ELSEVIER Biochimica et Biophysica Acta 1261 (1995) 272-274

Biochi~ic~a e t B i o p h y s i c a A~ta

Short Sequence-Paper

Two transcripts are generated from the Pancreatitis Associated Protein II gene by alternative splicing in the 5' untranslated region

Sophie Vasseur, Jean-Marc Frigerio, Nelson Javier Dusetti, Volker Keim, Jean-Charles Dagorn, Juan Lucio Iovanna * U.315 INSERM, 46 Boulevard de la Gaye, F-13009 Marseille, France

Received 9 December 1994; accepted 19 January 1995

Abstract

We have previously reported the coding sequence of the rat PAP II mRNA. We show in this paper the existence in rat pancreas of two forms of PAP II mRNA with identical coding sequence but a different Y-untranslated region. We demonstrate that this is the result of a differential splicing.

Keywords: Pancreatitis associated protein II; Gene transcript; Differential splicing

The Pancreatitis Associated Proteins (PAPs) constitute a multigenic family of proteins, structurally related to c-type animal lectins, that are overexpressed during the acute phase of pancreatitis [1]. PAP II mRNA is specifically expressed in the pancreas, as judged by Northern blot analysis [2], whereas PAP I and III mRNAs are also constitutively expressed in the intestinal tract [3,4]. The degree of sequence identity between PAP I and PAP III (66%) is greater than between PAP II and PAP III (63%) or PAP I and PAP II (58%) suggesting that among PAPs, PAP I and PAP III are the more closely related. The sequences of the genes encoding PAP I, II and III in rat have been recently determined [2,5,6]. The structure of these genes is highly conserved. All three genes are orga- nized in six exons separated by five introns, and their 5'-flanking region was also conserved. Finally, the three genes are located on chromosome 4q33-34 (Dusetti et al., unpublished results), strongly suggesting that they derived from the same ancestral gene by gene duplication.

In previous reports, we have shown that the PAP II mRNA had a 156 nt 5'-untranslated region [2], whereas this region comprised only 59 and 26 nt for PAP I and III, respectively [5,6]. That significant difference in length was surprising, given the strong conservation of the other parts

* Corresponding author• Fax: +33 91 266219.

0167-4781/95/$09.50 © 1995 Elsevier Science B.V. All rights reserved SSDI 0167-4781(95)00020-8

of the molecules. This led us to investigate further the splicing events by which the 5'-untranslated region of the PAP II mRNA is generated, with the hypothesis that a transcript with shorter 5'-untranslated region might also be present in the tissue.

Two strategies were developed. First, we have utilized a RT-PCR amplification of the 5'-untranslated region of the PAP II transcripts within total pancreatic RNA, followed by the sequencing of the amplified products. Secondly, a primer extension analysis was conducted, using pancreatic RNA as template and a synthetic oligonucleotide as primer. This was done with RNA from normal pancreas and from pancreas from rats with acute pancreatitis, to control the possible influence of the disease on PAP II mRNA expres- sion.

RT-PCR approach. Rat pancreatic RNA was obtained from control animals or rats with experimental acute pan- creatitis, as already described [7]. Kidney and liver RNA were used as control. 10 /~g of RNA was reverse-tran- scribed utilizing the reagents supplied with a commercial cDNA synthesis kit (Boehringer-Mannheim), following the manufacturer's instructions. The reaction mixture was heated at 70°C for 10 min and phenol/chloroform ex- tracted; cDNA was purified on a BioGel P-30 column as previously described [5]. PAP II transcripts were specifi- cally ampli f ied with sense ( 5 ' - A T C C C A G A T - CACTGCAAGGC-3') and antisense (5'-AAGGTCTCT-

S. Vasseur et al. / Biochimica et Biophysica Acta 1261 (1995) 272-274 273

M A B C D M

Fig. 1. RT-PCR analysis of PAP II mRNA in rat tissues. Amplified PCR products were obtained using PAP lI-specific primers and cDNA tem- plate reverse-transcribed from RNA of various tissues. Line M represent DNA molecular size markers. Lanes A to D show amplifications with cDNA from normal pancreas, pancreas with acute pancreatitis, kidney and liver.

