university of groningen phenylketonuria in mice and men ... · phenylketonuria in mice and men...

University of Groningen

Phenylketonuria in mice and menBruinenberg, Vibeke Marijn

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2017

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Bruinenberg, V. M. (2017). Phenylketonuria in mice and men. [Groningen]: Rijksuniversiteit Groningen.

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 14-06-2020

https://www.rug.nl/research/portal/en/publications/phenylketonuria-in-mice-and-men(699758ad-10cb-4fa2-85ff-39ef9beb31ac).html

https://www.rug.nl/research/portal/en/publications/phenylketonuria-in-mice-and-men(699758ad-10cb-4fa2-85ff-39ef9beb31ac).html

512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-Bruinenberg512536-L-bw-BruinenbergProcessed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017Processed on: 15-8-2017 PDF page: 1PDF page: 1PDF page: 1PDF page: 1

Phenylketonuria in

mice and men

Vibeke Marijn Bruinenberg


The studies described in this thesis were carried out at the Groningen Institute for Evolutionary Life

Sciences (GELIFES), University of Groningen, Groningen and the at the University Medical Center

Groningen, Beatrix Children’s Hospital, Groningen, The Netherlands. This research has been supported

by a grant from Nutricia Research.

Layout: Alex Wesselink (Persoonlijk Proefschrift.nl)

Cover design: Vibeke Bruinenberg

Printed by: Ipskamp Printing (www.proefschriften.net)

ISBN: 978-94-034-0072-3

http://www.proefschriften.net/


Phenylketonuria in

mice and men

Proefschrift

ter verkrijging van de graad van doctor aan de

Rijksuniversiteit Groningen

op gezag van de

rector magnificus prof. dr. E. Sterken

en volgens besluit van het College voor Promoties.

De openbare verdediging zal plaatsvinden op

vrijdag 22 september 2017 om 14:30 uur

door

Vibeke Marijn Bruinenberg

geboren op 19 juni 1988

te Groningen


PromotoresProf. dr. E.A. van der ZeeProf. dr. F.J. van Spronsen

Beoordelingscommissie

Prof. dr. C.O. Harding

Prof. dr. S. Spijker

Prof. dr. G.J. van Dijk


TABLE OF CONTENTS

Chapter 1 General introduction 9

Chapter 2 The Behavioral Consequence of Phenylketonuria in Mice Depends on the Genetic Background

23

Chapter 3 The behavioral phenotype of female phenylketonuria mice differs partially from male phenylketonuria mice

45

Chapter 4 Sleep disturbances in Phenylketonuria: an explorative study in men and mice

61

Chapter 5 A novel treatment strategy for phenylketonuria: exploring the possibilities of nutrients to improve brain function

77

Chapter 6 A specific nutrient combination attenuates the reduced expression of PSD-95 in the proximal dendrites of hippocampal cell body layers in a mouse model of phenylketonuria

99

Chapter 7 Long-term treatment with a specific nutrient combination in phenylketonuria mice improves recognition memory

113

Chapter 8 Large neutral amino acid supplementation exerts its effect through three synergistic mechanisms: proof of principle in phenylketonuria mice

133

Chapter 9 Therapeutic brain modulation with targeted Large Neutral Amino Acid supplements in the Pah-enu2 phenylketonuria mouse model

159

Chapter 10 Summary and general conclusion 179

Appendix I Nederlandse samenvatting 203

Appendix II Dankwoord 213

Appendix III Curriculum Vitae 219

Appendix IV Publications 223


CHAPTER 1General introduction


10

Chapter 1

1. PHENYLKETONURIA

The heritable metabolic disorder phenylketonuria (PKU) is caused by an inborn error in

phenylalanine (Phe) metabolism. This inborn error causes a dysfunction in the hepatic

enzyme phenylalanine hydroxylase (PAH) affecting the hydroxylation of Phe to tyrosine. As

a consequence, Phe obtained from dietary protein intake is not converted, resulting in a vast

rise of Phe in blood and brain. Furthermore, as the primary catabolic pathway of Phe relies on

functional PAH, an alternative pathway is initiated which causes an increase in metabolites

of Phe (phenylethylamine, phenylpyruvate, phenylacetate, 2-hydroxyphenylacetate, and

phenyllactate). The distinct odor of one of these metabolites (phenyllactate) in the urine of

patients was key in the first discovery of the disease in 19341. The name was later changed

to phenylketonuria considering the presence of these phenylketones in urine2. The first

descriptions of a PKU child was by a mother describing her normally developing child whom

at one point did not develop anymore (The Child Who Never Grew by Pearl Buck, 19503).

In the end, the buildup of Phe in the blood and brain affected the developing brain causing

mental disablement, problems with movement, and seizures4.

2. THE AFFECTED PHENYLKETONURIC BRAIN.

Although the conversion of Phe is disrupted in the liver, the most dramatic consequences of

raised Phe concentrations are found in the brain. Within the brain, these high concentrations

of Phe can have detrimental effects via direct and indirect mechanisms (Figure 1). The first

manner in which Phe can have an impairing effect is already with the entry of Phe in the brain

(Figure1 (1)). The LAT1 transporter responsible for this process is the predominant transport

system of large neutral amino acids (LNAA’s) over the blood-brain barrier5. As the affinity

of Phe is very high to this transporter, high concentrations of Phe can outcompete other

LNAA’s in transport, causing reduced concentrations of non-Phe LNAA’s in brain6,7(Figure 1

(2)). Among these LNAA’s are tyrosine and tryptophan, precursors of the neurotransmitters

dopamine and serotonin. Together with the poor intrinsic capacity to produce tyrosine,

this can result in reduced concentrations of these precursors in the brain. In turn, this can

result in reduced concentrations of the above mentioned neurotransmitters8 (Figure 1 (4)).

Furthermore, high levels of Phe can inhibit the enzymatic activity of tyrosine hydroxylase and

tryptophan hydroxylase, important in the conversion of these precursors to their subsequent

neurotransmitters9 (Figure 1 (3)). Not only neurotransmitter metabolism is affected by high

Phe. Increased Phe concentrations and its metabolites can increase the generation of reactive

species and inhibit antioxidant enzymes10,11 (Figure 1 (5)(6)). An imbalance between this

production and/or removal of reactive species is defined as oxidative stress that is frequently

found in PKU models and PKU patients (reviewed by Ribas12). Oxidative stress can damage

proteins, lipids, carbohydrates, and DNA. This can result in cell damage or death, f.e. in

neurons. Indeed, reduced functioning of neurons or synapses are found in PKU models and


1

11

Chapter 1

post-mortem tissue of PKU patients13–22 (Figure 1 (8)). However, not only oxidative stress

can have these neurotoxic effects. In 2012, Adler-abramovich and colleagues showed that

high concentrations of Phe can result in the assembly of toxic fibrils with an amyloid-like

structure23 (Figure 1 (7)). When added to cell culture, these structures have clear neurotoxic

effects. Finally, myelin alternations are consistently reported in PKU (found in in vitro and

in vivo models, and in untreated and treated PKU patients24–32 (Figure 1 (9)). However, the

exact mechanism in which Phe affects myelin is not clear yet. A possible mechanism could

be the effect of Phe on cholesterol and protein synthesis, processes key in the production and

maintenance of myelin sheaths33–37.

The increased concentrations of Phe have an extensive effect on the brain, affecting

neurtransmitter metabolism, oxidative stress, synaptic functioning, and myelin. These are

domains that are highly interrelated and are at the basis of cognitive functioning.

Figure 1 The affected phenylketonuric brain. (1) The LAT1 transporter has a high affinity to

phenylalanine. The increased Phe concentrations compared to other non-Phe large neutral amino acids,

such as tryptophan (Tryp) and tyrosine (Tyr) outcompete these non-Phe LNAA for entry into the brain.

(2) This causes high concentrations of Phe in the brain and low concentration of other non-Phe LNAA’s,

such as Tryp and Tyr. Furthermore, the dysfunction of phenylalanine hydroxylase in the periphery causes

poor intrinsic capacity to produce Tyr. (3) High concentrations of Phe inhibit tyrosine hydroxylase and

tryptophan hydroxylase important in the conversion of Tyr to 3,4-dihydroxyphenylalanine (DOPA)

and Tryp to 5-hydrotryptophan (5-HTP) respectively. (4) Together this causes a decrease in serotonin


12

Chapter 1

and dopamine. (5) High Phe concentrations can inhibit anti-oxidant enzymes and (6) increase reactive

species. The disrupted balance between production and removal of reactive species is oxidative stress.

(7) High concentrations of Phe can assembly in neurotoxic fibrils with an amyloid-like structure. (8)

Increased Phe concentrations can affect neuronal functioning trough affecting synaptic morphology,

and proteins related to synaptic functioning. (9) In PKU, alternations in myelin/ white matter integrity

are consistently found. A possible mechanism could lay in the indirect effect of Phe on cholesterol and

protein synthesis, processes important in the production and maintenance of myelin sheaths.

3. THE OUTCOME OF PHENYLKETONURIA PATIENTS.

In the 1950’s, it became clear that the treatment of PKU should focus on reducing Phe

intake38. In subsequent years, the first studies showed that low-Phe intake could reduce

Phe in blood and cerebrospinal fluid and improve behavior in PKU patients39,40. Currently,

the treatment of PKU patients still aims to reduce Phe intake that is now achieved by a

protein-restricted diet supplemented with artificial amino acids, vitamins, and minerals.

New born screening facilitates the early introduction of this diet which is prescribed as a

diet-for-life41. In early-treated patients, this diet could overcome the severe mental disabilities

experienced by untreated PKU patients. However, in recent years, it became clear that the

current treatment, the difficulties maintaining diet, and the world-wide misalignment of

Phe targets of treatment causes a suboptimal outcome42,43. Early-treated PKU patients still

experience reduced psychosocial outcome, quality of life, cognitive functioning, such as in

processing speed, attention and working memory, and more internalizing problems such as

depression and anxiety42–45. Therefore, the development of new and/or additional treatment

strategies in PKU is of great importance.

4. THESIS OUTLINE

In this current thesis we investigate two new treatment strategies in PKU, namely a specific

nutrient combination and large neutral amino acids supplementation. This research consists

of preclinical studies in the PKU mouse model. A major challenge in this preclinical research

is the translational value of the model. The translational value implies and demands a link

between the model and the modelled condition (the PKU mouse model to PKU patients).

Therefore, the first part of this thesis aims for a completer understanding of the PKU mouse

model, whereas the second and third part relate to the two new treatment strategies. As

such, the outline of this thesis is divided in three parts: I) Characterization and translational

value of the PKU mouse model, II) The effect of a specific nutrient combination in PKU and

III) Large neutral amino acids supplementation in PKU.


1

13

Chapter 1

Part I: Characterization and translational value of the PKU mouse model

In PKU research, several models are used to investigate underlying mechanisms and

new treatment strategies. A model often used is the PKU mouse model. This model, first

described in 1993 by Shedlovsky and colleagues, was developed via germline mutagenesis

with N-ethyl-N-nitroso-ureum (ENU)46. This technique caused a mutation in the PAH gene

resulting in very little enzymatic activity and, consequently, increased concentrations of Phe

in blood and brain46,47. This model, Pahenu2, was developed in the BTBR genetic background.

However, outside of PKU research, this genetic background is known for their abnormalities

in behavior and brain morphology48–51. Therefore, the BTBR Pahenu2 was crossed back on

to the more commonly used C57Bl/6 background. At this moment, both backgrounds of

the mouse model are used as equals despite clear indications from other research fields

that genetic background can influence phenotypical behavior52. In chapter 2, we directly

compare the adult male wild-type (WT) and PKU individuals of both strains (BTBR and

C57Bl/6) in four PKU-related domains; activity, motor performance, anxiety-and depressive-

like behavior and learning and memory. As genotyping with specific probes and primers

confirmed that the PKU mice of both strains have an identical point mutation, this study

further investigates if the biochemical profiles of the PKU mice of both genetic backgrounds

is similar. The biochemical profiles consist of neurotransmitter concentrations in brain, and

amino acid concentration in blood and brain.

In chapter 2, we examined male mice, as preclinical research most often focusses on the

males. However, it is progressively recognized that males can respond differently than

females53–55. Therefore, chapter 3 investigates the four PKU-related domains in adult female

WT and PKU individuals of both strains.

In the previous two chapters we have tested four PKU-related domains described for PKU. A

phenotypical consequence of PKU that is not described in literature is sleep-related problems.

The lack in sleep research is somewhat surprising to us, as several modulators of sleep and

wakefulness are affected in PKU56,57 (f.e. serotonin, dopamine, norepinephrine and orexin).

For this reason, chapter 4 investigates sleep characteristics in PKU patients and sleep/wake

patterns in male and female PKU mice of both genetic backgrounds. In PKU patients and

first degree relatives, four questionnaires in an electronic survey are used. Together with ten

questions to characterize the subjects, the questionnaires are used to examine the possible

occurrence of sleep disorders, sleep quality, sleepiness during the day, and chronotype. In

PKU and WT mice, rest/wake patterns are monitored via passive infrared recorders. From

these patterns, the fragmentation score (the frequency of switching between active and non-

active behavior) and diurnality (e.g. night active animals are active in the dark phase which

gives a negative diurnality score) is calculated.


14

Chapter 1

Part II: The effect of a specific nutrient combination in PKU

Current dietary treatment is often difficult to maintain by PKU patients. This can result in

reduced compliance causing Phe concentrations to rise and fluctuate58. In contrast to the

traditional focus of treatment to reduce Phe, counteracting the detrimental effects of Phe

on the brain could be of great interest to improve PKU treatment. As previously described,

several domains are affected in PKU, namely neurotransmitter metabolism, oxidative

stress, white matter integrity, and synaptic functioning. Chapter 5 reviews nutrients that

can positively affect theses domains of the brain. In this review, a combination of specific

nutrients is postulated as an additional new treatment strategy for PKU. This specific

nutrient combination (SNC) consists of uridine monophosphate (UMP), docosahexaenoic

acid (DHA), eicosapentaenoic acid (EPA), choline, phospholipids, folic acid, vitamins B12,

B6, C, and E, and selenium. The synergistic approach was originally designed to improve

the synthesis of phospholipids, a major component of (synaptic) membranes. Together

and beyond the original focus, SNC supplementation have shown positive effects on

synaptic functioning, e.g. pre- and postsynaptic proteins59–62 and neurite outgrowth61,63,

neurotransmitter release and signaling61,64, and memory performance65,66. In chapter 6, for

the first time, SNC supplementation is implemented in male and female C57Bl/6 WT and

PKU mice. In this proof-of-concept study, we examine the effect of SNC supplementation

on a post-synaptic marker, postsynaptic density protein 95, in specific subregions of the

hippocampus. In chapter 7, we continue this work in the BTBR WT and PKU mice to

investigate the behavioral outcome of this treatment. In a long-term intervention study, we

examine whether SNC supplementation can improve motor performanc, novel- and spatial

object recognition memory in high Phe and low Phe conditions.

Part III: Large neutral amino acid supplementation in PKU

As previously described, high Phe concentrations in blood can outcompete other non-

Phe LNAA’s (tyrosine, tryptophan, valine, isoleucine, leucine, methionine, histidine, and

threonine) in the transport over the blood-brain barrier. Consequently, Phe concentrations

are increased in brain, non-Phe- LNAA’s concentrations are reduced, and neurotransmitter

metabolism impaired. Restoring the balance between Phe and non-Phe LNAA’s in blood

with supplementing additional non-Phe LNAA’s could counteract these consequences.

Indeed, clinical studies support this hypothesis67–71. However, the optimal composition and

the effect on all three biochemical disturbances are still unknown. Therefore, as a start, the

acute diet regime of Pietz and colleagues (1999)67 in PKU patients was transformed to a

continuous treatment of supplementation of equal amounts of all non-Phe LNAA’s except

for threonine. In this study, described in chapter 8, we offer this LNAA’s regime for six weeks

to male and female C57Bl/6 WT and PKU mice. After six weeks, blood and brain LNAA’s

and neurotransmitter concentrations are examined to investigate the three biochemical

treatment objectives. In chapter 9, the results found in chapter 8 were used to optimize the

LNAA regimes. In this study six specific LNAA regimes were offered to C57Bl/6 PKU mice


1

15

Chapter 1

and compared to a normal diet in C57Bl/6 PKU and WT mice of both sexes. Again, blood

and brain LNAA’s and neurotransmitter concentrations were examined to investigate the

three biochemical consequences.

To conclude, in Chapter 10, the results of all chapters will be summarized and discussed.

Together with additional data, suggestions are made for future research.


16

Chapter 1

5. REFERENCES

1 Følling. Über Ausscheidung von

Phenylbrenztraubensäure in den Harn als

Stoffwechselanomalie in Verbindung mit

Imbezillität. Hoppe-Seylers Ztschr Physiol

Chem 1934; 227: 169–176.

