Figure 3). Because TACI-transfected cells bind
soluble biotinylated and radiolabeled BLyS and TACI-Fc competes with IM-9 cells for
binding of soluble BLyS, we conclude that TACI is able to interact with the soluble form
of BLyS.
(Figure 2, Figure 3)
To determine if TACI is capable of binding membrane-bound BLyS, a recombinant cell
line that expresses cell surface BLyS was generated. HEK293F cells were stably
transfected with BLyS and demonstrated to express cell-surface BLyS by FACS
analysis using a monoclonal antibody derived against BLyS (Fig 4a-d). These cells
were then tested for their ability to bind TACI-Fc protein using FACS analysis. As
demonstrated in Figure 4, TACI-Fc specifically binds the HEK293-BLyS stable cell line,
- 10 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
but not a HEK293-vector cell line. Furthermore, the binding of the HEK293-BLyS cells
is inhibited by the addition of soluble BLyS into the binding reaction (not shown). We
conclude that TACI is able to bind membrane-bound BLyS.
(Figure 4)
Binding specificity.
TACI-Fc fusion protein was employed to assess the specificity of the interaction
between TACI, BLyS and other members of the TNF ligand family. We used a panel of
4 conditioned media containing Flag-epitope tagged proteins, APRIL (23), LIGHT (21),
FasL (24) and BLyS, to assess interaction specificity. To evaluate the level of Flag-
tagged protein present in the conditioned media, we used anti-Flag antibodies to
immunoprecipitate the tagged proteins (Figure 5a). An equivalent aliquot of the
conditioned media was also subject to immunoprecipitation with TACI-Fc (Figure 5b) or
with beads alone (not shown). Immunoprecipitates were detected by Western analysis
using anti-Flag antibody. We find that TACI-Fc effectively immunoprecipitates all of the
Flag-BLyS present in the conditioned medium (Figure 5a and b, Lane 3) but does not
precipitate either LIGHT or FasL. We also find that TACI-Fc immunoprecipitates
approximately 20% of the APRIL present in the conditioned medium, suggesting that
TACI-Fc interacts with APRIL (Figure 5b, Lane 1). Interaction between APRIL and
TACI-Fc has also been observed with BIAcore analysis (next section).
(Figure 5)
BIAcore Analysis
We assessed the ability of TACI-Fc to bind BLyS by BIAcore analysis. TACI-Fc was
bound to a BIAcore chip and different concentrations of human BLyS were allowed to
flow over the cell. There was significant binding to the flow cell of ~1000 and 600 RU at
5 and 2.5 µg/ml BLyS, respectively. This binding was specific because BLyS binding to
- 11 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
TACI-Fc was competed with increasing concentrations of soluble TACI-Fc (data not
shown). Based on the immunoprecipitation data, we also tested the TNF-related ligand,
APRIL, for binding to TACI-Fc in BIAcore. APRIL was also found to bind to the TACI-
Fc chip and this interaction was also shown to be specific (data not shown). The Kd for
binding to BLyS and APRIL were determined by analysis of the binding of different
concentrations of ligand using the BIAcore biosensor instrument (Figure 6). The
interaction between TACI and APRIL was weaker than that observed for TACI and
BLyS; representative sensorgrams for the binding of BLyS and APRIL to TACI-Fc are
shown in Figures 6a and 6b, respectively. The association constant, ka, for binding was
6.45 x107 and 9.22 x105, for BLyS and APRIL, respectively. The dissociation rate, kd,
for TACI binding was 1.04 x10-2 and 5.89 x10-3 for BLyS and APRIL, respectively.
Thus, the on-rate is faster for BLyS compared to APRIL, whereas, the off-rate for BLyS
is faster than that of APRIL. The calculated Kd values for the binding of APRIL and
BLyS to TACI-Fc were 6.4 and 0.16 nM, respectively. Overall BLyS has a ~25-fold
higher binding constant than APRIL.