TCTGGCAGGCC-3') primers, in positions 1 to 20 and 351 to 370 of the reported PAP II mRNA, respectively [2]. PCR was carried out in a Crocodile II DNA thermal cycler (Appligene) for 30 cycles. Each cycle was carried out for 10 s at 94°C (denaturation), 2 rain at 60°C (annealing) and 2 min at 74°C (extension). The PCR products were ana- lyzed on 1.5% agarose gel (Fig. 1). Two amplified prod- ucts were obtained in normal pancreas and pancreas with acute pancreatitis as well, one of 370 bp, as expected, and another of 241 bp. The amplified products were eluted from gel slices, blunt-ended with T4 DNA polymerase and subcloned into pCR-Script TM SK(+) cloning vector

(Stratagene). Nucleotide sequence was determined by the dideoxy chain termination method with Sequenase 2.0 according to the manufacturer's specifications (United States Biochemical) and the universal primer. Sequences of both amplified products are given on Fig. 2. They show that two PAP II transcripts, differing in their 5'-untrans- lated regions, are indeed present in the pancreas. Nu- cleotides 23 to 151 of the larger transcript are missing from the smaller one.

Primer extension analysis. A synthetic oligonucleotide (5'-TTGTTGAAGGACAGACGAGGCAGC-3') was 5'-end labeled as previously described [5]. Hybridization of the primer with 10 /xg of the total RNA was performed in 30 /zl of formamide buffer (40 mM Pipes, 1 mM EDTA, 400 mM NaC1, and 80% deionized formamide, pH 6.4) at room temperature for 16 h. The heteroduplex was precipitated and dissolved in 18 /xl of 50 mM Tris-HCl, pH 8.2, containing 40 units of placental RNase inhibitor and 2 mM deoxynucleotide triphosphate, cDNA was synthesized from the primer by the addition of 50 units of avian myeloblas- tosis virus reverse transcriptase over 60 min at 42°C. The product was analyzed on a 6% polyacrylamide-8 M urea gel along with appropriate dideoxy sequencing samples as size markers. Fig. 3 shows two major products extending to 52 and 53 nt, and a minor product extending to 182 nt. This result suggests the presence of two different transcrip- tional initiation sites for the smaller form of the PAP II and only one for the longer form. In previous works [2] we had determined the transcriptional initiation site of the longer form, but failed to characterize the short PAP II mRNA because of its small size.

These findings show that maturation of PAP II mRNA involves alternative splicing in its 5' non translated region.

A

B

atccca~atcact~caagqcagaccttagcaaagcagagatggggctaagaetagtgtatcc I ctgaagacctaggcaaag~gagagagggccctcgtttgcttgttctcgttgactacactctcl tgtgccctgtttgctgcttccttgaagacaagATGCTGCCTCGTCTGTCCTTCAACAATGTG~ TCCTGGACGCTGCTCTACTACCTGTTCATATTTCAGGTACGAGGTG/LAGACTCCCAGAAGGCI AGTGCCCTCTACACGAACCAGCTGCCCCATGGGCTCCAAGGCTTATCGTTCTTACTGCTATA I CCTTGGTCACGACACTCAAATCCTGGTTTCAAGCAGATCTG~ CCTGCCAGAAGAGACCTT I

| I | TTCCTTCCAG~ TTCCTTC~__

a b Splicing sites

II ! " - - - / /

Fig. 2. Nucleotide sequence of clones that define the 5' end of PAP II mRNA and schematic representation of the alternative splicing. (A) As described in the text, two types of 5' sequences were found, defined as long and short forms of PAP II mRNA. Sequence inserted in the long form (nt 23 to 151) is indicated in bold lowercase letters. Capitals indicate coding sequence of PAP II mRNA. The horizontal arrows indicate sequences used as primers for PCR. (B) Exons are indicated by boxes and the introns by horizontal lines. Diagonal lines linking exons indicate splicing patterns. Sequences upstream from both splicing sites (a and b sites) are shown. The acceptor site of splicing (AG) is underlined.

274 S. Vasseur et al. / Biochimica et Biophysica Acta 1261 (1995) 272-274

1 2 TGCA

nt

182 - - I ~

s3:: 52

Fig. 3. Determination of the 5' end of the PAP II transcripts by primer extension analysis. An end-labeled oligonucleotide complementary to the PAP II mRNA was annealed to 10/xg of yeast tRNA (1) or RNA from rat pancreas with acute pancreatitis (2) and extended with reverse tran- scriptase. Positions of the labeled products are indicated by arrows. An M13 mpl8 ladder was used as a size marker.

Analysis of the gene sequences upstream from the 5' splice sites of both transcripts (Fig. 2) shows a very similar stretch of nucleotides defined as TI'CCTFNNAG, AG being the acceptor site of splicing.