2 Penrose. Inheritance of phenylpyruvic

amentia (phenylketonuria). Lancet 1935; 2:

192–194.

3 Buck P. The Child Who Never Grew. 1950.

4 Blau N, van Spronsen FJ, Levy HL.

Phenylketonuria. Lancet 2010; 376: 1417–

27.

5 Kanai Y, Segawa H, Miyamoto K i, Uchino

H, Takeda E, Endou H. Expression cloning

and characterization of a transporter for

large neutral amino acids activated by the

heavy chain of 4F2 antigen (CD98). J Biol

Chem 1998; 273: 23629–32.

6 van Spronsen FJ, Hoeksma M, Reijngoud

D-J. Brain dysfunction in phenylketonuria:

is phenylalanine toxicity the only possible

cause? J Inherit Metab Dis 2009; 32: 46–51.

7 de Groot MJ, Sijens PE, Reijngoud

D-J, Paans AM, van Spronsen FJ.

Phenylketonuria: brain phenylalanine

concentrations relate inversely to cerebral

protein synthesis. J Cereb Blood Flow

Metab 2015; 35: 200–5.

8 Hommes FA, Lee JS. The control of

5-hydroxytryptamine and dopamine

synthesis in the brain: a theoretical

approach. J Inherit Metab Dis 1990; 13:

37–57.

9 Ogawa S, Ichinose H. Effect of metals and

phenylalanine on the activity of human

tryptophan hydroxylase-2: comparison

with that on tyrosine hydroxylase activity.

Neurosci Lett 2006; 401: 261–5.

10 Mazumder MK, Paul R, Borah A.

β-phenethylamine--a phenylalanine

derivative in brain--contributes to oxidative

stress by inhibiting mitochondrial complexes

and DT-diaphorase: an in silico study. CNS

Neurosci Ther 2013; 19: 596–602.

11 Rosa AP, Jacques CED, Moraes TB,

Wannmacher CMD, Dutra A de M, Dutra-

Filho CS. Phenylpyruvic acid decreases

glucose-6-phosphate dehydrogenase activity

in rat brain. Cell Mol Neurobiol 2012; 32:

1113–8.

12 Ribas GS, Sitta A, Wajner M, Vargas CR.

Oxidative stress in phenylketonuria: what is

the evidence? Cell Mol Neurobiol 2011; 31:

653–62.

13 Christ SE, Price MH, Bodner KE, Saville C,

Moffitt AJ, Peck D. Morphometric analysis

of gray matter integrity in individuals with

early-treated phenylketonuria. Mol Genet

Metab 2016; 118: 3–8.

14 Andolina D, Conversi D, Cabib S,

Trabalza A, Ventura R, Puglisi-Allegra

S et al. 5-Hydroxytryptophan during

critical postnatal period improves

cognitive performances and promotes

dendritic spine maturation in genetic

mouse model of phenylketonuria. Int J

Neuropsychopharmacol 2011; 14: 479–89.

15 Liang L, Gu X, Lu L, Li D, Zhang X.

Phenylketonuria-related synaptic changes

in a BTBR-Pah(enu2) mouse model.

Neuroreport 2011; 22: 617–22.

16 Cordero ME, Trejo M, Colombo M, Aranda

V. Histological maturation of the neocortex

in phenylketonuric rats. Early Hum Dev

1983; 8: 157–73.


1

17

Chapter 1

17 Hörster F, Schwab MA, Sauer SW, Pietz J,

Hoffmann GF, Okun JG et al. Phenylalanine

reduces synaptic density in mixed cortical

cultures from mice. Pediatr Res 2006; 59:

544–8.

18 Schlegel G, Scholz R, Ullrich K, Santer

R, Rune GM. Phenylketonuria: Direct

and indirect effects of phenylalanine. Exp

Neurol 2016; 281: 28–36.

19 Zhang Y, Zhang H, Yuan X, Gu X.

Differential effects of phenylalanine on

Rac1, Cdc42, and RhoA expression and

activity in cultured cortical neurons. Pediatr

Res 2007; 62: 8–13.

20 Imperlini E, Orrù S, Corbo C, Daniele A,

Salvatore F. Altered brain protein expression

profiles are associated with molecular

neurological dysfunction in the PKU mouse

model. J Neurochem 2014; 129: 1002–12.

21 Horling K, Schlegel G, Schulz S, Vierk R,

Ullrich K, Santer R et al. Hippocampal

synaptic connectivity in phenylketonuria.

Hum Mol Genet 2014. doi:10.1093/hmg/

ddu515.

22 Cabib S, Pascucci T, Ventura R, Romano V,

Puglisi-Allegra S. The behavioral profile of

severe mental retardation in a genetic mouse

model of phenylketonuria. Behav Genet

2003; 33: 301–10.

23 Adler-Abramovich L, Vaks L, Carny

O, Trudler D, Magno A, Caflisch A et

al. Phenylalanine assembly into toxic

fibrils suggests amyloid etiology in

phenylketonuria. Nat Chem Biol 2012; 8:

701–6.

24 ALVORD EC, STEVENSON LD, VOGEL

FS, ENGLE RL. Neuropathological findings

in phenyl-pyruvic oligophrenia (phenyl-

ketonuria). J Neuropathol Exp Neurol

1950; 9: 298–310.

25 Huttenlocher PR. The neuropathology of

phenylketonuria: human and animal studies.

Eur J Pediatr 2000; 159 Suppl: S102-6.

26 Anderson PJ, Leuzzi V. White matter

pathology in phenylketonuria. Mol Genet

Metab 2010; 99 Suppl 1: S3-9.

27 Hood A, Antenor-Dorsey JA V, Hershey

T, Rutlin J, Shimony JS, McKinstry RC et

al. White matter integrity and executive

abilities in individuals with phenylketonuria.

Mol Genet Metab 2013; 109: 125–31.

28 Anderson PJ, Wood SJ, Francis DE,

Coleman L, Warwick L, Casanelia S et al.

Neuropsychological functioning in children

with early-treated phenylketonuria: impact

of white matter abnormalities. Dev Med

Child Neurol 2004; 46: 230–8.

29 Bick U, Ullrich K, Stöber U, Möller H,

Schuierer G, Ludolph AC et al. White

matter abnormalities in patients with

treated hyperphenylalaninaemia: magnetic

resonance relaxometry and proton

spectroscopy findings. Eur J Pediatr 1993;

152: 1012–20.

30 Leuzzi V, Tosetti M, Montanaro D,

Carducci C, Artiola C, Antonozzi I et

al. The pathogenesis of the white matter

abnormalities in phenylketonuria. A

multimodal 3.0 tesla MRI and magnetic

resonance spectroscopy (1H MRS) study. J

Inherit Metab Dis 2007; 30: 209–16.

31 Mastrangelo M, Chiarotti F, Berillo L,

Caputi C, Carducci C, Di Biasi C et al. The

outcome of white matter abnormalities in

early treated phenylketonuric patients: A

retrospective longitudinal long-term study.

Mol Genet Metab 2015. doi:10.1016/j.

ymgme.2015.08.005.

32 Dyer CA, Kendler A, Philibotte T, Gardiner

P, Cruz J, Levy HL. Evidence for central

nervous system glial cell plasticity in

phenylketonuria. J Neuropathol Exp Neurol

1996; 55: 795–814.


18

Chapter 1

33 Shefer S, Tint GS, Jean-Guillaume D,

Daikhin E, Kendler A, Nguyen LB et al. Is

there a relationship between 3-hydroxy-

3-methylglutaryl coenzyme a reductase

activity and forebrain pathology in the PKU

mouse? J Neurosci Res 2000; 61: 549–63.

34 Smith I, Knowles J. Behaviour in early

treated phenylketonuria: a systematic

review. Eur J Pediatr 2000; 159 Suppl: S89-

93.

35 Hoeksma M, Reijngoud D-J, Pruim J,

de Valk HW, Paans AMJ, van Spronsen

FJ. Phenylketonuria: High plasma

phenylalanine decreases cerebral protein

synthesis. Mol Genet Metab 2009; 96:

177–82.

36 Hughes J V, Johnson TC. The effects of

phenylalanine on amino acid metabolism

and protein synthesis in brain cells in vitro. J

Neurochem 1976; 26: 1105–13.

37 Binek-Singer P, Johnson TC. The effects of

chronic hyperphenylalaninaemia on mouse

brain protein synthesis can be prevented by

other amino acids. Biochem J 1982; 206:

407–14.

38 WOOLF LI, VULLIAMY DG.

Phenylketonuria with a study of the effect

upon it of glutamic acid. Arch Dis Child

1951; 26: 487–94.

39 BICKEL H, GERRARD J, HICKMANS

EM. Influence of phenylalanine intake on

phenylketonuria. Lancet (London, England)

1953; 265: 812–3.

40 BICKEL H, GERRARD J, HICKMANS

EM. The influence of phenylalanine intake

on the chemistry and behaviour of a phenyl-

ketonuric child. Acta Paediatr 1954; 43:

64–77.

41 van Spronsen FJ, van Wegberg AM, Ahring

K, Bélanger-Quintana A, Blau N, Bosch

AM et al. Key European guidelines for

the diagnosis and management of patients

with phenylketonuria. Lancet Diabetes

Endocrinol 2017. doi:10.1016/S2213-

8587(16)30320-5.

42 Moyle JJ, Fox AM, Arthur M, Bynevelt

M, Burnett JR. Meta-analysis of

neuropsychological symptoms of adolescents

and adults with PKU. Neuropsychol Rev

2007; 17: 91–101.

43 Enns GM, Koch R, Brumm V, Blakely E,

Suter R, Jurecki E. Suboptimal outcomes in

patients with PKU treated early with diet

alone: revisiting the evidence. Mol Genet

Metab; 101: 99–109.

44 Jahja R, van Spronsen FJ, de Sonneville

LMJ, van der Meere JJ, Bosch AM, Hollak

CEM et al. Social-cognitive functioning and

social skills in patients with early treated

phenylketonuria: a PKU-COBESO study. J


45 Jahja R, Huijbregts SCJ, de Sonneville LMJ,

van der Meere JJ, Bosch AM, Hollak CEM

et al. Mental health and social functioning

in early treated Phenylketonuria: the PKU-

COBESO study. Mol Genet Metab 2013;

110 Suppl: S57-61.

46 Shedlovsky A, McDonald JD, Symula

D, Dove WF. Mouse models of human

phenylketonuria. Genetics 1993; 134:

1205–10.

47 van Vliet D, Bruinenberg VM, Mazzola

PN, van Faassen MHJR, de Blaauw P,

Kema IP et al. Large Neutral Amino Acid

Supplementation Exerts Its Effect through

Three Synergistic Mechanisms: Proof of

Principle in Phenylketonuria Mice. PLoS

One 2015; 10: e0143833.


1

19

Chapter 1

48 Wahlsten D, Metten P, Crabbe JC. Survey of

21 inbred mouse strains in two laboratories

reveals that BTBR T/+ tf/tf has severely

reduced hippocampal commissure and

absent corpus callosum. Brain Res 2003;

971: 47–54.

49 Ding Z, Georgiev P, Thöny B.

Administration-route and gender-

independent long-term therapeutic

correction of phenylketonuria (PKU) in

a mouse model by recombinant adeno-

associated virus 8 pseudotyped vector-

mediated gene transfer. Gene Ther 2006; 13:

587–593.

50 MacPherson P, McGaffigan R, Wahlsten D,

Nguyen P V. Impaired fear memory, altered

object memory and modified hippocampal

synaptic plasticity in split-brain mice. Brain

Res 2008; 1210: 179–88.

51 Jones-Davis DM, Yang M, Rider E, Osbun

NC, da Gente GJ, Li J et al. Quantitative

trait loci for interhemispheric commissure

development and social behaviors in the

BTBR T+ tf/J mouse model of autism. PLoS

One 2013; 8: e61829.

52 Sittig LJ, Carbonetto P, Engel KA, Krauss

KS, Barrios-Camacho CM, Palmer AA.

Genetic Background Limits Generalizability

of Genotype-Phenotype Relationships.

Neuron 2016; 91: 1253–1259.

53 Miller LR, Marks C, Becker JB, Hurn PD,

Chen W-J, Woodruff T et al. Considering

sex as a biological variable in preclinical

research. FASEB J 2017; 31: 29–34.

54 Soldin OP, Mattison DR. Sex differences in

pharmacokinetics and pharmacodynamics.

Clin Pharmacokinet 2009; 48: 143–57.

55 Sandberg K, Umans JG, Georgetown

Consensus Conference Work Group the

GCCW. Recommendations concerning

the new U.S. National Institutes of Health

initiative to balance the sex of cells and

animals in preclinical research. FASEB J

2015; 29: 1646–52.

56 Holst SC, Valomon A, Landolt H-P. Sleep

Pharmacogenetics: Personalized Sleep-Wake

Therapy. Annu Rev Pharmacol Toxicol

2016; 56: 577–603.

57 Eban-Rothschild A, Rothschild G,

Giardino WJ, Jones JR, de Lecea L. VTA

dopaminergic neurons regulate ethologically

relevant sleep–wake behaviors. Nat

Neurosci 2016; 19: 1356–1366.

58 MacDonald A, Gokmen-Ozel H, van

Rijn M, Burgard P. The reality of dietary

compliance in the management of

phenylketonuria. J Inherit Metab Dis 2010;

33: 665–70.

59 Wurtman RJ, Cansev M, Sakamoto T, Ulus

IH. Administration of docosahexaenoic

acid, uridine and choline increases levels of

synaptic membranes and dendritic spines in

rodent brain. World Rev Nutr Diet 2009;

99: 71–96.

60 Cansev M, Wurtman RJ. Chronic

administration of docosahexaenoic acid or

eicosapentaenoic acid, but not arachidonic

acid, alone or in combination with uridine,

increases brain phosphatide and synaptic

protein levels in gerbils. Neuroscience 2007;

148: 421–31.

61 Cansev M, van Wijk N, Turkyilmaz

M, Orhan F, Sijben JWC, Broersen

LM. A specific multi-nutrient enriched

diet enhances hippocampal cholinergic

transmission in aged rats. Neurobiol Aging

2015; 36: 344–51.

62 Sakamoto T, Cansev M, Wurtman RJ. Oral

supplementation with docosahexaenoic acid

and uridine-5’-monophosphate increases

dendritic spine density in adult gerbil

hippocampus. Brain Res 2007; 1182: 50–9.

63 Pooler AM, Guez DH, Benedictus

R, Wurtman RJ. Uridine enhances

neurite outgrowth in nerve growth

factor-differentiated PC12 [corrected].

Neuroscience 2005; 134: 207–14.


20

Chapter 1

64 Savelkoul PJM, Janickova H, Kuipers AAM,

Hageman RJJ, Kamphuis PJ, Dolezal V et

al. A specific multi-nutrient formulation

enhances M1 muscarinic acetylcholine

receptor responses in vitro. J Neurochem

2012; 120: 631–40.

65 Scheltens P, Kamphuis PJGH, Verhey

FRJ, Olde Rikkert MGM, Wurtman RJ,

Wilkinson D et al. Efficacy of a medical

food in mild Alzheimer’s disease: A

randomized, controlled trial. Alzheimers

Dement 2010; 6: 1–10.e1.

66 Scheltens P, Twisk JWR, Blesa R, Scarpini

E, von Arnim CAF, Bongers A et al. Efficacy

of Souvenaid in mild Alzheimer’s disease:

results from a randomized, controlled trial. J

Alzheimers Dis 2012; 31: 225–36.

67 Pietz J, Kreis R, Rupp A, Mayatepek

E, Rating D, Boesch C et al. Large

neutral amino acids block phenylalanine

transport into brain tissue in patients with

phenylketonuria. J Clin Invest 1999; 103:

1169–78.

68 Schindeler S, Ghosh-Jerath S, Thompson S,

Rocca A, Joy P, Kemp A et al. The effects

of large neutral amino acid supplements

in PKU: an MRS and neuropsychological

study. Mol Genet Metab 2007; 91: 48–54.

69 Koch R, Moseley KD, Yano S, Nelson

M, Moats RA. Large neutral amino acid

therapy and phenylketonuria: a promising

approach to treatment. Mol Genet Metab

2003; 79: 110–3.

70 Yano S, Moseley K, Azen C. Large neutral

amino acid supplementation increases

melatonin synthesis in phenylketonuria: a

new biomarker. J Pediatr 2013; 162: 999–

1003.

71 Kalkanoğlu HS, Ahring KK, Sertkaya D,

Møller LB, Romstad A, Mikkelsen I et

al. Behavioural effects of phenylalanine-

free amino acid tablet supplementation in

intellectually disabled adults with untreated

phenylketonuria. Acta Paediatr 2005; 94:

1218–22.


1

21

Chapter 1


CHAPTER 2The Behavioral Consequence of Phenylketonuria

in Mice Depends on the Genetic Background

Vibeke M. Bruinenberg1, Els van der Goot1, Danique van Vliet2,

Martijn J. de Groot2, Priscila N. Mazzola1,2,

M. Rebecca Heiner-Fokkema3, Martijn van Faassen3,

Francjan J. van Spronsen2, Eddy A. van der Zee1*.