(Figure 6)
In order to show that the interaction of TACI with APRIL was not an artifactual result of
using a TACI-Fc fusion protein, we determined if TACI present on the surface of cells
could bind APRIL. We find that TACI transfected cells are capable of binding Flag-
tagged-APRIL or BLyS but not Flag tagged Fas ligand (Figure 7a-f). We also find that
APRIL competes for radiolabeled BLyS binding to TACI transfected cells (Figure 7g). In
agreement with the BIAcore analysis, the relative affinity of TACI for APRIL was again
found to be some 10-20 fold lower than for BLyS. We also observe interaction of TACI-
Fc with membrane bound APRIL on cells transiently transfected with a full length APRIL
- 12 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
construct (not shown).
(Figure 7)
TACI Expression Correlates with BLyS Binding Capacity.
TACI was previously characterized as being present on B-cells and a subset of
activated T cells (10). We extended this analysis initially by Northern analysis on a
series of tissues. In agreement with previous observations, we find that TACI is
expressed primarily in immune tissues with weaker signals present in gastrointestinal
tissues. Notably, the highest message is present in the B-cell lymphoma cell line RAJI
(not shown). We have also refined this analysis by studying TACI mRNA expression
using quantitative, real-time PCR (Taqman). In agreement with the above findings, we
show that TACI is predominantly expressed on B cells and B-cell lines; there is a much
weaker signal present in cells of the monocytic and T-cell lineage. Furthermore, the
weak expression of TACI in T cells and dendritic cells is unaltered by known stimulators
of the immune system (Figure 8a). We and others (2,3) have previously defined the
functional presence of BLyS receptor on different cell types and show that among B-cell
lines Daudi cells do not effectively bind BLyS. We, therefore, measured TACI
expression among different B-cell lines using Taqman analysis and asked if TACI
expression correlates with BLyS binding. We find that among B-cell lines Daudi has
little or no TACI mRNA expression, while other B-cell lines have good TACI expression
(Figure 8b). Thus TACI expression among B-cell lines correlates with BLyS binding
capacity.
Previous work has suggested that TACI is present on the surface of activated T cells.
As we show here that TACI functions as a BLyS receptor we analyzed the capacity of T
cells activated by ionomycin and PMA to bind biotinylated BLyS. We find that activated
T cells only weakly bind biotinylated BLyS (not shown).
- 13 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
(Figure 8)
TACI Mediates signal transduction in HEK293 cells.
It has previously been demonstrated that several TNF receptor family members mediate
NF-κB signaling, and that when overexpressed the receptors activate the NF-κB
pathway independent of ligand binding (25). To determine if TACI is capable of
activating the NF-κB pathway in HEK293 cells, TACI was transiently overexpressed in
this cell type together with an NF-κB-SEAP reporter plasmid. As demonstrated in
Figure 9, TACI alone is capable of activating the NF↑κB signaling pathway. The NF-κB
response is dependent upon the amount of TACI transfected into the cells. We also
show that addition of BLyS or APRIL into this system by cotransfection of a ligand
expression plasmid results in significantly increased stimulation of the NF-κB reporter
(Figure 9). This demonstrates that both BLyS and APRIL can associate with, and direct
TACI mediated signaling.
(Figure 9)
Discussion
Using an expression cloning protocol we have identified the previously described TNFR
family member TACI as a BLyS-binding protein that is present predominantly on B cells.
We present several lines of evidence to suggest that TACI is the BLyS receptor;
however, the high affinity of the interaction between BLyS and TACI (Kd of 0.1 nM),
which is typical of physiological receptor-ligand interactions, is probably the most
compelling. Additionally, there is good concordance between the TACI expression
profile and the BLyS-binding potential of cells. Notably, among different B-cell lines,
Daudi cells (which do not bind BLyS) do not express TACI. Significantly, we show that
TACI is able to interact with both soluble BLyS and the membrane-bound form of BLyS
present on a recombinant cell line, an observation that suggests that TACI is able to
- 14 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
mediate signal transduction of both forms of BLyS to B cells. Previous work has shown
that BLyS present on the surface of cells is competent to act as a co-stimulator of B
cells (3); we show here that this activity is probably mediated, at least in part, by TACI.