The short form of PAP II mRNA is predominant in pancreas, indicating that the splicing site 'b' is prefer- entially utilized. The splicing site 'a', used to generate the long form of the messenger, might be illegitimate and have been conserved during evolution because addition of sev- eral base pairs did not alter significantly the expression of the PAP II mRNA. Yet, alternative splicing might also be of functional significance. It has been previously shown that alternative splicing at the 5' end of mRNAs could be involved in regulation of expression at the translation step. As described by several authors [8-13], such regulation

occurs by adding or removing sequences that interact with regulatory proteins. Interestingly, the additional fragment of exon 2 that appears in the long form of PAP II mRNA contains a very short open reading frame (8 codons), in frame with the PAP II translated sequence and whose ATG initiator codon lays within a reasonable Kozak consensus sequence with a purine (G) in position - 3 and a G in position + 4 [14]. This could make that sequence a poten- tial regulator of translation, because binding of initiation factors to its initiation site would inhibit translation of the downstream messenger. Regulation of expression by that mechanism has been already reported [15-17]. It is note- worthy that it concerned genes lacking a TATA and/or a CAAT box, which is also a characteristic feature of PAP II.

Similar strategies failed to evidence alternative splicing for PAP I and PAP III mRNAs in pancreas.

We are grateful to P. Garrido and R. Grimaud for their technical assistance. N.J.D. is supported by a fellowship from the Fondation pour la Recherche M6dicale (FRM). J-M.F. is supported, in part by a fellowship from the Club Fran~ais du Pancr6as. V.K. is supported by grant Ke 347/3-1 from the Deutsche Forschungsgemeinschaft.

References

[1] Keim, V., Iovanna, J.L. and Dagom, J-C. (1994) Digestion 55, 65-72.

[2] Frigerio, J-M., Dusetti, N., Keim, V., Dagorn, J-C. and Iovanna, J.L. (1993) Biochemistry 32, 9236-9241.

[3] Iovanna, J.L., Keim, V., Bosshard, A., Orelle, B., Frigerio, J-M., Dusetti, N. and Dagorn, J-C. (1993) Am. J. Physiol. 265, G611- G618.

[4] Frigerio, J-M., Dusetti, N., Garrido, P., Dagorn, J-C. and lovanna, J.L. (1993) Biochim. Biophys. Acta 1216, 329-331.

[5] Dusetti, N., Frigerio, J-M., Keim, V., Dagorn, J-C. and Iovanna, J.L. (1993) J. Biol. Chem. 268, 14470-14475.

[6] Dusetti, N., Frigerio, J-M., Szpirer, C., Dagorn, J-C. and Iovanna, J.L. (1994) Biochem. J. (in press).

[7] Iovanna, J.L., Keim, V., Michel, R. and Dagorn, J-C. (1991) Am. J. Physiol. 261, G485-G489.

[8] Gereke, D.R., Foley, J.W., Castagnola, P., Gennari, M., Dublet, B., Cancedda, R., Linsenmayer, T.F., Van der Rest, M., Oisen, B.J. and Gordon, M.K. (1993) J. Biol. Chem. 268, 12177-12184.

[9] Levy, S., Avni, D., Hariharan, N., Perry, R.P. and Meyuhas, O. (1991) Proc. Natl. Acad. Sci. USA 88, 3319-3323.

[10] Patel, L.C., Jacobs-Lorena, M. (1991) J. Biol. Chem. 267, 1159- 1164.

[11] McGary, T.J. and Linquist, S. (1985) Cell 42, 903-911. [12] Parkin, N., Darneau, A., Nicholson, R. and Sonenberg, N. (1988)

Mol. Cell. Biol. 8, 2875-2883. [13] Waterhouse, P., Khokha, R. and Denhardt, D.T. (1990) J. Biol.

Chem. 265, 5585-5589. [14] Kozak, M. (1986) Cell 44, 283-292. [15] Ren, H. and Stiles, G. (1994) Proc. Natl. Acad. Sci. USA 91,

4864-4866. [16] Ren, H. and Stiles, G. (1994) J. Biol. Chem. 269, 3104-3110. [17] Reynolds, G.A., Basu, S.K., Osborne, T.F., Chin, D.J., Gil, G.,

Brown, M.S., Goldstein, J.S. and Luskey, K.L. (1984) Cell 38, 275-285.