1Molecular Neurobiology, Groningen Institute for Evolutionary Life Sciences (GELIFES),

University of Groningen, Groningen, the Netherlands, 2Beatrix Children’s Hospital,

University Medical Center Groningen, Groningen, the Netherlands, 3Laboratory Medicine,

University of Groningen, University Medical Center, Groningen, the Netherlands

Front Behav Neurosci. 2016 Dec 20;10:233. doi: 10.3389/fnbeh.2016.00233.

eCollection 2016.


24

Chapter 2

ABSTRACT

To unravel the role of gene mutations in the healthy and the diseased state, countless studies

have tried to link genotype with phenotype. However, over the years, it became clear that

the strain of mice can influence these results. Nevertheless, identical gene mutations in

different strains are often still considered equals. An example of this, is the research done in

phenylketonuria (PKU), an inheritable metabolic disorder. In this field, a PKU mouse model

(either on a BTBR or C57Bl/6 background) is often used to examine underlying mechanisms

of the disease and/or new treatment strategies. Both strains have a point mutation in the

gene coding for the enzyme phenylalanine hydroxylase which causes toxic concentrations of

the amino acid phenylalanine in blood and brain, as found in PKU patients. Although the

mutation is identical and therefore assumed to equally affect physiology and behavior in both

strains, no studies directly compared the two genetic backgrounds to test this assumption.

Therefore, this study compared the BTBR and C57Bl/6 wild-type and PKU mice on PKU-

relevant amino acid- and neurotransmitter levels and at a behavioral level. The behavioral

paradigms were selected from previous literature on the PKU mouse model and address four

domains, namely 1) activity levels, 2) motor performance, 3) anxiety and/or depression-

like behavior, and 4) learning and memory. The results of this study showed comparable

biochemical changes in phenylalanine and neurotransmitter concentrations. In contrast,

clear differences in behavioral outcome between the strains in all four above-mentioned

domains were found, most notably in the learning and memory domain. The outcome in

this domain seem to be primarily due to factors inherent to the genetic background of the

mouse and much less by differences in PKU-specific biochemical parameters in blood and

brain. The difference in behavioral outcome between PKU of both strains emphasizes that

the consequence of the PAH mutation is influenced by other factors than Phe levels alone.

Therefore, future research should consider these differences when choosing one of the genetic

strains to investigate the pathophysiological mechanism underlying PKU-related behavior,

especially when combined with new treatment strategies.


2

25

Chapter 2

1. INTRODUCTION

Transgenic and knockout/ knock-in mice are used to investigate the consequence of genetic

mutations to understand the human biological system, especially in a diseased condition. It

is progressively acknowledged that the strain of these mice highly influences the outcome of

the gene mutation1–4. Nevertheless, identical gene mutations in different strains are often still

considered equals in various disciplines. A striking example is the mouse model used in the

field of phenylketonuria (PKU, OMIM 261600). PKU is an inheritable metabolic disorder

characterized by high concentrations of the amino acid phenylalanine (Phe) in blood and

brain caused by mutations in the gene that encodes for the enzyme Phe hydroxylase (PAH,

EC 1.14.16.1). This mutation results in a loss of catalytic activity of the enzyme and, as a

consequence, the conversion of Phe to tyrosine is disrupted. In untreated patients, these

raised concentrations of Phe are associated with symptoms such as a severe intellectual

disability, disruptions in motor performance, mood swings, anxiety, depression disorders,

and epilepsy5. The mouse model of PKU mimics the PKU patients through a chemically

induced point mutation in the gene encoding for the enzyme PAH. Originally, this point

mutation was described for the black and tan, brachyury (BTBR) mouse 6. However, the

wild-type (WT) mice of the BTBR strain were found to have difficulties with breeding and

displayed abnormalities in brain morphology and behavior, thus limiting their suitability for

preclinical research7–10. Therefore, The BTBR PKU mouse was crossed back on a C57Bl/6JRj

(referred to as B6 hereafter) background. As a result, both strains are currently used in PKU

studies, often without justification. Without fully understanding the influence of the genetic

background on behavior and physiology, notably behavioral results in these PKU studies can

be difficult to interpret.

Various studies highlight the phenotypical difference in behavior between BTBR and B6 WT,

as the BTBR is often used in autism research. For example, novelty induced activity is greater

in BTBR WT than B6 WT 11–13 but decreased in home-cage conditions11. Furthermore, motor

performance of the BTBR WT is inferior to the B6 WT on the rotarod12,14. However, mixed

results are described for the differences between the strains in anxiety-related behavior and

learning and memory. For anxiety-related behavior, no differences13, a reduction11, and an

increase of anxiety-related behavior of BTBR WT 12 compared to B6 WT are reported.

Similar contradicting results are described for learning and memory. Some articles show an

intact ability to master a short-term or long-term memory task by both backgrounds11,13.

Others report memory deficits in for instance short-term novel object memory in the

B6 WT13, reversal learning in the BTBR11, and cued and contextual fear conditioning in

BTBR9,15. The deficits found in the BTBR could be restored with an increase in training15

and cage enrichment9. These results clearly indicate differences between the BTBR and B6

WT individuals in domains important in PKU research. It highlights that the fundaments

on which the PKU genotype is induced are already different. Therefore, it is important to


26

Chapter 2

characterize the different strains’ biochemical profile along with behavioral outcome in order

to highlight similarities and, most of all, differences between the strains, providing better

translational insight in the use of the PKU mouse model. For this reason, this study aims

to directly compare male BTBR and B6 mice in terms of amino acid-and neurotransmitter

levels, and behavioral and cognitive performance under identical laboratory conditions (e.g.

food regime, housing conditions, and experimental design). We particularly aimed to answer

two specific questions: 1) Do WT and PKU mice of the two strains differ from each other?

and 2) Do PKU mice differ from WT mice within a strain? To this aim, the mice were

behaviorally tested in four PKU relevant domains previously described in the literature for

at least one of the strains, namely 1) activity levels, 2) motor performance, 3) anxiety and/or

depression-like behavior, and 4) learning and memory.

2. MATERIAL AND METHODS

2.1 Animals

Heterozygous mating pairs of either BTBR or B6 mice were bred to obtain male

BTBR WT, BTBR PKU, B6 WT, and B6 PKU mice. Original breeding pairs of B6 were

obtained from the lab of Prof. Dr. Thöny, University of Zürich, Switzerland and in our

hands crossed back every fifth generation with the C57Bl/6JRj (Janvier). The breeding

pairs of the BTBR were kindly provided by Prof. Puglisi-Allegra, Sapienza University of

Rome, Italy. They obtained the original BTBR-Pahenu2/J parental pairs from Jackson

Laboratories (Bar Harbor, ME, USA)16 All individuals were weaned on postnatal day

28 and tissue obtained at weaning was used to establish genotype with quantitative

PCR (forward primer: 5’ CCGTCCTGTTGCTGGCTTAC 3’, reverse primer: 3’

CAGGTGTGTACATGGGCTTAGATC 5, WT probe: CCGAGTCZZLCALTGCA, PKU

probe: CCGAGTCZLLCACTGCA, aimed at exon 7 of the PAH gene (Eurogentec, Fremont,

USA). Mice were group housed until the start of the experiment in a cage with a paper role

and nesting material. Animals were tested around the age of 4-5 months. All mice were

housed individually in cages with a paper role and nesting material seven days before the

experiment. Mice were handled by the researcher for two minutes on the three consecutive

days before the start of the first behavioral paradigm. The reported behavioral paradigms

were obtained from two separate cohorts of 10 males for each group. In the first cohort, in

chronological order, we examined the open field (OF), long-term novel object recognition

(NOR), long-term spatial object recognition (SOR), and the forced swim test (FST). In

the second cohort, in chronological order, we examined home-cage activity, the elevated

plus maze (EPM), and the balance beam (BB). An overview of the time line is given in

figure 1A. During the experiment, animals had ad libitum access to water and normal chow

(RMH-B 2181, ABdiets, Phe: 8.7 g/kg food) and were kept on a 12/12 light/dark cycle.

All experimental measurements, except for home-cage activity, were performed between

Zeitgeber Time 1 (ZT1) and ZT6. All proceedings were carried out in accordance with the


2

27

Chapter 2

recommendation of the Guide for the Care and Use of Laboratory Animals of the National

Institutes of Health (The ARRIVE Guidelines Checklist) and protocols were approved by

the Institutional Animal Care and Use Committee of the University of Groningen (Permit

No 6731A and 6731D).

Figure 1 Overview of behavioral paradigms. (A) Time line of the study. The first cohort started

with an open field (OF) and novel object recognition test (NOR), 5 days later followed by a spatial

object recognition test (SOR) and three weeks later a Forced swim test (FST). After the FST, the mice

were sacrificed. The second cohort was monitored for five days with passive infrared sensors (PIR),

subsequently 24 hours later tested in the elevated plus maze (EPM) and 24 hours later on the balance

beam (BB). (B) OF and NOR setup. The habituation phase of the NOR was used as OF. For the analysis


28

Chapter 2

with ethovision, the arena was divided in three regions; 1) corner, 2) border, and 3) center. The NOR

was started 24 hours after the habituation phase, in which the animals could freely explore two identical

objects. Again 24 hours later, one object was replaced for a new object. (C) The SOR was performed in

two days. The first day the mice were exposed to four trials of six min with a two min break in between.

The first trial was a habituation phase and the second to fourth trial the mice could explore three

different objects in a specific configuration. 24 hours later, one object was moved to another position.

2.2 Amino acid and neurotransmitter analyses

Two hours after the FST, animals were anesthetized with isoflurane. When the hind paw

reflex was no longer present, blood samples were taken via heart puncture and collected

in heparin tubes (temporarily stored at 4ºC). Brains were removed from the skull and

cerebrum was immediately flash frozen. To obtain blood plasma, heparin tubes with the

blood samples were centrifuged at 1,500 rcf for ten minutes and the supernatant was taken.

Plasma and brain samples were stored at -80ºC until further processing. Amino acid and

neurotransmitter analyses were performed as described in van Vliet et al. 201517.

2.3. Open field test

Activity and anxiety-like behavior were assessed in a square OF test (50x50x35 cm) with a

white Plexiglas floor and gray Plexiglas walls with a checkerboard cue on one of the walls.

This same arena was used for the NOR and SOR. In all tests with this arena, dim lighting

was used (10 lux in the center of the arena). At the start of the trial, the animal was placed in

the middle of the OF and left to explore the arena freely for ten minutes. All trials were video

recorded and were analyzed at a later time with Ethovision v.11. In this analysis, the arena

was divided into a center zone, four border zones, and four corner zones 18. Activity was

quantified by the distance moved and anxiety-like behavior was examined by the preference

of the animal to seek out the more sheltered zones.

2.4 Novel object recognition

NOR was used to examine the ability of the mice to recall a familiar object after a delay of

24 hours. This widely used learning and memory paradigm and the SOR task (see section

2.5 below) are both based on the innate exploratory behavior of mice towards novel stimuli.

If mice successfully recall the previous event, they will increase exploration towards the

novel stimuli and in the SOR a displaced object19,20. In figure 1B is shown that the NOR

test consists of three phases; the habituation phase, the familiarization phase, and the test

phase 20. The OF test was used as the habituation phase. The familiarization phase was

performed twenty-four hours after the habituation phase. Within this phase, the mice were

allowed to freely explore two identical objects. Twenty-four Hours later, mice were exposed

to one previously encountered object and one novel object in the test phase. The objects were

randomized over the trials. All phases were ten minutes long and video recorded. The read-

out parameter of the NOR test was the time spent exploring the novel object compared to


2

29

Chapter 2

the previously encountered object, expressed as the ratio of novel object exploration time to

total exploration time of both objects. The exploratory behavior was scored manually with

the program ELINE (developed in house).

2.5 Spatial object recognition

In the SOR test, mice were tested for their ability to recognize the displaced object after

twenty-four hours. Within this test, the displaced object that caused the new configuration

of objects was the novel stimulus. SOR was tested five days after the NOR test. Comparable

to the NOR test, the SOR test consisted of a habituation phase, a familiarization phase, and

a test phase (figure 1C). In the habituation phase, the mice could explore the arena without

objects, similar to the previous OF. In the familiarization phases 2-4, the mice were placed

in the same arena with three objects with different shapes and different materials (pottery,

RVS, and glass) in a specific configuration. Twenty-four hours later, in the test phase, one of

the outer objects was displaced (randomized between experimental groups). All trials were

six minutes long and video recorded for analysis at a later time point. Between habituation

phase and the familiarization phase, the mice were placed in their home cage and the arena

was cleaned with 30% ethanol. All trials were manually scored for exploratory behavior

with the program ELINE. The discrimination index for NOR was calculated by dividing

the exploration time of the novel object by the total exploration time multiplied with 100.

In contrast to NOR, in the SOR test it was not possible to keep all objects in the same

distance from the walls and from each other in both familiarization and test phases, because

the limitation of three objects in a rectangular space. Therefore, a correction was made for

possible a priori preference for location or object. This correction was done by calculating

the mean time spent on exploring each object in the three training sessions of the first day.

These cumulative exploration times were set as a percentage of the overall exploration time.

The difference between exploration time in the test trial and mean exploration time in the

three training sessions was calculated and expressed as a percentage difference. A positive

value depicts an increased preference of the individual towards the object in retrospect of

possible innate preference at for hand.

2.6 Forced swim test

The original FST21 used to test antidepressants, consists of a pre-test session of fifteen

minutes and a test session of five minutes twenty-four hours later. The now commonly used

FST to assess depressive-like behavior without intervention consists of one trial 22 and was

used in this study. Mice were placed in a 5,000 ml cylinder containing 2,000 mL of 27

C tap water for six minutes. All trials were recorded with a video camera positioned in

front of the cylinder. These videos were analyzed with ELINE and scored for the behaviors

swimming, struggling, and floating. Swimming was defined as a controlled motion in which

the animals used all four paws. Floating behavior was defined as an immobile state with only

small movements of one paw to keep balance. Finally, struggling was defined as any other


30

Chapter 2

behavior to keep the head above water. This was often done with hasty movements of all

four paws towards the side of the cylinder with a vertical body position. Literature shows

that an increase in floating behavior is consistent with a more depression-like phenotype21,22.

2.7 Home-cage activity

To examine spontaneous activity in a familiar environment, individuals were monitored with

a passive infrared (PIR) detector in their home cage. After seven days of individual housing,

which included three days of handling, the animals were subjected to five consecutive days

of PIR registration starting at ZT1. Starting at midnight, four days (96 hours) were analyzed

with ACTOVIEW 23. This program calculates the average activity from the files produced by

the activity management system (CAMS) collected from the PIR.

2.6 Balance beam

The BB task was used to assess coordination and balance as previously described in Mazzola

et al. 201524. In short, animals were trained over three distances (10, 40, and 75 cm) to cross

a square wooden beam (length 1 m, width 5 mm, height 10 mm, horizontally positioned

50 cm above the underlying surface) to their home cage. This is followed by a read-out trial

of 100 cm. At the start and between trials, the animals were left in their home cage for one

minute. In this study, the performance of the animal was measured by the number of correct

steps as a percentage of the total steps necessary to cross the beam. A correct step was

defined by the full placement of the hind paw on the beam from the initiation of the step to

replacing it on the beam in a forward motion.

2.7. Elevated Plus Maze

The second measurement of anxiety-like behavior is the EPM25,26. This paradigm is also based

on the innate exploratory behavior of the mice but this exploratory drive is counteracted

by the reluctance of the mice to explore open and raised areas. The apparatus used for this

paradigm was a plus-shaped maze with two open and two closed arms connected in the

middle with an open center zone. The closed arms were surrounded by walls of 16 cm that

were open at the top. The open arms solely had a small ridge (2 mm) surrounding the arms.

The length of the arms was 29.5 cm and the center zone was 5x5 cm. The whole apparatus

was positioned 50 cm above the ground. Low lighting conditions were used (30 lux open

arms). At the start of the eight minutes trial, the animals were placed with their head in the

middle of the center zone, pointing towards an open arm. The trials were manually scored

for the following parameters: number of open arm entries and closed arm entries, and the

time spent in open arms and closed arms. The maze was divided into three zones: open arms,

closed arms and center. Entering into a new zone with four paws was seen as an entry and

time recordings were taken from this point. A percentual score for each zone was calculated

by dividing the time spent in a certain area by the total time.