In parallel work, others have recently shown that TACI as well as another TNFR family
member, BCMA, (26) act as BLyS-binding proteins (9) (11) (12) (13) (14). Importantly,
we show here that the interaction between TACI and BLyS is not exclusive and that
TACI is capable of interacting with the TNF-related ligand APRIL, as judged by four
independent in vitro methods. The interaction between TACI and APRIL was found to
be some 10-20-fold lower in affinity than that seen for the BLyS –TACI interaction.
However, the affinity was still in the nanomolar range (6 nM) and is similar to affinities
of other receptor-ligand interactions in the TNF/TNFR superfamily. The interaction of a
TNFR superfamily member with multiple TNF-like ligands is not unprecedented; the
receptor HVEM was shown to interact with the ligands LIGHT and Lymphotoxin-α (21).
The in vivo role of APRIL remains elusive; a role as a growth promoting factor has been
shown, and a role in tumor cell growth has been suggested (23), while other work has
suggested a role in apoptosis (27). However, the expression of APRIL in peripheral
blood lymphocytes (23), monocytes and macrophages (TALL-2; (4)) and its interaction
with TACI demonstrated here, make a role in regulation of immune function seem likely.
It has been suggested that TACI, as soluble receptor, may prove useful as a
therapeutic agent to antagonize the function of BLyS in autoimmune diseases such as
SLE (28). Indeed, it has been shown that administration of TACI-Fc soluble receptor
results in reduction of proteinuria and prolongation of lifespan in an animal model of SLE
(9) or inhibition of primary immune responses and germinal center disruption in normal
mice (13) (11). The interaction between APRIL and TACI demonstrated here has
- 15 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
implications for any potential therapeutic utilitiy based on soluble TACI receptor. Since
we show that TACI is not specific for BLyS but also binds with high affinity to APRIL,
TACI based therapeutics will almost certainly also antagonize the function of APRIL.
The outcomes of the previous in vivo studies with TACI-Fc could be the result of TACI-
Fc blocking APRIL mediated B cell effects, or BLyS and APRIL mediated effects, rather
than simply BLyS mediated effects. While this manuscript was in revision, parallel work
was published by others that also demonstrates interaction of TACI and APRIL (29);
furthermore this paper also demonstrates the interaction between APRIL and the
alternate BLyS receptor BCMA. Clearly, further work will be required to unravel the
relative contributions of BLyS, APRIL, TACI and BCMA interactions in B-cell regulation.
We show here that TACI mRNA expression profile is predominantly B-cell specific. In
contrast, TACI was initially characterized as being present in B cells and activated T
cells (10). Other cells, such as dendritic cells and monocytes, have much lower levels of
TACI. Furthermore, TACI expression is not inducible in these cells by proinflammatory
agents, such as interferon gamma and IL-10. In agreement with the previous report on
TACI, we observe weak expression of TACI on T cells. However, at the mRNA level this
expression is at least an order of magnitude lower than that seen on B cells. In
agreement with these findings, we are able to observe weak binding of BLyS to a
purified population of stimulated T cells. This binding, however, is less than 5% of the
binding observed on B-cells (not shown). Thus if BLyS plays a role in T-cell regulation
as suggested by others (5), it seems unlikely that this role will be a major one. However,
we cannot exclude that under normal physiological conditions the interaction of BLyS
with T cells is required for some form of cross-talk between these two compartments of
the immune system.
The clone we originally isolated as the BLyS-binding protein represented an amino-
- 16 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
terminal truncation of the published TACI sequence. Since TACI is a Type 3
transmembrane protein, it contains no amino-terminal signal sequence; an amino
terminal truncation will not, therefore, interfere with the topological signals present in the
internal signal anchor, and the protein will be transported to the cell surface.
Surprisingly, this truncated version of TACI is biologically active and has an affinity
which is only 5-fold lower than compared to full length TACI. This bioactive deletion
may prove useful in delineating structure-function relationships between TACI and
BLyS or APRIL binding. It may also represent some fraction of the naturally translated
protein that is found in vivo.
TACI was initially identified as an orphan receptor in a two-hybrid screen using the
signal transduction component CAML as bait and was shown to mediate activation of
NFκB, NFAT and AP-1 in the Jurkat T-cell line (10). We confirm here that TACI is capable
of activating the NF-κB pathway in HEK293 cells. At the highest levels of TACI
transfected, the level of NF-κB activation by TACI is comparable to levels observed with
RANK (not shown) (17,30), a TNF receptor family member known to activate NF-κB
suggesting that TACI is a strong activator of the NF-κB pathway. Furthermore, this
stimulation is augmented by the addition of either BLyS or APRIL. Recent analysis of
the TACI intracellular domain has identified TRAF2, TRAF5 and TRAF6 specifically
interacting with regions of TACI in a yeast 2-hybrid system and in unstimulated HEK293
cells expressing epitope tagged components (11). Further work will be required in order
to delineate which TRAFs are specifically recruited to TACI following ligand stimulation.
Acknowledgements.
We wish to thank Drs. Jian Ni and Yangu Shi for the Flag tagged-TNF ligand expression
- 17 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
constructs. Roberto Patarca and Tim Beardsley are thanked for critical reading of the
manuscript.
- 18 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
References.
1. Wallach, D., Bigda, J., and Engelmann, H. (1999) in The cytokine network and
immune functions (Theze, J., ed), pp. 51-84, Oxford University Press, Oxford
2. Moore, P. A., Belvedere, O., Orr, A., Pieri, K., LaFleur, D. W., Feng, P., Soppet,
D., Charters, M., Gentz, R., Parmelee, D., Li, Y., Galperina, O., Giri, J., Roschke, V.,
Nardelli, B., Carrell, J., Sosnovtseva, S., Greenfield, W., Ruben, S. M., Olsen, H. S.,
Fikes, J., and Hilbert, D. M. (1999) Science 285, 260-3
3. Schneider, P., MacKay, F., Steiner, V., Hofmann, K., Bodmer, J. L., Holler, N.,
Ambrose, C., Lawton, P., Bixler, S., Acha-Orbea, H., Valmori, D., Romero, P., Werner-
Favre, C., RH, Z., Browning, J. L., and Tschopp, J. (1999) J. Exp. Med. 189, 1747-56
4. Shu, H. B., Hu, W. H., and Johnson, H. (1999) J. Leukoc. Biol. 65, 680-683
5. Tribouley, C., Wallroth, M., Chan, V., Paliard, X., Fang, E., Lamson, G., Pot, D.,
Escobedo, J., and Williams, L. T. (1999) J. Biol Chem 380, 1443-7
6. Mukhopadhyay, A., Ni, J., Zhai, Y., Yu, G.-L., and Aggarwal, B. B. (1999) J. Biol.
Chem. 274, 15978-15981
7. Khare, S. D., Sarosi, I., Xia, X. Z., McCabe, S., Miner, K., Solovyev, I., Hawkins,
N., Kelley, M., Chang, D., Van, G., Ross, L., Delaney, J., Wang, L., Lacey, D., Boyle, W.
J., and Hsu, H. (2000) Proc. Natl. Acad. Sci. USA 97, 3370-3375
8. Mackay, F., Woodcock, S. A., Lawton, P., Ambrose, C., Baetscher, M.,
Schneider, P., Tschopp, J., and Browning, J. L. (1999) J. Exp. Med. 190, 1697-1710
9. Gross, J. A., Johnston, J., Mudri, S., Enselman, R., Dillon, S. R., Madden, K., Xu,
W., Parrish-Novack, J., Foster, D., Lofton-Day, C., Moore, M., Littau, A., Grossman, A.,
Haugen, H., Foley, K., Blumberg, H., Harrison, K., Kindsvogel, W., and Clegg, C. H.