2

31

Chapter 2

2.8 Statistical analysis

A one-way ANOVA was used in the statistical analysis of the data. When the one-way

ANOVA resulted in a p-value ≤0.05, a Bonferroni posthoc test was performed. As the

research question in the introduction did not focus on the comparison between PKU

individuals and the opposing WT group, the statistical outcome of these comparisons (BTBR

WT vs B6 PKU and B6 WT vs BTBR PKU) will not be discussed. To further investigate

the learning and memory tasks, the discrimination index of each group was tested with

a paired Student’s t-test. A statistical significant difference was defined as p≤0.05. Values

two standard deviations outside the mean were viewed as outliers and discarded from the

analysis.

3. RESULTS

3.1 Phe measurements in blood and brain.

To examine if the identical point mutation in two different strains resulted in similar amino

acid levels under the same food regimes, amino acid measurements were performed in blood

and brain (figure 1A-B). Phe levels differed between the groups in blood (F(3,17)=106.129,

p<0.001) and brain (F(3,18)=306.510, p<0.001). In blood, BTBR PKU showed Phe

concentrations of 1270.8±82.3 µmol/L, a 6.3-fold increase compared to the BTBR WT (Phe

200.8±82.3 µmol/L, p<0.001). In B6 PKU, a Phe concentration of 1632.5±313.2 µmol/L was

observed, which was a 26.2-fold rise compared to WT littermates (Phe 62.3±7.7 µmol/L,

p<0.001). In respect to the blood Phe concentrations, brain Phe content in BTBR PKU

mice were 699.5±46.9 nmol/g wet weight and in B6 PKU 666.8±65.4 nmol/g wet weight,

resulting in respectively a 3.4-fold and 5.1-fold increase compared to WT littermates (BTBR

WT 205.6±13.3 nmol/g wet weight, B6 WT 128.5±12.8 nmol/g wet weight, p<0.001 for

both). A comparison between strains showed that B6 PKU individuals had higher levels of

Phe in blood than BTBR (p=0.036), what was also found in the brain Phe levels between WT

individuals (p=0.034). Additional amino acids measurements in blood and brain are provided

as supplementary material. In blood of the B6 strain, additional genotype differences were

found in blood valine (p=0.007), isoleucine (p=0.001) and leucine (p=0.002). In the BTBR

strain, only differences were found in tyrosine (p<0.001). The altered blood amino acid

concentrations did not translate to similar changes in brain amino acid concentration. In

brain, only tyrosine levels were reduced in B6 PKU compared to B6 WT (p=0.001).


32

Chapter 2

Figure 2 Phenylalanine concentrations in blood and brain. (A) Phenylalanine concentrations in blood

(µmol/L) (n=4-6), and (B) Phenylalanine content in the brain (nmol/g) (n=5-6) of BTBR and C57Bl/6

(B6) wild-type (WT) and phenylketonuria (PKU) mice. * p≤0.05; mean±SEM

3.2 Monoaminergic neurotransmitters in brain

To further investigate the consequence on the biochemical level of the identical point

mutation in both PKU strains, monoaminergic neurotransmitters together with the

associated metabolite content were examined in the brain (Fig. 3A-C). First, in figure 3A,

the catecholamine dopamine did not significantly differ between groups (F(3,19)=1.094,

p=0.376). Second, further downstream the catecholamine pathway, norepinephrine (NE) did

show differences between the groups (figure 3B; F(3,19)=20.384, p<0.001). Norepinephrine

levels were reduced to 53% in B6 PKU compared to WT littermates (p<0.001) and a trend

towards a reduction of 63% was observed in BTBR PKU (p=0.061). B6 WT showed a higher

norepinephrine content compared to BTBR WT (p=0.002). Finally, in figure 2C, serotonin

levels showed differences between the groups (F(3,19)=14.053, p<0.001) in which BTBR PKU

showed a 57% reduction (p=0.012) and B6 PKU a 50% reduction (p<0.001). No significant

differences were observed between the WTs and PKUs of both strains (both: p=1.000).

3.3 Activity

The behavioral phenotype was examined in four domains, starting with locomotor activity that

was assessed in three experimental test conditions. First, home-cage activity measurements were

taken to assess baseline locomotor activity (figure 4A). A significant difference was observed

between the WT of both strains (F(3,33)=10.185, p<0.001, BTBR WT vs B6 WT, p<0.001)

and the PKU and WT individuals of the BTBR (p=0.017). Such a difference was not observed

in the B6 strain (p=1.000). Second, the distance moved in an open field was measured to assess

novelty-induced locomotion (figure 4B). In this novel environment, a significant difference

was found between strains (F(3,34)= 14.093, p<0.001, BTBR WT vs BTBR B6 p=0.006,

BTBR PKU vs B6 PKU, p<0.001) in which the B6 moved a greater distance. Furthermore,

in contrast to the home-cage activity measurements, no significant differences were found


2

33

Chapter 2

in genotype (BTBR: p=1.000, B6: p=1.000). Finally, entries in the elevated plus maze were

used to examine novelty-induced locomotion in a different arena. The results did not show

significant differences between the groups (F(3,36)=0.916, p=0.443).

Figure 3 Neurotransmitter analyses. (A) Dopamine (B) Norepinephrine (C) Serotonin (n=6 for all

groups except for BTBR PKU n=5). * p≤0.05; mean±SEM

Figure 4 Activity. (A) Distance moved in an open field (n=9-10). (B) Home-cage activity measured by

PIR (n=9-10). * p≤0.05; mean±SEM


34

Chapter 2

3.4 Motor performance

In figure 5 it is clear that the motor performance, assessed by the percentage of correct

steps in the read-out trial, differed significantly (F(3,36)=16.479, p<0.001 respectively). In

both strains, PKU individuals showed a lower percentage of correct steps compared to WT

individuals (BTBR: p=0.001, B6 p<0.001). No significant differences were observed between

strains (WTs p=1.000, PKUs p=1.000).

Figure 5 Motor performance. The number of correct steps in the probe trail is depicted as a percentage

of the total steps necessary to cross the beam (n=9-10). * p≤0.05; mean±SEM

3.5 Anxiety and depressive-like behavior

Anxiety and depressive-like behavior were examined by the use of the OF, the EPM, and the

FST (Fig.6A-D). In the OF, time spent in the corners significantly differed between groups

(F(3,34)=9.164, p<0.001). B6 PKU significantly spent more time in the corners compared

to the BTBR PKU (p<0.001). Particularly, the B6 PKU individuals spent approximately

50% of the time in the corners which was more than their WT littermates (p=0.024). In

addition, the EPM showed a difference in the percentage of time spent in the closed arms

(F(3,34)=10.302, p<0.001). This significant difference was found between the strains (WTs

p=0.001, PKU’s p=0.004) but not between the PKU and WT individuals of each strain (BTBR:

p=1.000, B6: p=1.000). Finally, the FST used to examine depressive-like behavior, showed

significant differences in the amount of time spent on floating (F(3,34)=6.155, p=0.002),

struggling (F(3,34)=11.092; p<0.001), and swimming (F(3,34)=3.634, p=0.022). Floating

and struggling differed only between B6 PKU and B6 WT but not between BTBR PKU

and BTBR WT (floating: p=0.003, p=1.000, struggling; p=0.002, p=0.140, respectively). In

swimming, only a significant reduction of swimming behavior was observed in BTBR PKU

individuals compared to BTBR WT (BTBR: p=0.047, B6 p=0.221).


2

35

Chapter 2

Figure 6 Anxiety- and depressive-like behavior. (A) The time spent in the corners of the open field, the

most sheltered areas of the arena. The habituation phase of the NOR was used as open field (n=9-10).

(B) Time spent in the closed arms of the elevated plus maze (n=10). (C) Floating behavior in the forced

swim test (n=9-10) (D) Struggling behavior in the forced swim test (n=9-10). * p≤0.05; mean±SEM

3.6 Learning and memory

Learning and memory were assessed by the NOR and SOR tests (Fig7A,B). The performance

on the discrimination index of the novel object and the displaced object showed a trend

between groups (NOR: F(3,36)=2.818, p=0.053, SOR: (F(3,34)=2.775, p=0.056). To test

whether each group learned the task, a paired t-test was used to examine if either the novel

object differed from the same object or the displaced object from the non-displaced object.

In NOR, the B6 WT (t(9)=-2.265, p=0.050) and B6 PKU (t(8)=2.762, p=0.030) learned

the task. Within the BTBR WT a trend was observed (t(9)=-2.153, p=0.060). The PKU


36

Chapter 2

BTBR did not learn the task (t(9)=0.986, df=9, p=0.350). In SOR, BTBR WT (t(9)=2.335,

p=0.044), B6 WT (t(8)=3.076, p=0.015), and B6 PKU (t(8)=2.762, p=0.025) learned the

task. Again, PKU BTBR mice did not learn the task (t=-0.314, df=9, p=0.761). No significant

differences were found in the exploration of the objects in the NOR test (F(3,36)=1.093,

p=0.364). In the test session of the SOR, the BTBR mice explored the objects overall more

than the B6 mice (F(3,36)=5.463, p=0.003, BTBR compared to B6 p<0.001).

Figure 7 Learning and memory. (A) Discrimination index of NOR (n=10) (B) Discrimination index of

SOR (n=8-10). * p≤0.05, ~ p=0.06; mean±SEM

4. DISCUSSION

Here, we directly compared the two strains of the PKU mouse model in behavioral domains

previously described for at least one of the two strains in literature (activity levels, motor

performance, anxiety and/or depression-like behavior, and learning and memory) and PKU-

related biochemical parameters in the same laboratory using the same experimental settings.

Distinct differences in behavioral outcome between the two strains were found in all four

above-mentioned domains, regardless of comparable biochemical changes in amino acid

and neurotransmitter content. The result of the mutation in the PAH enzyme on behavior

was most pronounced in the PKU BTBR mice, revealing changes in home-cage activity,

reduced motor performance, and learning and memory deficits. In contrast, compared to

B6 WT mice, PKU B6 mice only showed reduced motor performance and indications of

differences in anxiety-like behavior. Therefore, differences in the phenotypical outcome of

the BTBR and B6 PKU mouse model seem to be primarily due to factors inherent to the

genetic background of the mouse and much less to differences in biochemical parameters in

blood and brain that are typically described for PKU pathology.


2

37

Chapter 2

4.1 Learning and memory are intact in B6 PKU

On a behavioral level, the cognitive outcome is consistently used to assess the severity of

the PKU pathology and effectiveness of (new) treatments. This study confirms the cognitive

deficits described for BTBR PKU mice in the literature. However, we show for the first time

that B6 PKU mice can master a learning and memory paradigm despite severe disruptions

in amino acid and neurotransmitter content in the brain. The differences in phenotypical

behavior could lay in a different ability to understand the cognitive demands of a learning

and memory paradigm of the genetic background. In the literature, a direct comparison

between BTBR WT and B6 WT shows mixed results. As mentioned in the introduction,

some articles show an intact ability to master a short-term or long-term memory task by

both strains11,13. In contrast, memory deficits in short-term novel object memory in the B613,

reversal learning in the BTBR11, and cued and contextual fear conditioning in BTBR9,15 have

been reported. The deficits found in BTBR could be restored with an increase in training15 and

cage enrichment9. In our study, difficulties to master the learning and memory paradigms by

BTBR WT were also found for the NOR but not for the SOR. This outcome could have been

influenced by the order of testing (the NOR always preceded the SOR), or the number of

training sessions (a single training phase in NOR, versus three training phases in SOR). Our

results together with literature suggest that BTBR WT mice have more difficulties mastering

a learning and memory paradigm compared to B6 WT mice. It is up for discussion whether

and to what degree the PKU behavioral phenotype in the BTBR PKU is a result of weakening

a poor learner, creating a deficit, or that the strong learner (B6 WT) is able to compensate.

4.2 Can PKU-related biochemical changes affect both strains differently?

Both strains showed a vast increase in Phe levels and disrupted serotonin and norepinephrine

levels in the brain (for norepinephrine a trend was observed for BTBR statistically) which

is in accordance with previous studies17,27–29. How these PKU-related changes can result

in a different functional outcome is not clear. Concerning raised Phe concentrations, in in

vitro models of PKU, increased Phe concentrations seems to affect post- and presynaptic

markers, proteins involved in cytoskeleton organization, and neuronal morphology30–35.

In vivo, although both strains show changes in different markers related to synaptic

functioning, both BTBR PKU and B6 PKU show affected synaptic plasticity and overall

neuronal functioning29,31,36,37. Differences are found between BTBR WT and B6 WT

in adult neurogenesis and neurodevelopmental markers but not in the synaptic markers

synaptophysin and postsynaptic density protein (PSD-95) that are discussed in PKU

literature38. The reduced neurogenesis together with altered neurodevelopmental markers in

BTBR WT indicates that BTBR could have a different brain development compared to B6

WT38. As changes in Phe and neurotransmitters are chronically present at a very early age,

we assume that neurodevelopment differs between BTBR PKU and B6 PKU. An indication

that this is the case is given by the work of Andolina et al. 201129. In their study they could

improve dendritic spine maturation and performance in a short-term version of the NOR and


38

Chapter 2

SOR tests with a seven-day treatment (PND-14-21) with 5-hydroxytryptophan, a precursor

of serotonin29. It is not clear if B6 mice only have a different neonatal development or

that they also have different susceptibility towards neurotransmitter depletion in life. Some

indications present in literature suggest that B6 can differ from BTBR in their response to

neurotransmitter manipulations. For instance, a comparison of acute tryptophan depletion,

a method to deplete serotonin, both B6 and BTBR WT’s show a decrease in serotonin but the

tryptophan depletion only altered social interaction and social novelty behaviors in B6 and not

in BTBR39. Furthermore, administration of the serotonin agonist 3-chlorophenylpiperazine

(CCP) in WT B6 has not affected locomotor activity nor performance of the B6 in learning

and memory paradigm40. Finally, in a conditional knock-out mouse maintained on a B6

genetic background, a significant decrease in serotonin and norepinephrine concentrations

did not affect locomotor activity, motor performance and anxiety- and depression-related

behaviors 41. These examples highlight that in addition to the differences found between

BTBR WT and B6 WT in neurodevelopment, the consequence of neurotransmitter depletion

in later life (without differences in development) could be different between BTBR and B6.

Therefore, we hypothesize that the PKU-related changes in Phe and neurotransmitters affect

both strains differently during neurodevelopment and later in life resulting in a difference in

phenotypical behavior.

4.3 Considerations in testing behavior

In this study, we identified differences between PKU of the B6 background and the PKU of

the BTBR background. As all domains seem to be affected to some extent, an important

consideration is the possibility that altered behavior in one domain can influence the

outcome nonspecifically in another behavioral paradigm. For example, deficits found in

motor performance in the BB of both genetic backgrounds could influence the outcome in

the OF, EPM, SOR, NOR, and FST. However, we did not clearly find an influence of motor

performance in behavioral paradigms with a low level of required motor performance (OF,

EPM, NOR, SOR) as both strains did not reduce activity in the OF and the EPM, and

no differences were found in exploration of the objects in the NOR. Therefore, the mice

were not hampered to fulfill the key feature of the task. However, the task that required

most motor skills, i.e. the FST, could be affected by the motor problems found in PKU.

Accordingly, we observed that the PKU mice from both backgrounds showed difficulties

in maintaining a floating position and correct swimming behavior during the FST. As a

result, we believe that the changes found in the FST are primarily attributed to deficits in

motor performance. Therefore, we conclude that the FST in PKU mice is not well suited for

examining depressive-like behavior in PKU mice and conclusions in this domain should,

therefore, be drawn with caution.


2

39

Chapter 2

4.4 The translational value of the PKU mouse model

The differences in behavioral outcome between PKU mice of both strains emphasizes that

the consequences of the PAH mutation are influenced by other factors than Phe levels

alone. Although the underlying mechanisms may be different, B6 PKU mice may resemble

the human situation where some specific untreated PKU patients with high blood Phe

concentrations have clearly escaped from the severe symptoms of PKU42.

To conclude, this study showed clear differences in PKU behavioral phenotype between BTBR

and B6 mice despite similar biochemical phenotype. It contributes to a better translational

insight in the use of the PKU mouse model. Future research should consider these differences

when choosing one of the genetic strains to investigate the underlying mechanisms of PKU

and/or new treatment targets. As the origin of BTBR and B6 PKU strains between labs may

differ (or the frequency of backcrossing), our results also stress the need for a better genetic

understanding of these strains used by research groups worldwide. Nevertheless, we would

like to emphasize that both PKU strains have their own translational value for studying PKU

and developing novel interventional strategies to battle the burden of the disease, as they

may represent different patient populations.

SUPPLEMENTAL DATA

Table 1. Amino acid concentrations in blood (µmol/L). Each column depicts the mean concentration of

the amino acids ± standard deviation. The greek symbols are used to highlight significant differences;

α= a difference between BTBR WT and BTBR PKU, β= a difference between B6 WT and B6 PKU, γ= a

difference between BTBR PKU and B6 PKU (n=4-6).