(2000) Nature 404, 995-999
10. von Bulow, G.-U., and Bram, R. J. (1997) Science 278, 138-141
- 19 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
11. Xia, X.-Z., Treanor, J., Senaldi, G., Khare, S. D., Boone, T., Kelley, M., Theill, L.
E., Colombero, A., Solovyev, I., Lee, F., McCabe, S., Elliott, R., Miner, K., Hawkins, N.,
Guo, J., Stolina, M., Yu, G., Wang, J., Delany, J., Meng, S.-Y., Boyle, W. J., and Hsu, H.
(2000) J. Exp. Med. 192, 137-143
12. Thompson, J. S., Schneider, P., Kalled, S. L., Wang, L., A., L. E., Cachero, T. G.,
MacKay, F., Bixler, S. A., Zafari, M., Liu, Z.-Y., Woodcock, S. A., Qian, F., Batten, M.,
Madry, C., Richard, Y., Benjamin, C. D., Browning, J. L., Tsapis, A., Tschopp, J., and
Ambrose, C. (2000) J. Exp. Med. 192, 129-135
13. Yan, M., Marsters, S. A., Grewal, I. S., Wang, H., Ashkenazi, A., and Dixit, V. M.
(2000) Nature Immunology 1, 37-41
14. Shu, H.-B., and Johnson, H. (2000) Proc. Natl. Acad. Sci. USA 97, 9156-9161
15. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: a
laboratory manual., Cold Spring Harbor Press, Cold Spring Harbor, NY
16. Pacholczyk, T., Blakely, R. D., and Amara, S. G. (1990) Biotechniques 5, 556-
558
17. Anderson, D. M., Marakovsky, E., Billingsley, W. L., Dougall, W. C., Tometsko,
M. E., Roux, E. R., Teepe, M. C., DuBose, R. F., Cosman, D., and Galibert, L. (1997)
Nature 390, 175-179
18. Bateman, A., Birney, E., Durbin, R., Eddy, S. R., Howe, K. L., and Sonnhammer,
E. L. L. (2000) Nucl. Acid. Res. 28, 263-266
19. Ware, C. F., Santee, S., and Glass, A. (1998) in The cytokine handbook.
(Thomson, A., ed), 3 Ed., pp. 549-592, Academic Press, London
20. Kanakaraj, P., Migone, T.-S., Nardelli, B., Ullrich, S., Li, Y., Olsen, H. S.,
Salcedo, T. W., Kaufman, T., Cochrane, E., Gan, Y., Hilbert, D. M., and Giri, J. (2000)
Cytokine In press,
- 20 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
21. Mauri, D. N., R., E., Montgomery, R. I., Kochel, K. D., Cheung, T. C., Yu, G.-L.,
Ruben, S., Murphy, M., Eisenberg, R. J., Cohen, G. H., Spear, P. G., and Ware, C. F.
(1998) Immunity 8, 21-30
22. Harrop, J. A., McDonnell, P. C., Brigham-Burke, M., Lyn, S. D., Minton, J., Tan,
K. B., Dede, K., Spampanato, J., Silverman, C., Hensley, P., DiPrinzio, R., Emery, J. G.,
Deen, K., Eichman, C., Chabot-Fletcher, M., Truneh, A., and Young, P. R. (1998) J.
Biol. Chem. 273, 27548-27556
23. Hahne, M., Kataoka, T., Schroter, M., Hofmann, K., Irmler, M., Bodmer, J.-L.,
Schneider, P., Bornard, T., Holler, N., French, L. E., Sordat, B., Rimoldi, D., and
Tschopp, J. (1998) J. Exp. Med. 188, 1185-1190
24. Suda, T., Takahashi, T., Golstein, P., and Nagata, S. (1993) Cell 75, 1169-1178
25. Ashkenazi, A., and Dixit, V. M. (1998) Science 281, 1305-1308
26. Madry, C., Laabi, Y., Callebaut, I., Roussel, J., Hatzoglou, A., Le Coniat, M.,
Mornon, J.-P., Berger, R., and Tsapis, A. (1998) Int. Immunol. 10, 1693-1702
27. Kelly, K., Manos, E., Jensen, G., Nadauld, L., and Jones, D. A. (2000) Cancer
Res. 60, 1021-1027
28. Ware, C. F. (2000) Nature 404, 949-950
29. Marsters, S. A., Yan, M., Pitti, R. M., Haas, P. E., Dixit, V. M., and Ashkenazi, A.
(2000) Curr. Biol 10, 785-788
30. Darnay, B. G., Haridas, V., Ni, J., Moore, P. A., and Aggarwal, B. B. (1998) J.
Biol. Chem. 273, 20551-20555
31. Pan, G., Bauer, J. H., Haridas, V., Wang, S., Liu, D., Yu, G., Vincenz, C.,
Aggarwal, B. B., Ni, J., and Dixit, V. M. (1998) FEBS Lett. 431, 351-356
- 21 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
Footnotes.
¶ The abbreviations used are DMEM, Dulbeccos modified Eagle medium; FBS, fetal
bovine serum; NFAT, nuclear factor of activated T cells; NF-κB, nuclear factor kappa B;
SAC, Staphylococcus aureus Cowan preparation; SEAP, secreted alkaline phosphatase;
SLE, systemic lupus erythematosus; TACI, transmembrane activator and CAML
interacting protein; TNF, tumor necrosis factor superfamily member; TNFR tumor
necrosis factor receptor superfamily member
Figure Legends.
Figure 1. Affinity determination of the TACI-BLyS interaction.
A. Saturation binding analysis was performed using various concentrations of
radiolabeled BLyS on TACI transfected cells as described in materials and methods.
Specific binding is shown. The insert also shows the data plotted in Scatchard format.
B. TACI-transfected cells were used for binding analysis using 0.3 nM radioiodinated
BLyS and increasing concentrations of cold competitor. Either full length TACI (open
squares) or truncated TACI (filled triangle) was used for transfection.
Figure 2. TACI interacts with soluble BLyS.
Cells were transfected with TACI (A, C, E) or empty vector (B, D, F) and 24 hours post
transfection were stained with biotinylated BLyS (A, B) or biotinylated LIGHT (B, D).
Incubation with secondary reagent alone (streptavidin-PE) is also shown (E, F).
Figure 3. TACI-Fc competes for soluble BLyS binding to a B cells The B-cell line IM-
9 was stained with 0.5 µg/ml biotinylated BLyS (A) and detected with streptavidin-PE by
- 22 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
FACS analysis. Increasing concentrations (2.5 µg/ml and 25 µg/ml) of TACI-Fc (C, E)
or an irrelevant DR6-Fc (Death receptor-6 (31); D, F) were added as indicated. No
staining of the IM-9 cells with streptavidin-PE (secondary reagent) alone was observed
Figure 4. TACI interacts with membrane BLyS.
A recombinant cell line HEK293-BLyS that stains with monoclonal antibody I006D08
raised against BLyS were generated (A, C). No staining was observed with the control
cell line HEK293-Vector (B, D). No staining was observed in the absence of primary
antibody (A, B). The cell lines were subsequently tested for the ability to bind TACI-Fc
(H, E) or an irrelevant TNFR-Fc protein (Lymphotoxin-β-Fc; LT-βR-Fc; I, F). Staining
was dependent on the presence of TAC-Fc fusion; no staining was observed in the
absence of fusion protein (J, G).
Figure 5. TACI interacts with BLyS and APRIL.
Conditioned medium from HEK293 cells transiently transfected with FLAG epitope-
tagged versions of-APRIL, LIGHT, BLyS or FasL were immunoprecipitated with anti-
FLAG epitope antibodies (A) or with TACI-Fc fusion protein (B). Immunoprecipitates
were analyzed by SDS-PAGE and Western analysis with anti-FLAG epitope
monoclonal antibody. A cross-reacting band that co-migrates with FasL in all lanes in
panel A is present, however FasL is clearly visible above this. Molecular weights in kDa
are indicated.