BTBR B6WT PKU WT PKU

Phenylalanine 200.8 ± 82.3 1270.8 ± 87.5 α 58.3 ± 2.4 1632.5 ± 313.2 β,γ

Tyrosine 65.4 ± 6.3 27.8 ± 10.9 α 53.0 ± 4.1 38.0 ± 19.8

Valine 247.8 ± 26.0 237.0 ± 30.2 181.2 ± 10.3 277.2 ± 70.2 β

Isoleucine 89.8 ± 6.8 92.5 ± 13.4 68.7 ± 11.6 104.3 ± 15.4 β

Leucine 148.6 ± 14.7 140.3 ± 21.7 117.8 ± 12.0 170.0 ± 27.5 β

Histidine 62.8 ± 7.0 65.0 ± 3.6 51.2 ± 2.4 67.7 ± 19.4

Threonine 144.2 ± 21.5 131.5 ± 7.3 116.7 ± 7.0 156.5 ± 47.1


40

Chapter 2

Table 2. Amino acid concentrations in brain (nmol/g). Each column depicts the mean concentration of

the amino acids ± standard deviation. The greek symbols are used to highlight significant differences;

α= a difference between BTBR WT and BTBR PKU, β= a difference between B6 WT and B6 PKU, γ= a

difference between BTBR PKU and B6 PKU, δ= a difference between BTBR WT and B6 WT (n=5-6).

BTBR B6WT PKU WT PKU

Phenylalanine 205.6 ± 13.3 699.5 ± 46.9 β 128.5 ± 12.8 δ 666.8 ± 65.4 β

Tyrosine 125.4 ± 9.4 107.8 ± 19.7 128.0 ± 19.8 81.6 ± 1.5 β

Valine 84.4 ± 14.3 94.5 ± 21.4 93.2 ± 8.7 67.4 ± 10.5 γ

Isoleucine 53.0 ± 7.6 65.0 ± 17.7 54.0 ± 8.4 48.6 ± 5.1

Leucine 198.4 ± 19.1 224.2 ± 41.5 200.7 ± 20.5 175.8 ± 8.0

Histidine 90.4 ± 9.7 124.0 ± 10.2 86.7 ± 10.9 95.2 ± 5.3 γ

Threonine 370.2 ± 18.9 347.8 ± 32.3 347.3 ± 38.2 300.2 ± 32.2

Methionine 80.0 ± 18.1 93.8 ± 22.8 77.3 ± 10.0 62.8 ± 8.2 γ

Tryptophan 10.2 ± 4.0 12.3 ± 4.4 13.0 ± 4.1 10.2 ± 5.4


2

41

Chapter 2

5. REFERENCES

1 Holmes A, Wrenn CC, Harris AP, Thayer

KE, Crawley JN. Behavioral profiles of

inbred strains on novel olfactory, spatial

and emotional tests for reference memory in

mice. Genes Brain Behav 2002; 1: 55–69.





Neuron 2016; 91: 1253–1259.

3 Alam I, McQueen AK, Acton D, Reilly

AM, Gerard-O’Riley RL, Oakes DK et al.

Phenotypic severity of autosomal dominant

osteopetrosis type II (ADO2) mice on

different genetic backgrounds recapitulates

the features of human disease. Bone 2017;

94: 34–41.

4 Doetschman T. Influence of Genetic

Background on Genetically Engineered

Mouse Phenotypes. 2009, pp 423–433.



27.




1205–10.






971: 47–54.






One 2013; 8: e61829.





Res 2008; 1210: 179–88.








587–593.

11 Molenhuis RT, de Visser L, Bruining H,

Kas MJ. Enhancing the value of psychiatric

mouse models; differential expression of

developmental behavioral and cognitive

profiles in four inbred strains of mice. Eur


12 Moy SS, Nadler JJ, Young NB, Perez A,

Holloway LP, Barbaro RP et al. Mouse

behavioral tasks relevant to autism:

phenotypes of 10 inbred strains. Behav

Brain Res 2007; 176: 4–20.





2003; 33: 301–10.

14 Nadler JJ, Zou F, Huang H, Moy SS,

Lauder J, Crawley JN et al. Large-scale

gene expression differences across brain

regions and inbred strains correlate with a

behavioral phenotype. Genetics 2006; 174:

1229–36.

15 Stapley NW, Guariglia SR, Chadman KK.

Cued and contextual fear conditioning in

BTBR mice is improved with training or

atomoxetine. Neurosci Lett 2013; 549:

120–4.


42

Chapter 2

16 Puglisi-Allegra S, Cabib S, Pascucci T,

Ventura R, Cali F, Romano V. Dramatic

brain aminergic deficit in a genetic mouse

model of phenylketonuria. Neuroreport

2000; 11: 1361–4.







One 2015; 10: e0143833.

18 Hovens IB, Schoemaker RG, van der

Zee EA, Absalom AR, Heineman

E, van Leeuwen BL. Postoperative

cognitive dysfunction: Involvement

of neuroinflammation and neuronal

functioning. Brain Behav Immun 2014; 38:

202–10.

19 Ennaceur A, Delacour J. A new one-trial

test for neurobiological studies of memory

in rats. 1: Behavioral data. Behav Brain Res

1988; 31: 47–59.

20 Antunes M, Biala G. The novel object

recognition memory: neurobiology, test

procedure, and its modifications. Cogn

Process 2012; 13: 93–110.

21 Porsolt RD, Anton G, Blavet N, Jalfre M.

Behavioural despair in rats: a new model

sensitive to antidepressant treatments. Eur J

Pharmacol 1978; 47: 379–91.

22 Bogdanova O V, Kanekar S, D’Anci KE,

Renshaw PF. Factors influencing behavior in

the forced swim test. Physiol Behav 2013;

118: 227–39.

23 Mulder C, Van Der Zee EA, Hut RA,

Gerkema MP. Time-Place Learning and

Memory Persist in Mice Lacking Functional

Per1 and Per2 Clock Genes. J Biol Rhythms

2013; 28: 367–379.

24 Mazzola PN, Bruinenberg V, Anjema

K, van Vliet D, Dutra-Filho CS, van

Spronsen FJ et al. Voluntary Exercise

Prevents Oxidative Stress in the Brain of

Phenylketonuria Mice. JIMD Rep 2015.

doi:10.1007/8904_2015_498.

25 Calabrese EJ. An assessment of anxiolytic

drug screening tests: hormetic dose

responses predominate. Crit Rev Toxicol

2008; 38: 489–542.

26 Belzung C, Griebel G. Measuring normal

and pathological anxiety-like behaviour in

mice: a review. Behav Brain Res 2001; 125:

141–9.

27 Sawin EA, Murali SG, Ney DM. Differential

effects of low-phenylalanine protein sources

on brain neurotransmitters and behavior in

C57Bl/6-Pahenu2 mice. Mol Genet Metab

2014; 111: 452–461.

28 Pascucci T, Giacovazzo G, Andolina

D, Accoto A, Fiori E, Ventura R et

al. Behavioral and neurochemical

characterization of new mouse model of

hyperphenylalaninemia. PLoS One 2013; 8:

e84697.













544–8.





ddu515.


2

43

Chapter 2





Res 2007; 62: 8–13.




Neurol 2016; 281: 28–36.

34 Zhang H, Gu XF. A study of gene

expression profiles of cultured embryonic

rat neurons induced by phenylalanine.

Metab Brain Dis 2005; 20: 61–72.

35 Li D, Gu X, Lu L, Liang L. Effects of

phenylalanine on the survival and neurite

outgrowth of rat cortical neurons in

primary cultures: possible involvement of

brain-derived neurotrophic factor. Mol Cell

Biochem 2010; 339: 1–7.




Neuroreport 2011; 22: 617–22.

37 Bruinenberg VM, van Vliet D, Attali A, de

Wilde MC, Kuhn M, van Spronsen FJ et al.

A Specific Nutrient Combination Attenuates

the Reduced Expression of PSD-95 in

the Proximal Dendrites of Hippocampal

Cell Body Layers in a Mouse Model of

Phenylketonuria. Nutrients 2016; 8.

doi:10.3390/nu8040185.

38 Stephenson DT, O’Neill SM, Narayan

S, Tiwari A, Arnold E, Samaroo HD et

al. Histopathologic characterization of

the BTBR mouse model of autistic-like

behavior reveals selective changes in

neurodevelopmental proteins and adult

hippocampal neurogenesis. Mol Autism

2011; 2: 7.

39 Zhang WQ, Smolik CM, Barba-Escobedo

PA, Gamez M, Sanchez JJ, Javors MA et

al. Acute dietary tryptophan manipulation

differentially alters social behavior, brain

serotonin and plasma corticosterone in three

inbred mouse strains. Neuropharmacology

2015; 90: 1–8.

40 Vetulani J, Sansone M, Bednarczyk

B, Hano J. Different effects of

3-chlorophenylpiperazine on locomotor

activity and acquisition of conditioned

avoidance response in different strains

of mice. Naunyn Schmiedebergs Arch

Pharmacol 1982; 319: 271–4.

41 Isingrini E, Perret L, Rainer Q, Sagueby S,

Moquin L, Gratton A et al. Selective genetic

disruption of dopaminergic, serotonergic

and noradrenergic neurotransmission:

insights into motor, emotional and addictive

behaviour. J Psychiatry Neurosci 2016; 41:

169–81.

42 Ramus SJ, Forrest SM, Pitt DB, Saleeba JA,

Cotton RG. Comparison of genotype and

intellectual phenotype in untreated PKU

patients. J Med Genet 1993; 30: 401–5.


CHAPTER 3The behavioral phenotype of female

phenylketonuria mice differs partially from male phenylketonuria mice

Bruinenberg VM1, van der Goot E1, van Vliet D2, de Groot M2, Mazzola

PN1,2, van Spronsen FJ2, van der Zee EA1



University Medical Center Groningen, Groningen, the Netherlands.


46

Chapter 3

ABSTRACT

Introduction

The use of both sexes in preclinical and clinical research is actively advocated in science.

However, the implementation of this recommendation is often lacking. In the preclinical

research of phenylketonuria (PKU) the inclusion of both sexes is limited. The heritable

metabolic disorder PKU is caused by a mutation in the gene for phenylalanine hydroxylase,

a key enzyme in the conversion of phenylalanine (Phe) to tyrosine. The consequent rise in

Phe concentrations in blood and brain has detrimental effects in the brain, for example in

neurotransmitter metabolism. Our recent study showed differences in behavioral outcome

between the two genetic backgrounds of the PKU mouse model used in preclinical research1.

As that study only included male mice, the aim of the present study was to assess the

behavioral phenotype of female PKU mice of both strains in the same behavioral paradigms;

1) activity, 2) motor performance, 3) anxiety-like behavior, and 4) learning and memory.

Materials & Methods

Female wild type (WT) and PKU mice of each strain were tested in two cohorts (BTBR

WT, BTBR PKU, B6 WT, and B6 PKU, n=10 per group/per cohort). In the first cohort, the

behavior of the mice was assessed in the open field (OF), long-term novel object recognition

(NOR), and long-term spatial object recognition (SOR). In the second cohort, the mice were

tested in home-cage activity, the elevated plus maze (EPM), and the balance beam (BB).

Results

1) For activity, a PKU phenotype was seen in the BTBR strain only in the OF (p<0.001).

A PKU phenotype was lacking in other activity measurements. 2) In motor performance,

a similar deficit was found in the BTBR and B6 strain (both p<0.001). 3) Only in the OF,

a preference for sheltered areas was found for the PKU mice of both backgrounds (BTBR:

p=0.014, B6: p=0.047). 4) Both the BTBR PKU and the B6 PKU mice did not master the

learning and memory paradigms (NOR: BTBR p=0.317, B6=0.516, SOR: BTBR p=0.565,

B6 p=0.310)

Conclusion/Discussion

In contrast to the previously described differences in behavioral phenotype of male PKU

mice of both genetic backgrounds, the PKU females of both strains showed a similar PKU

phenotype. Together these studies highlight that the outcome of the PKU pathophysiology

is influenced not only by genetic background, but also by sex. By including both males and

females in PKU research, PKU research into the underlying mechanism of brain dysfunction

and new treatment strategies will benefit the PKU population.


3

47

Chapter 3

1. INTRODUCTION

Despite an equivalent number of males and females in the human population, neuroscience

and biochemical research usually neglects this ratio between the sexes. Most of the literature

focused on understanding underlying mechanisms of the healthy and the diseased state is

biased towards males2. Accordingly, the male-biased preclinical research has resulted in

skewed data that is unable to be implemented in females3. This imbalance has, for example,

resulted in reports of adverse effects in females and withdrawal of drug treatments from the

market4. To prevent these adverse effects in females and the annulment of years of research,

the use of both sexes is increasingly advocated5. However, in many research fields these

recommendations are not yet implemented, including the field of phenylketonuria (PKU).

In PKU, the first step of the catabolic pathway of phenylalanine (Phe) is disrupted. The

inborn error existing in the converting step of Phe to tyrosine causes the characterizing

increase in Phe concentrations in blood and brain. When no restrictions are made in

protein intake, patients exhibit severe mental disabilities and developmental delays6. To

understand the underlying mechanism of these detrimental effects, a PKU mouse model has

been introduced7. This PKU mouse model originated from mutagenesis in the black and tan

brachyuryblack (BTBR) mouse strain, resulting in a mouse model that had a point mutation

in the enzyme Phe hydroxylase (Pah). As a consequence, no catalytic activity of the enzyme is

present and Phe concentrations rise in blood and brain. Clear limitations of the BTBR strain

in the brain morphology and breeding capacity were the main reason to start back crossing

of the original model onto the C57Bl/6 (B6). Recent research has shown a clear difference in

the behavioral phenotype in male BTBR Pahenu2 and B6 Pahenu mice1. However, it is not clear

what the behavioral phenotype of the female mice of both strains is.

In studies concerning the PKU mouse model, limited studies investigate both sexes or

females8–13. In some of these studies sex differences are described for behavioral response,

biochemical consequence and/or treatment response. For example, while no sex differences

were found in the marble burying test, vertical activity in the open field had a clear

PKU phenotype in female B6 but not in male B69. In addition, the same study showed

sex differences in the neurotransmitters (e.g. norepinephrine, epinephrine, the metabolite

of dopamine 3,4-dihydroxyphenylacetic acid (DOPAC), and serotonin) and response to

glycomacropeptide or amino acid supplementation9. Furthermore, one of the first studies on

gene therapy has shown sex difference in dose response and duration of adeno-associated

virus-treatment in the ability to restore PAH functioning8. These studies give a first indication

that sex can influence the phenotypical outcome of PKU. However, a study examining an

array of PKU-related behavioral paradigms in female PKU mice of both genetic backgrounds

is lacking. Therefore, the aim of this study was to assess the behavioral phenotype of female

PKU mice. From our own work, it is clear that the genetic background (BTBR or B6) of


48

Chapter 3

the PKU mouse model can influence the behavioral phenotype1. Therefore, female mice of

both genetic backgrounds are assed in the identical behavioral paradigms of this study1. The

behavioral paradigms can be subdivide in four behavioral domains: 1) activity, 2) motor

performance, 3) anxiety-like behavior, and 4) learning and memory.


2.1 Animal and experimental design

The experimental design of this study was identical to the study described in Bruinenberg

et al. (2016)1. The fundamental steps of this design will be discussed briefly. Two cohorts of

female wild-type (WT) and PKU mice of each strain (BTBR WT, BTBR PKU, B6 WT, and

B6 PKU, n=10 per group/per cohort) were derived from heterozygous mating pairs. The

offspring was weaned at post-natal 28 and group housed until the start of the experiment at

the age of 4-5 months. The mice were subjected to a battery of behavioral paradigms. In the

first cohort, the mice were tested in the open field (OF), long-term novel object recognition

(NOR), and long-term spatial object recognition (SOR). In the second cohort, home-cage

activity, the elevated plus maze (EPM), and the balance beam (BB) were performed. Seven

days before the start of each cohort, the mice were individually housed and handled three

times in the days preceding the start of the first test. Animals were kept on a 12/12 light/

dark cycle with unlimited access to food (RMH-B 2181, AB Diets®, Phe: 8.7 g/kg) and

water. The behavioral tests were performed between zeitgeber (ZT) 1 and 6. All proceedings

were approved by the Institutional Animal Care and Use Committee of the University of

Groningen.

2.2 Behavioral paradigms of cohort 1

The first cohort was subjected to the OF, NOR, and SOR. For these tests an arena (50x50x35

cm) with grey sides and a white floor was used. On the first day, the animals were introduced

to this arena for 10 minutes to explore. This phase used as the OF test. The second day, two

identical glass objects were placed in the arena. Again, the mice could explore the apparatus

for 10 minutes. The third day, one of these objects was replaced by a novel glass object

(the replaced object was randomized over the mice). Hereafter, the mice were not tested for

five days. On day nine, the mice had four sessions of six minutes in the arena for the SOR:

(1) habituation phase, (2-4) acquisition phases wherein a specific configuration of three

different objects was presented (configuration was randomized over the mice). On day ten,

this configuration was changed. All behavioral paradigms were video recorded. In the OF

test, distance moved through the maze and time spend in certain locations of the maze (center

zone, border zone, and corner zone (Figure 3A)14) were analyzed with Ethovision v.11. The

NOR and the SOR were analyzed by hand with the program ELINE (made in house). With

this program, the percentage of time spending exploring an object can be registered. For the

NOR, the difference in time between the time exploring the novel object to familiar object


3

49

Chapter 3

was divided by the total time exploring the objects. For the SOR, the exploration time of the

three habituation phases were set as zero by dividing the time exploring the located object

by the percentual exploring time of the same object in the habituation phase.