Figure 6. TACI interaction by BIAcore analysis.
A. Sensorgram of Binding of BLyS to TACI-Fc. The sensorgram shows the on and off
rate region of the BIAcore sensorgram of a series of different concentrations (range=1.5
- 23 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
-100 nM) of BLyS. Kd value was calculated using the BIAevaluation kinetic software
program.
B. Sensorgram of Binding of APRIL to TACI-Fc. Sensorgram shows the on and off rate
region of the BIAcore sensorgram of a series of different concentrations (range = 1.5 -
196 nM) of APRIL.
Figure 7. Interaction of APRIL with membrane bound TACI.
A. FACS Analysis. Cells were transiently co-transfected with vector (A, C, E) or TACI
(B, D, F), and either Flag-Fas ligand(A, B), Flag-APRIL (C, D,) or Flag-BLyS (E, F)
expression constructs. Twenty four hours post transfection, cells were analyszed by
FACS for binding of the M2 anti-Flag antibody.
H. APRIL competes with BLyS for binding to membrane bound TACI . Cells were
transiently transfected with TACI and 0.3 nM of radiolabeled BLyS bound in the
presence of unlabeled BLyS (filled squares) or APRIL (open circles). The calculated
EC50 values for cold BLyS and APRIL are 0.33 nM and 11.8 nM respectively.
Figure 8. Determination of TACI messenger RNA levels by real time quantitative RT-
PCR.
A. TACI mRNA levels in B cells and primary haematopoietic cell. RNA samples from the
following primary haematopoietic cells were used: B-cells two donors A and B, dendritic
cells, dendritic cell treated with IFN-γ (100 U/ml), dendritic cells treated with IL-10 (100
ng/ml), dendritic cells treated with LPS 100 ng/ml, natural killer cells (NK) , natural killer
cells treated with Il-2 and Il-12 (100 U/ml), monocytes treated with IFN-γ (100 U/ml),
monocytes treated with IL-10 (100 ng/ml), T cells treated with PHA (50 ng/ml), T-cells
treated with PHA and IL-2 (100 U/ml), CD4+ T-cells, Th1 T-cells, Th1 T-cells treated
with mAbCD3, T-cells, T-cells treated with PMA, and Ionomycin ,T cells cord blood, T
- 24 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
cells from cord blood treated with PMA and Ionomycin. Expression levels are shown
relative to mRNA levels in B-cells donor A.
B. TACI mRNA levels in B-cell lines. RNA samples from the following B-cell lines were
analyzed: ARH-77, Daudi, Namalwa, IM-9 , RAJI, REH RPMI-8226. Expression levels
are compared to TACI mRNA levels in B-cells from donor A and B and shown relative to
expression levels in donor A .
Figure 9. TACI mediates signal transduction in HEK293 cells
HEK293 (1 x 105) were transiently transfected with an NF-κB-SEAP reporter plasmid
together with the indicated concentration of TACI expression vector. Expression
plasmids directing expression of soluble BLyS or soluble APRIL were also cotransfected
where indicated at 20 ng/ml. 18 hours post-transfection, supernatants were collected
and alkaline phosphatase levels determined.
- 25 -
8/18th/00
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from
Henrik S. Olsen, Palanisamy Kanakaraj, Paul A. Moore and Kevin P. BakerThi-Sau Migone, Bernardetta Nardelli, Ping Wei, Steve M. Ruben, Stephen J. Ullrich,
Yuxiang Gan, Yun-Hee Cho, Andy D. Garcia, Elisa Gollatz, Donna Dimke, David LaFleur, Youmei Wu, Dana Bressette, Jeff A. Carrell, Thomas Kaufman, Ping Feng, Kara Taylor,
Receptor for TNF Family Members APRIL and BLySTumor Necrosis Factor Receptor Superfamily Member TACI is a High Affinity
published online August 23, 2000J. Biol. Chem.
10.1074/jbc.M005224200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on February 13, 2018http://w
ww
.jbc.org/D
ownloaded from