2.3 Behavioral paradigms of cohort 2

In the second cohort, the mice were subjected to three measurements, in chronological order;

home-cage activity, elevated plus maze, and balance beam. Similar to cohort 1, the mice were

individually housed seven days before the start of the experiment, including three days of

handling, in cages that where placed underneath a passive infrared detector. After these seven

days, a five-day recording period was started. In de final analysis, the 96 hours started from

midnight on the first day was used for analysis with ACTOVIEW (made in house15). After

home-cage activity measurements, the animals were subjected to an elevated plus maze. The

mice were placed in this plus-shaped maze, consisting of two open and two closed arms, for

eight minutes. With ELINE, the number of open arm entries and closed arm entries, and

the time spent in open arms and closed arms was investigated. Finally, the mice were tested

on motor performance on the balance beam. In this task, the mice were trained to cross a

one-meter long wooden beam by placing the mice further away from the safe house at the

end of the beam (10 cm, 40 cm, and 75 cm). After this training, they were able to cross the

one-meter beam in the read-out trail. The number of slips compared to the total number of

steps in this read-out trail was used as read-out parameter.


Normally distributed data, established with a Shapiro-Wilk test, was tested in a one-

Way ANOVA (owANOVO). Non-normally distributed data was analyzed with the non-

parametric Kruskal-Wallis test. As in Bruinenberg et al. 2016, the statistical analysis was

used to answer if differences were present between WT and PKU mice of each strain and

between genotype of specific strains. When the p-value of the owANOVA was ≤ 0.05, a

Bonforroni post-hoc test was used to examine the differences among these specific groups

(BTBR WT vs. BTBR PKU, B6 WT vs. B6 PKU, BTBR WT vs. B6 WT, and BTBR PKU

vs. B6 PKU). When the Kruskal-Wallis test was ≤ 0.05, a Mann-Whitney U test was used

to examine these differences. If not specified differently, the data is represented as mean ±

standard error of the mean. Tukey’s hinges are used to assess the interquartile range (Q3-

Q1). In the normally distributed data, values outside 1.5 x interquartile range were seen as

outliers and excluded from the statistical analysis.

3. RESULTS

3.1 Activity

Activity was explored in different paradigms within the battery of behavioral paradigms

(Figure 1A/B). In Figure 1A, the average daily activity under home-cage conditions is


50

Chapter 3

depicted (F(3,35)=3.909, p=0.017). No significant differences were found between the PKUs

and WTs of both genetic backgrounds. However, BTBR PKU mice did show a higher activity

than the B6 PKU mice (p=0.018). In Figure 2B, the distance moved through the OF is shown.

This distance is indicative of novelty-induced activity. Here, the BTBR PKU mice covered

less distance compared to the BTBR WT mice (p<0.001), showing a PKU phenotype effect

within the BTBR strain. Furthermore, the BTBR PKU mice moved less than the B6 PKU

mice (p<0.001). No effect of the PKU phenotype was seen in the B6 strain (p=0.097), and no

differences were found between the WTs (p=0.109).

Figure 1 Activity. (A) Passive infrared registration of home-cage activity (arbitrary units) (n=9-10). (B)

The total distance moved in the open field (n=9-10). * p≤0.05; mean±SEM

3.2 Motor performance

To assess motor performance in the mice, the number of correct steps relative to the total

number of steps from the probe trail (100 cm) was calculated. In Figure 2, a clear difference

in this score was shown between PKUs and WTs in both genetic strains (BTBR PKU vs. WT

p<0.001, B6 PKU vs. WT p<0.001). No differences were observed between WTs or PKUs of

both strains (WTs p=0.286, PKUs p=0.475).

Figure 2 Motor performance. The number of correct steps in the balance beam test’s probe trail (100

cm) is expressed as a percentage of the total number of steps necessary to cross the beam (n=9-10). *

p≤0.05; mean±SEM


3

51

Chapter 3

3.3 Anxiety-like behavior

Anxiety-like behavior was examined in two behavioral paradigms, namely the OF and the

EPM (Figure 3A-C). Both mazes used in these behavioral paradigms were designed to offer

the mice sheltered and open areas, i.e. the corners compared to the center in the OF (Figure

3A) and closed arms versus open arms in the EPM. The preference of the animal to seek out

these sheltered locations is thought to represent anxiety-like behavior. In the OF, the groups

differed in time spent in the corners of the arena (F(3,35)=8.511, p<0.001). Both in the

BTBR and B6 background, the PKU mice spent more time in the corners than the WT mice

(BTBR: p=0.014, B6: 0.047). No differences were found between WTs (p=0.199) and PKUs

(p=0.828). In the EPM, the PKU animals of both strains did not seek out the sheltered areas

more than the WT animals, while the B6 PKU mice did spent more time in the closed arms

compared with the BTBR PKU (p=0.003).

Figure 3 Anxiety-like behavior. (A) For Ethovion analysis, the open field was divided in three areas; 1)

corner, 2) border, and 3) center. (B) The time spent in the corners (sum of area 1) of the open field are

depicted (n=9-10). (C) Percentage of time spent in the closed arms of the elevated plus maze (n=9-10).

* p≤0.05; mean±SEM

3.4 Learning and memory

Two learning and memory paradigms were used to examine cognitive performance,

namely NOR and SOR. In both tasks, the ability to identify a novel stimulus by increasing

the exploration above change level was seen as intact ability to master the task. In the

NOR, the BTBR WT mastered the task (t(9)=2.708, p=0.024) but the BTBR PKU did not

(t(9)=1.059, p=0.317). In the B6 WT a trend was observed (t(9)=2.179, p=0.057) but this


52

Chapter 3

tendency was not present in the B6 PKU (t(9)=-0.677, p=0.516). In the SOR, a distinct PKU

phenotype effect was seen in both stains wherein the WTs mastered the task (BTBR WT:

t(9)=3.016, p=0.015, B6 WT: t(9)=4.381, p=0.002) and the PKUs did not (BTBR PKU:

t(9)=0.565, p=0.586, B6 PKU: t(8)=1.084, p=0.310). Overall, trends were observed between

differences between groups (NOR: F(3.36)=2.263, p=0.098, F(3.35)=2.706, p=0.060). No

differences were found in total exploration time in both test phases of the paradigms (NOR:

F(3,36)=1.873, p=0.152, SOR: F(3,33)=2.557, p=0.072).

Figure 4 Learning and memory. (A) Discrimination index of the long-term novel object recognition

(NOR) (n=9-10). A score of zero indicates an equal amount of time spent exploring both objects (B) The

discrimination index of the long-term spatial object recognition (SOR) was corrected for any preference

in location of object at for hand (n=9-10). * p≤0.05, ~ p=0.057 above bars depict statistical analysis

concerning change level; mean±SEM

4. DISCUSSION

In this study, the behavioral phenotype of female PKU mice was assessed in the four

domains; 1) activity, 2) motor performance, 3) anxiety-like behavior, and 4) learning and

memory. In contrast to male PKU mice of both genetic backgrounds1, the effect of the PKU

phenotype of the PKU females of both strains showed a similar outcome (Figure 5). The PKU

phenotype in females was found in motor performance, anxiety-related behavior, and the

learning and memory paradigms. Therefore, this study highlights that the PKU phenotype

of the PKU mouse model is not only influenced by the genetic background1, but can also be

different between males and females. As numerous studies show that males and females can

differ in (brain) morphology, behavior, and physiology, the discussion of this study will only

concentrate on sex differences found in PKU patients. Two hypotheses related to steroid

hormones and neurotransmitter metabolism, and differences in gene expression profiles

between sexes will be considered. Before these topics are discussed, the limitations of the

study will be discussed.


3

53

Chapter 3

4.1. Limitations of the study

In female mice, the fluctuating concentrations of ovarian hormones can influence behavior

in for instance learning and memory16,17. We did not monitor the cycle of the females during

the behavioral paradigms in this study. We assume that mice would be at a random point

in their cycle, as we have tested the females in small groups over a long period of time.

However, we cannot be certain of this. It would be interesting to eliminate sex hormones

to investigate the direct influence of sex hormones on the phenotypical outcome in future

research. Furthermore, including biochemical parameters such as Phe and neurotransmitter

concentration in brain, could give a better understanding of the underlying mechanism of

the gender difference in the phenotypical outcome.

4.2 Differences in the manifestation of PKU between genders.

As in preclinical research, clinical studies investigating gender differences in PKU are limited.

Some of these studies describe gender differences in the outcome parameter, others do not.

For example, no differences were found between PKU males and PKU females in IQ18 or

in gray matter volume of different brain regions19. In contrast, differences were described

in the occurrence of psychiatric disorders, visual attention, dietary control, quality of

life, personality characteristics and behavior18,20–24. The study of Stemerink et al. (2000)

showed that the association between Phe concentrations in plasma and behavioral outcome

is different between males and females (Age range: 8-20 years old)24. In PKU males, a

correlation was found between Phe concentrations measured over a two-year period prior

to evaluation and the clusters introversion and positive-task orientation. In PKU females, the

Phe concentrations of the first two years of life correlated with these clusters24. This finding

could indicate a gender difference in the response to elevated Phe concentrations24. However,

as pointed out by the authors, this result could also be influenced by differences in coping

with the disorder, e.g. differences in social stress associated to PKU or maintaining the

dietary treatment24. In the PKU mouse model, differences are found between sexes in the B6

background but not in the BTBR background. For example, in the BTBR background, both

the male and female BTBR PKU mice showed a PKU phenotype in the learning and memory

paradigms. In the B6 background, only the female PKU mouse model showed behavioral

deficit1. Taken together, our present and previous7 results suggest that (genetic) factors can

influence the phenotypical outcome of PKU.


54

Chapter 3

Male Female

BTBR B6 BTBR B6

Activity

OF

Home-cage activity

Motor performance

BB

Anxiety-like behaviour

OF

EPM

Learning and memory

NOR

SOR

No significant difference

Trend

Significant difference

Figure 5 The comparison between the PKU phenotype of male and female PKU mice. In our previous

study, a PKU phenotype was observed in male BTBR mice in home-cage activity, balance beam (BB),

novel object recognition (NOR), and spatial object recognition (SOR)1. In the male B6, a PKU phenotype

was only observed in the BB and the time spent in the corners of the open field (OF). In this current

study, similar profile was seen in PKU phenotype in female BTBR and B6. Except for the distance moved

trough OF that was only significant different between BTBR WT and BTBR PKU. (EPM=elevated plus

maze)

4.2 Hypothesis 1: Sex hormones and neurotransmitter metabolism

In PKU pathophysiology, disrupted neurotransmitter metabolism plays a key role in the

development of brain dysfunction. In the PKU mouse model (B6) differences are observed

in serotonin, epinephrine, norepinephrine and a metabolite of dopamine between female

mice and male mice, regardless of genotype9. It is not clear if these differences are also

found in the BTBR PKU mouse model. Numerous studies have shown that neurotransmitter

metabolism can be directly influenced by sex hormones. For example, estrogens can affect

the neurotransmission of serotonin and dopamine by influencing concentrations, turnover,

and number and function of receptors25–27. Furthermore, exposure patterns of sex hormones

during development play a key role in the sexual dimorphic development of the brain which,

in turn, can also influence the direct effect of sex hormones later in life28,29. Therefore, the

hypothesis could be raised that different hormonal exposure in (brain) development in

male and female could predispose the sensitivity towards PKU-related changes in males


3

55

Chapter 3

and females differently. However, it is clear from the data we obtained in this study and

the current literature that the gender differences are found in interaction with genetic

background, indicating that the most likely hypothesis includes genetic factors.

4.3 Hypothesis II: Sex differences in gene expression.

Despite similar genome sequences, sexual dimorphism is found in gene expression30.

Approximately 14% of the gene expression in the whole brain of mice is different between

males and females30. This estimation can differ between organs, brain regions and/or

during development30–32. Although sexual dimorphic gene expression does not equal sex

differences in protein levels33, pinpointing gene expression differences could help identify

modifying genes that reduce the impact of PKU-related biochemical changes in B6 PKU male

mice. Especially, future research could investigate the overlap between differences in gene

expression profiles between B6 and BTBR males and between B6 PKU male mice and B6

PKU female mice could narrow the number of genes of interest.

4.4 Conclusion

This study, together with our previous report1, emphasizes that the PKU phenotype is

influenced by many factors including sex and genetic background. Investigating the

underlying mechanisms in which these factors contribute to the PKU phenotype will increase

our understanding of the detrimental effect of PKU. Furthermore, by including females

within studies and as variable in statistical analysis more often, research into the underlying

mechanism and new treatment strategies could further benefit the PKU population.


56

Chapter 3

5. REFERENCES

1 Bruinenberg VM, van der Goot E, van

Vliet D, de Groot MJ, Mazzola PN,

Heiner-Fokkema MR et al. The Behavioral

Consequence of Phenylketonuria in Mice

Depends on the Genetic Background. Front

Behav Neurosci 2016; 10: 233.

2 Beery AK, Zucker I. Sex bias in neuroscience

and biomedical research. Neurosci Biobehav

Rev 2011; 35: 565–72.














2015; 29: 1646–52.



27.




1205–10.

8 Mochizuki S, Mizukami H, Ogura T, Kure

S, Ichinohe A, Kojima K et al. Long-term

correction of hyperphenylalaninemia

by AAV-mediated gene transfer leads to

behavioral recovery in phenylketonuria

mice. Gene Ther 2004; 11: 1081–6.





2014; 111: 452–461.

10 Zagreda L, Goodman J, Druin DP,

McDonald D, Diamond A. Cognitive

deficits in a genetic mouse model of the

most common biochemical cause of human

mental retardation. J Neurosci 1999; 19:

6175–82.






doi:10.1007/8904_2015_498.







One 2015; 10: e0143833.


PN, van Faassen MH, de Blaauw P,

Pascucci T et al. Therapeutic brain

modulation with targeted large neutral

amino acid supplements in the Pah-enu2

phenylketonuria mouse model. Am J Clin

Nutr 2016; 104: 1292–1300.







202–10.





2013; 28: 367–379.


3

57

Chapter 3

16 Sabaliauskas N, Shen H, Molla J, Gong

QH, Kuver A, Aoki C et al. Neurosteroid

effects at α4βδ GABAA receptors alter

spatial learning and synaptic plasticity in

CA1 hippocampus across the estrous cycle

of the mouse. Brain Res 2015; 1621: 170–

86.

17 Hamson DK, Roes MM, Galea LAM. Sex

Hormones and Cognition: Neuroendocrine

Influences on Memory and Learning. Compr

Physiol 2016; 6: 1295–337.

18 Pietz J, Fätkenheuer B, Burgard P,

Armbruster M, Esser G, Schmidt H.

Psychiatric disorders in adult patients with

early-treated phenylketonuria. Pediatrics

1997; 99: 345–50.





Metab 2016; 118: 3–8.

20 Fisch RO, Sines LK, Chang P. Personality

characteristics of nonretarded

phenylketonurics and their family members.

J Clin Psychiatry 1981; 42: 106–13.

21 Cazzorla C, Cegolon L, Burlina AP, Celato

A, Massa P, Giordano L et al. Quality

of Life (QoL) assessment in a cohort of

patients with phenylketonuria. BMC Public

Health 2014; 14: 1243.

22 Smith I, Beasley MG, Wolff OH, Ades AE.

Behavior disturbance in 8-year-old children

with early treated phenylketonuria. Report

from the MRC/DHSS Phenylketonuria

Register. J Pediatr 1988; 112: 403–8.

23 Craft S, Gourovitch ML, Dowton SB,

Swanson JM, Bonforte S. Lateralized

deficits in visual attention in males with

developmental dopamine depletion.

Neuropsychologia 1992; 30: 341–51.

24 Stemerdink BA, Kalverboer AF, van der

Meere JJ, van der Molen MW, Huisman

J, de Jong LW et al. Behaviour and school

achievement in patients with early and

continuously treated phenylketonuria. J


25 Pecins-Thompson M, Brown NA, Bethea

CL. Regulation of serotonin re-uptake

transporter mRNA expression by ovarian

steroids in rhesus macaques. Brain Res Mol

Brain Res 1998; 53: 120–9.

26 Bethea CL, Phu K, Belikova Y, Bethea SC.

Localization and regulation of reproductive

steroid receptors in the raphe serotonin

system of male macaques. J Chem

Neuroanat 2015; 66–67: 19–27.

27 Fink G, Sumner BE, Rosie R, Grace O,

Quinn JP. Estrogen control of central

neurotransmission: effect on mood, mental

state, and memory. Cell Mol Neurobiol

1996; 16: 325–44.

28 Knoll J, Miklya I, Knoll B, Dalló J.

Sexual hormones terminate in the rat The

significantly enhanced catecholaminergic/

serotoninergic tone in the brain

characteristic to the post-weaning period.

Life Sci 2000; 67: 765–773.

29 Espinosa P, Silva RA, Sanguinetti NK,

Venegas FC, Riquelme R, González LF et

al. Programming of Dopaminergic Neurons

by Neonatal Sex Hormone Exposure:

Effects on Dopamine Content and Tyrosine

Hydroxylase Expression in Adult Male

Rats. Neural Plast 2016; 2016: 1–11.

30 Yang X, Schadt EE, Wang S, Wang H,

Arnold AP, Ingram-Drake L et al. Tissue-

specific expression and regulation of

sexually dimorphic genes in mice. Genome

Res 2006; 16: 995–1004.

31 Dewing P, Shi T, Horvath S, Vilain E.

Sexually dimorphic gene expression

in mouse brain precedes gonadal

differentiation. Brain Res Mol Brain Res

2003; 118: 82–90.


58

Chapter 3

32 Vawter MP, Evans S, Choudary P, Tomita

H, Meador-Woodruff J, Molnar M et al.

Gender-specific gene expression in post-

mortem human brain: localization to sex

chromosomes. Neuropsychopharmacology

2004; 29: 373–84.

33 Xu J, Watkins R, Arnold AP. Sexually

dimorphic expression of the X-linked gene

Eif2s3x mRNA but not protein in mouse

brain. Gene Expr Patterns 2006; 6: 146–55.


3

59

Chapter 3


CHAPTER 4Sleep disturbances in Phenylketonuria:an explorative study in men and mice

Vibeke M. Bruinenberg1, Marijke C.M. Gordijn2 , Anita MacDonald3,

Francjan J. van Spronsen4, Eddy A. Van der Zee1

1Molecular Neurobiology, Groningen Institute for Evolutionary Life Sciences

(GELIFES), University of Groningen, Groningen, the Netherlands, 2Chrono@work

B.V. and Chronobiology, Groningen Institute for Evolutionary Life Sciences (GELIFES),

University of Groningen, Groningen, the Netherlands, 3Birmingham Children’s Hospital,

Birmingham, United Kingdom, 4Beatrix Children’s Hospital, University Medical Center

Groningen, Groningen, the Netherlands.

Front Neurol. 2017 Apr 26;8:167. doi: 10.3389/fneur.2017.00167. eCollection 2017.


62

Chapter 4

SUMMARY

Sleep problems have not been directly reported in Phenylketonuria (PKU). In PKU, the

metabolic pathway of phenylalanine is disrupted, which, among others, causes deficits

in the neurotransmitters and sleep modulators dopamine, norepinephrine and serotonin.

Understanding sleep problems in PKU patients may help explain the pathophysiology of

brain dysfunction in PKU patients. In this explorative study we investigated possible sleep

problems in adult treated PKU patients and untreated PKU mice. In the PKU patients,

sleep characteristics were compared to healthy first degree relatives by assessment of sleep

disturbances, sleep-wake patterns, and sleepiness with the help of four questionnaires:

Holland sleep disorder questionnaire, Pittsburgh sleep quality index, Epworth sleepiness

scale, and Munich Chronotype Questionnaire. The results obtained with the questionnaires

show that PKU individuals suffer more from sleep disorders, a reduced sleep quality, an

increased latency to fall asleep, and experience more sleepiness during the day. In the PKU

mice, activity patterns were recorded with passive infrared recorders. PKU mice switched

more often between active and non-active behavior and shifted a part of their resting

behavior into the active period, confirming that sleep quality is affected as a consequence

of PKU. Together, these results give the first indication that sleep problems are present in

PKU. More detailed future research will give a better understanding of these problems which

could ultimately result in the improvement of treatment strategies by including sleep quality

as an additional treatment target.

Keywords (max 6): inherited metabolic disorder; Pahenu2 mice; PKU patients; PKU mice;

neurotransmitters; sleep disorders


4

63

Chapter 4

1. INTRODUCTION

In 2014, Gadoth and Oksenberg reviewed the incidence of sleep and sleep disorders in

patients with inherited metabolic disease (IMD). Although their review focused on sleep-

related breathing disorders among severely affected subjects with IMD, the general title

suggested that sleep problems could be missed or underestimated in these conditions. A

metabolic disease in which brain modulators of sleep are severely affected but attention for

sleep research is very limited is phenylketonuria (PKU). PKU is caused by an inborn error in

the metabolic pathway of phenylalanine (Phe) that disrupts the conversion of Phe to tyrosine.

As a result, Phe concentrations build up in blood and brain and the ability to intrinsically

produce the dopamine precursor tyrosine is lost. These changes do not solely affect the

metabolism of dopamine. Also, reduced concentrations of noradrenaline and serotonin are

found in PKU patients1,2 and in the PKU mouse model3. These neurotransmitters are known

to be important regulators of sleep, wakefulness, and switches between these states4,5.

Nevertheless, these abnormalities in neurotransmitter availability are not specifically linked

to possible sleep problems in PKU research. In PKU research, a few studies have indirectly

investigated sleep regulators or sleep. First, in treated and untreated PKU patients, sleep-

EEG measurements indicate differences in the number of sleep spindles despite similar REM

and non-REM distribution compared to healthy controls6. Second, in early treated PKU

infants (4-18 weeks old), EEG measurements show differences in the development of sleep

compared to healthy controls7. Finally, in the PKU mouse model high levels of orexin A

(hypocretin 1) were reported, a neuropeptide that is associated with wakefulness8,9. This

made the authors suggest hyperactivity in PKU, however, the exact consequence of these

increased levels are not clear while hyperactivity is not consistently described in PKU mice10.

Currently, PKU treatment remains suboptimal in which disturbances in executive functions,

mood, social cognition, and in internalizing problems such as depression and anxiety

are described in early-treated PKU patients11,12. As it is well established that altered sleep

negatively influences cognitive performance, most notably in the domains of executive

functioning13–15, and mood by impacting feelings of depression, anxiety and stress16,17, sleep

related issues could very well serve as an explanation of the PKU brain dysfunction despite

diet and drug treatment.

Understanding the presence and severity of sleep problems in PKU patients and its

pathophysiology could ultimately result in the improvement of treatment strategies

by including sleep quality as an additional treatment target. Therefore, the aim of this

explorative study was to investigate the presence of sleep disturbances in PKU patients with

questionnaires together with analyses of rest/wake patterns in PKU mice, indirectly reflecting

sleep characteristics which could confirm the PKU-specific nature of putative sleep issues

in PKU patients. As sleep is influenced by, among others, genetic factors18–21, first-degree


64

Chapter 4

relatives (FDR) of PKU patients and wild-type (WT) littermates of each genetic strain of the

PKU mouse model were used as controls.

2. MATERIALS & METHODS

2.1. PKU patients

2.1.1. Subjects

In the summer of 2016, participants for this study were recruited by distributing a link to

an electronic survey to subjects associated with the Dutch PKU patient organization. PKU

patients and FDR, who did not do shift work in the past three months, were asked to fill

out four questionnaires with ten additional questions (date of birth, zip code, gender, height,

bodyweight, PKU or control, treatment of PKU, other health issues, smoking, and the use of

sleep promoting drugs). All participants were informed about the scientific purpose of the

study and agreed to participate. They completed the questionnaires completely anonymous.

To ensure that the questionnaires were not completed by the same individuals more than

once, the submissions were checked for uniqueness, focusing on date of birth and IP address.

In total, 47 subjects of which 25 PKU patients and 23 controls participated. The Medical

Ethics Review Committee (METC) of the University of Groningen concluded that the

Medical Research Involving Subjects Act did not apply to this study.

2.1.2. Sleep questionnaires

Four validated questionnaires were included in the survey: (1) Holland Sleep Disorders

Questionnaire (HSDQ)22; 40 items, (2) Pittsburgh Sleep Quality Index (PSQI)23; 19 items, (3)

Epworth Sleepiness Questionnaire (ESS)24; 8 items. (4) Munich Chronotype Questionnaire

(MCTQ)25; 16 items. Firstly, the HSDQ gives a general score to identify the possible

occurrence of a sleep disorder and can differentiate between six main categories of sleep

disorders (insomnia, parasomnia, circadian rhythm sleep disorders (CRSD), hypersomnia,

sleep-related movement disorders such as for instance restless legs syndrome, and sleep-

related breathing disorder)22. Secondly, for the PSQI, seven component scores can be

derived (subjective sleep quality, sleep latency, sleep duration, habitual sleep efficiency, sleep

disturbances, use of sleep medication, and daytime dysfunction) and computed to a global

score23. Thirdly, the ESS is used to examine sleepiness during the day (for instance during

reading)24. Finally, the MCTQ was used to identify chronotype (the preferred timing of

sleep) calculated by taking the mid-point of sleep on free days corrected for the sleep debt

acquired during working days26.

2.2 PKU mouse study

To investigate the rest/wake pattern in PKU mice, the home-cage activity of adult (4-7

months) WT and PKU mice of BTBR and C57Bl/6 (B6) background was monitored. Both

genetic strains of the PKU mouse model have a point mutation in the gene encoding for


4

65

Chapter 4

phenylalanine hydroxylase (PAH) causing Phe to rise in blood and brain10. The PKU model

was originally described for the BTBR background but the model was latter crossed back

on to the C57Bl/6J background. Currently, both genetic strains are used in PKU research.

In-house heterozygous mating pairs were used to breed the following groups of mice:

BTBT WT, BTBR PKU, B6 WT, and B6 PKU. These mice were weaned on post-natal day

28 and genotype was established with quantitative PCR10. The experiment consisted of a

habituation phase and a data acquiring phase. After a seven-day habituation phase, the

activity of individual housed mice (cage: 33x15x14cm with nesting material and paper

role) were monitored for seven days with passive infrared detectors (PIR). During the whole

experiment, animals were on a 12/12 light/dark cycle and had ad libitum access to water and

normal chow (RMH-B 2181, ABdiets, Phe: 8.7 g/kg). Data was analyzed with ACTOVIEW

(made in-house, described in 27). This program calculated the average daily activity, diurnality

((Sum activity light phase- sum activity dark phase)/ total activity) and fragmentation28 from

the files produced by the activity management system (CAMS) collected from the PIR. All

proceedings were carried out in accordance to the Guide for the Care and Use of Laboratory

Animals of the National Institutes of Health (The ARRIVE Guidelines Checklist) approved

by the Institutional Animal Care and Use Committee of the University of Groningen.

2.3 Statistics

The statistical analysis was executed with the statistical software IBM SPSS Statistics for

Windows, Version 22.0 (Armonk, NY: IBM Corp.). Within this program the Shapiro-Wilk

was used to test normality of the data. The activity of the mice was normally distributed and

a multi-variate ANOVA was used to test the factors group and gender of overall activity,

fragmentation and diurnality. Differences in group characteristics in the patient study were

not normally distributed and therefore tested with the non-parametric Mann-Whitney U

test. The chronotype score of the MCTQ, normally distributed, was tested with a univariate

ANOVA for group. Age and gender were included as cofactors. The ordinal nature of the

HSDQ, PSQI and ESS scores, made it not possible to test confounding factors parametrically.

Therefore, gender and age were explored with generalized linear models, using an ordinal

model. Differences in the frequency of occurrence of sleep disorders was also tested with a

generalized linear model, using a binary model. Non-parametric Levene’s test was used to

test the homogeneity of the data.

3. RESULTS

3.1 PKU patients

3.1.1. Subjects

This study is a pilot study serving as a proof-of-concept for sleep-related issues due to PKU.

For this reason, individuals were included when they correctly filled out at least one of the

questionnaires. Not all questionnaires were correctly filled out by all subjects which resulted


66

Chapter 4

in different group characteristics for each questionnaire (Table 1). For all questionnaires

responses, the FDR controls were significantly older than the PKU subjects (HSDQ:

p<0.05, PSQI: p<0.05, ESS: p<0.05, MCTQ: p<0.05) but no differences were found in BMI

(HSDQ: p=0.68, PSQI: p=0.92, ESS: p=0.99, MCTQ: p=0.90). Furthermore, no significant

differences were found in gender distribution of the groups (HSDQ: t(44)=-0.603, p=0.55,

PSQI: t(35)=0.172, p=0.87, ESS: t(37)=0.143, p=0.89 , MCTQ: t(39)=-0.260, p=0.80). One

FDR control was excluded because she used several sleep-promoting drugs (Trazodon and

zolpidem tartrate).

3.1.2 Frequency of sleep disorders.

The global score of the HSDQ is used to identify the presence of a sleep disorder with an

overall accuracy of 88% (κ: 0.75)22. In PKU patients, 48 % had a global score above the

cut-off of 2.02, indicative of a sleep disorder, compared to 19 % of FDR controls (Fig.

1A: b=1.367, Wald χ2(1,N=46)=3.983, p<0.05). Especially, among the six main sleep

disorder categories, PKU patients had a higher score for both insomnia and CRSD (Fig

1B: b=-1.527, Wald χ2(1,N=46)=7.626, p<0.05, Fig 1C: b=-1.593, Wald χ2(1,N=46)=8.115,

p<0.05, respectively), but not for the other four categories (parasomnia; b=-0.985, Wald

χ2(1,N=46)=2.941, p=0.086, hypersomnia; b=-0.985, Wald χ2(1,N=46)=3.287, p=0.070,

restless legs syndrome; b=-0.696, Wald χ2(1,N=46)=1.757, p=0.185 and sleep-related

breathing disorder; b=-0.693, Wald χ2(1,N=46)=1.688, p=0.194). Age and gender did not

significantly contribute to these models. These results reveal a higher frequency of sleep

disorders, more specifically insomnia and CRSD, in PKU patients.

3.1.3 Sleep quality

The global PSQI, comprised of seven sleep related components, is used to classify poor (>5)

and good sleepers (≤5). This global score was significantly higher in the PKU patients of

which more people were classified as poor sleepers (57%) compared to the FDR controls

of which 25% were classified as poor sleepers (Fig. 2A: b=-1.674, Wald χ2(1,N=37)=7.102,

p<0.05). Within the global score, two component scores differed between PKU patients

and FDR controls. The first was the component score for latency to fall asleep which was

significantly increased in PKU patients (FDR: 0.44±0.63, PKU: 1.43±0.98, b=-2.306, Wald

χ2(1,N=37)=9.733, p<0.05). The second one was the component score for subjective sleep

quality. This score was computed from the question in which subjects could indicate their

quality of sleep during the past month on a scale of very good (score 0) to very bad (score

3). This score was significantly higher in PKU patients than in the FDR controls (FDR:

0.69±0.60, PKU: 1.38±0.92, b=-1.655, Wald χ2(1,N=37)=5.516, p<0.05). Age and gender

did not significantly contribute to these models. These results suggest that sleep quality is

reduced in PKU patients compared to FDR controls.


4

67

Chapter 4

Tab

le 1

. Sub

ject

cha

ract

eris

tics

. Dat

a is

pre

sent

ed a

s mea

n ±

stan

dard

dev

iati

on. A

bbre

viat

ions

: F=f

emal

e, M

=mal

e, H

SDQ

= H

olla

nd S

leep

Dis

orde

rs Q

uest

ionn

aire

,

PSQ

I=Pi

ttsb

urgh

Sle

ep Q

ualit

y In

dex,

ESS

=Epw

orth

Sle

epin

ess

Que

stio

nnai

re,

MC

TQ

=Mun

ich

Chr

onot

ype

Que

stio

nnai

re,

PKU

= ph

enyl

keto

nuri

a pa

tien

ts,

FDR

-con

trol

= fir

st d

egre

e re

lati

ves-

cont

rol

HSD

QPS

QI

ESS

MC

TQ

PKU

FDR

-con

trol

PKU

FDR

-con

trol

PKU

FDR

-con

trol

PKU

FDR

-con

trol

Num

ber

2521

2115

2217

2417

Age

29.2

± 8

.844

.2 ±

10.

130

.1 ±

9.0

46.6

± 1

029

.6 ±

9.1

45.9

± 1

0.1

29.0

± 8

.945

.9 ±

10.

1

BM

I24

.1 ±

4.3

25.0

± 5

.124

.5 ±

4.3

24.8

± 5

.624

.6 ±

4.2

24.6

± 4

.224

.4 ±

4.1

24.6

± 4

.2

Gen

der

17F/

8M

16F/

5M

15F/

6M

11F/

4M

16 F

/6 M

12 F

/ 5M

16F/

8M

12 F

/ 5M

Smok

ing

41

41

41

41

Hea

th is

sues

50

40

40

50

Slee

p-pr

omot

ing

drug

s5

05

05

05

0

KU

VA

N3

22

3

KU

VA

N+p

rote

in r

estr

icte

d4

33

3

Prot

ein

rest

rict

ed22

1617

18


68

Chapter 4

3.1.4. Sleepiness during the day

In the ESS, the participant subjectively rate the chance of dozing off during eight situations

from “none” (score 0) to “high” (score 3). This score is significantly higher in PKU patients

than FDR controls (Fig 2B: (b=-1.608, Wald χ2(1,N=39)=6.597, p<0.05). A main effect of

age and gender did not contribute significantly to the model. These results suggest that PKU

patients experience more sleepiness during daytime.

3.1.5. Chronotype.

In the MCTQ, the sleep schedules of the participants on working and non-working days

were asked. From this data, we could calculate chronotype, defined as the mid-sleep on free

days corrected for the potential sleep debt acquired during the working days26. Chronotype

is dependent on age and gender26, therefore, statistical analysis included age and gender as a

cofactor. No significant differences were found between chronotype scores in PKU patients

and FDR controls or for any of the cofactors in the complete model (Group: F(1,37)=1.287,

p=0.26, Gender: F(1,37)=0.954, p=0.34, Age: F(1,37)=1.941, p=0.17).

3.2. PKU mice

3.2.1 Rest/wake patterns.

No main or interaction effects were observed for sex in all parameters, therefore, data of

males and female were grouped. The fragmentation score is indicative of the frequency that

active behavior is switched to non-active behavior and vice versa. In PKU mice, in both

strains, the fragmentation score was increased compared to WT (Fig. 3A; F(3,56)=10.803,

p<0.05, BTBR p<0.05, p<0.05). Although differences were found in overall activity between

the WT’s of each strain (BTBR WT: 3162.46±1239.24, B6 WT: 2193.69±785.91 (mean±SD)

F(3,56)=3.858, p<0.05, BTBR WT vs B6 WT p=0.019), the increase in fragmentation

score found in PKU mice did not coincide with a change in overall activity (BTBR PKU:

2655.42±605.23, B6 PKU: 2306.90±860.06, BTBR p=0.67, B6 p=1.000). However, a shift

did occur in the timing of the rest/active behavior. The negative diurnality score, reflecting

night activity in animals, became less negative in PKU mice (Fig. 3B; F(3,56)=8.235, p<0.001,

BTBR p<0.05, B6 p<0.05). These results reveal that PKU mice have increased fragmentation

and a shift in diurnality (more inactive in active phase).


4

69

Chapter 4

Figure 1. HSDQ (A) Results from the global score of HSDQ indicate that 48% of the PKU patients

have a sleep disorder compared to 19% of the FDR controls. (B) PKU patients have a significant higher

insomnia score than FDR controls. Six PKU patients are above the cut-off score compared to zero FDR

controls (C). Although only two PKU patients are above the cut-off score, PKU patients have significant

higher CRSD score compared to FDR controls. Data represents individual scores with median. Dotted

line represents cut-off score between having sleep problem or not. ** p<0.01

Figure 2. PSQI and ESS. (A) The global score of the Pittsburgh Sleep Quality Index (PSQI) was

significantly higher in PKU patients compared to FDR control. The dotted line represents the cut-off

between good and poor sleepers. 57% of the PKU patients are above this cut-off and categorized as

poor sleepers. (B) Epworth Sleepiness Questionnaire (ESS). Patients experience more sleepiness during

the day than FDR controls. Data represents individual scores with median. * p<0.05, ** p<0.01


70

Chapter 4

Figure 3. Characteristics of the rest/wake pattern in mice (A) In both genetic strains of the PKU mouse

model, an increase in fragmentation is seen in the PKU mice compared to WT littermates. Furthermore,

a significant difference is found between the fragmentation score of PKU mice of each strain. (B) In the

graph negative diurnality scores are observed. This indicates that we are investigating animals which

are active in the dark. PKU mice have a less distinct negative score suggesting that they shift part of

their resting behavior into the light phase. Data are depicted as mean ± standard error of the mean. *

p<0.05, ** p<0.01

4. DISCUSSION

In this explorative study, we investigated sleep characteristics in PKU patients with

questionnaires and analyzed the rest/wake patterns in PKU mice. In the PKU patients study,

we showed that PKU patients compared to FDR controls have more sleep disorders, a reduced

sleep quality, an increased latency to fall asleep, and experience more sleepiness during the

day. In the PKU mice, we found an increase in fragmentation and a shift in diurnality. The

increase in fragmentation indicated that the PKU mice switch more often between active and

non-active behavior. This score did not coincide with changes in overall activity. In addition,

PKU mice shift a part from their resting behavior into the active phase (a shift in diurnality).

Both experiments strongly support the hypothesis that sleep is affected in PKU. This seems

to be directly related to the disorders as the deficits were found in both PKU mouse strains

despite their genetic differences and cognitive sensitivity to the PKU condition10.

4.1. Study limitations

Sleep is influenced by, among others, genetic factors, age, and gender 18–21. For this reason,

this study recruited FDR of PKU patients as control group. No differences were found in

gender distributions between the groups, but differences were found in age between FDR

controls and PKU patients. Although we recognize these limitations, we believe that it does

not hamper our results obtained in the first three questionnaires (HSDQ, PSQI, ESS) for the

following reason. Literature shows either no effect or a deterioration of sleep with aging. For


4

71

Chapter 4

example, the PSQI is not affected by age29. The ESS score is influenced by an age x gender

interaction, wherein females tend to have higher scores between 0-39 age group compared

to males30. Around the ages 40-49, the ESS score of males deteriorates reaching the same ESS

score as females. Therefore, the ESS score is either higher or stays constant with increasing

age30. This implies that the higher scores found in the younger PKU patients compared to

the older FDR controls are contrary to what would be expected and likely reflect a real

indication of sleep problems in PKU patients. Moreover, no significant effect of age was

found in our study.

4.2 Sleep characteristics are altered in PKU

The different measurements of sleep used in this study reveal a variety of sleep problems

and show some specifically affected characteristics of sleep. In the HSDQ, PKU patients

show a higher incidence in sleep disorders, but only in the main categories insomnia and

CRSD scores were higher in PKU patients than in FDR controls. CRSD were changed to

circadian rhythm sleep-wake disorders (CRSWD) in the third edition of the International

classification of sleep disorders31. CRSWD are sleep disorders grouped under dyssomnias, a

group of sleep disorders which show insomnia, excessive sleepiness, or difficulty initiating

or maintaining sleep31. In the current study, we found an increased score for insomnia and

an increased sleepiness during the day in the ESS in PKU patients, supporting the idea that

PKU patients experience problems specific for this cluster of sleep disorders. CRSWD are

disorders related to the timing of sleep31. Some are a consequence of external circumstances,

e.g. shift work or jet lag, others have potentially a more internal, neurological basis, e.g.

delayed sleep phase syndrome (DSPS). In DSPS, the latency to fall asleep opposed to the

desired time to fall asleep is delayed. DSPS patients experience difficulties to shift their sleep/

wake pattern to an earlier time point in response to environmental time cues, for example

traveling from Europe to Asia, and do not experience sleepiness when they are able to sleep

at their desired time, as is possible for instance during a holiday or vacation period. In this

study, we showed that PKU patients report an increased latency to fall asleep in the PSQI.

However, we did not see a difference in the midsleep on non-working days when age was

a cofactor. This could be because midsleep is strongly influenced by age and the age was

not distributed evenly over the full width of both groups26. Therefore, an important future

direction is to compare age-matched controls to PKU patients. Further research in PKU

should focus on 1) more objective measurements of sleep such as polysomnography, or sleep-

wake rhythm analysis with 2) phase shift experiments in PKU mice to identify problems in

shifting sleep/wake patterns (and neurological substrates), 3) monitoring sleepiness during

the day specifically during holidays, and 4) core body temperature and dim-light melatonin

rhythm monitoring to investigate if PKU patients experience a blunted or delayed internal

rhythm of physiological markers.


72

Chapter 4

4.3 The switch between sleep and wakefulness is defective in PKU

The HSDQ identifies sleep disorders and attribute certain scores to six symptom clusters. These

clusters may be due to different sleep disorders, possibly with different pathophysiological

mechanism. For instance, the comorbidity of insomnia with other sleep disorders is very

high22. The PKU mouse study did identify a more specific aspect of sleep, namely increased

fragmentation. In general, an increased fragmentation score indicates an increase in

switching behavior. Switching between sleep and wakefulness is thought to be regulated by a

flip-flop switch that results from mutual inhibition of sleep-promoting pathways and wake-

promoting pathways32. Several cholinergic and monoaminergic projections are important

in these pathways, such as serotonin, norepinephrine, and dopamine32. As these latter

neurotransmitters are affected in PKU mice (and in untreated PKU patients), it could be that

the increased fragmentation score is a consequence of disruptions in this switch. In early-

treated patients on diet, neurotransmitter deficiencies in dopamine and serotonin are still

present2. These deficiencies could possibly affect the switch between sleep and wakefulness

and cause fragmentation of the sleep/wake rhythm in PKU patients, more difficulty falling

asleep and as a consequence daytime sleepiness.

4.4. Conclusion

This explorative study is the first to investigate sleep disturbances both in PKU patients and

PKU mice. In PKU patients, we demonstrate more sleep disorders, a reduced sleep quality,

an increased latency to fall asleep, and more sleepiness during the day. We show in PKU mice

an increased fragmentation and a shift in diurnality. These results produce the first evidence

to suggest that sleep problems occur in PKU. The resulting complaints associated with

altered sleep are comparable to the cognitive symptoms described for early and continuously

treated PKU patients. More detailed future research will give a better understanding and

further identify sleep problems in PKU which could ultimately result in the improvement of

treatment strategies by including sleep quality as an additional treatment target.

ACKNOWLEDGEMENTS

The authors would like to thank Dr. Marina C. Giménez for her help with the electronic

survey.


4

73

Chapter 4

5. REFERENCES

1 McKean CM. The effects of high

phenylalanine concentrations on serotonin

and catecholamine metabolism in the

human brain. Brain Res 1972; 47: 469–76.

2 Burlina AB, Bonafé L, Ferrari V, Suppiej

A, Zacchello F, Burlina AP. Measurement

of neurotransmitter metabolites in the

cerebrospinal fluid of phenylketonuric

patients under dietary treatment. J Inherit

Metab Dis 2000; 23: 313–6.







Nutr 2016; 104: 1292–1300.

4 Holst SC, Valomon A, Landolt H-P. Sleep

Pharmacogenetics: Personalized Sleep-Wake

Therapy. Annu Rev Pharmacol Toxicol

2016; 56: 577–603.

5 Eban-Rothschild A, Rothschild G,

Giardino WJ, Jones JR, de Lecea L. VTA

dopaminergic neurons regulate ethologically

relevant sleep–wake behaviors. Nat

Neurosci 2016; 19: 1356–1366.

6 Schulte FJ, Kaiser HJ, Engelbart S,

Bell EF, Castell R, Lenard HG. Sleep

patterns in hyperphenylalaninemia: a

lesson on serotonin to be learned from

phenylketonuria. Pediatr Res 1973; 7: 588–

99.

7 De Giorgis GF, Nonnis E, Crocioni

F, Gregori P, Rosini MP, Leuzzi V et

al. Evolution of daytime quiet sleep

components in early treated phenylketonuric

infants. Brain Dev; 18: 201–6.

8 Surendran S, Rady PL, Szucs S, Michals-

Matalon K, Tyring SK, Matalon R.

High level of orexin A observed in the

phenylketonuria mouse brain is due to the

abnormal expression of prepro-orexin.

Biochem Biophys Res Commun 2004; 317:

522–6.

9 Surendran S, Campbell GA, Tyring SK,

Matalon K, McDonald JD, Matalon R.

High levels of orexin A in the brain of the

mouse model for phenylketonuria: possible

role of orexin A in hyperactivity seen in

children with PKU. Neurochem Res 2003;

28: 1891–4.













12 Waisbren SE, Noel K, Fahrbach K, Cella C,

Frame D, Dorenbaum A et al. Phenylalanine

blood levels and clinical outcomes in

phenylketonuria: a systematic literature

review and meta-analysis. Mol Genet Metab

2007; 92: 63–70.

13 Banks S, Dinges DF. Behavioral and

physiological consequences of sleep

restriction. J Clin Sleep Med 2007; 3: 519–

28.

14 Couyoumdjian A, Sdoia S, Tempesta D,

Curcio G, Rastellini E, DE Gennaro L et al.

The effects of sleep and sleep deprivation

on task-switching performance. J Sleep Res

2010; 19: 64–70.


74

Chapter 4

15 Goel N, Rao H, Durmer JS, Dinges DF.

Neurocognitive consequences of sleep

deprivation. Semin Neurol 2009; 29: 320–

39.

16 Short MA, Louca M. Sleep deprivation leads

to mood deficits in healthy adolescents.

Sleep Med 2015; 16: 987–93.

17 Meerlo P, Havekes R, Steiger A. Chronically

restricted or disrupted sleep as a causal

factor in the development of depression.

Curr Top Behav Neurosci 2015; 25: 459–

81.

18 Lind MJ, Aggen SH, Kirkpatrick RM,

Kendler KS, Amstadter AB. A Longitudinal

Twin Study of Insomnia Symptoms in

Adults. Sleep 2015; 38: 1423–30.

19 Barclay NL, Gregory AM. Quantitative

genetic research on sleep: A review of

normal sleep, sleep disturbances and

associated emotional, behavioural, and

health-related difficulties. Sleep Med Rev

2013; 17: 29–40.

20 Gottlieb DJ, O’Connor GT, Wilk JB.

Genome-wide association of sleep and

circadian phenotypes. BMC Med Genet

2007; 8: S9.

21 Paine S-J, Gander PH, Harris R, Reid P.

Who reports insomnia? Relationships with

age, sex, ethnicity, and socioeconomic

deprivation. Sleep 2004; 27: 1163–9.

22 Kerkhof GA, Geuke MEH, Brouwer A,

Rijsman RM, Schimsheimer RJ, Van Kasteel

V. Holland Sleep Disorders Questionnaire:

a new sleep disorders questionnaire based

on the International Classification of Sleep

Disorders-2. J Sleep Res 2013; 22: 104–7.

23 Buysse DJ, Reynolds CF, Monk TH, Berman

SR, Kupfer DJ. The Pittsburgh Sleep Quality

Index: a new instrument for psychiatric

practice and research. Psychiatry Res 1989;

28: 193–213.

24 Johns MW. Reliability and factor analysis

of the Epworth Sleepiness Scale. Sleep 1992;

15: 376–81.

25 Roenneberg T, Kuehnle T, Juda M,

Kantermann T, Allebrandt K, Gordijn M

et al. Epidemiology of the human circadian

clock. Sleep Med Rev 2007; 11: 429–38.

26 Roenneberg T, Kuehnle T, Pramstaller PP,

Ricken J, Havel M, Guth A et al. A marker

for the end of adolescence. Curr Biol 2004;

14: R1038–R1039.





2013; 28: 367–379.

28 van Someren EJ, Hagebeuk EE, Lijzenga

C, Scheltens P, de Rooij SE, Jonker C et al.

Circadian rest-activity rhythm disturbances

in Alzheimer’s disease. Biol Psychiatry 1996;

40: 259–70.

29 Grandner MA, Kripke DF, Yoon I-Y,

Youngstedt SD. Criterion validity of the

Pittsburgh Sleep Quality Index: Investigation

in a non-clinical sample. Sleep Biol Rhythms

2006; 4: 129–139.

30 Boyes J, Drakatos P, Jarrold I, Smith J, Steier

J. The use of an online Epworth Sleepiness

Scale to assess excessive daytime sleepiness.

Sleep Breath 2016. doi:10.1007/s11325-

016-1417-x.

31 American Academy of Sleep Medicine.

International Classification of Sleep

Disorders – Third Edition (ICSD-3). 2014.

32 Saper CB, Fuller PM, Pedersen NP, Lu J,

Scammell TE. Sleep State Switching. Neuron

2010; 68: 1023–1042.


4

75

Chapter 4


CHAPTER 5A novel treatment strategy for phenylketonuria:

exploring the possibilities of nutrients to improve brain function

Vibeke M.Bruinenberg1, Priscila N. Mazzola1,2, Danique van Vliet2,

Danielle S. Counotte3, Maryam Rakhshandehroo3, Mirjam Kuhn3,

Francjan J. van Spronsen2, Eddy A. van der Zee1



University Medical Center Groningen, Groningen, the Netherlands, 3Nutricia Research,

Nutricia Advanced Medical Nutrition, Utrecht, the Netherlands


78

Chapter 5

Abbreviations

AA Arachidonic acid

BDNF Brain-derived neurotrophic factor

EPA Eicosapentaenoic acid

GABA Gamma-aminobutyric acid

HMGR 3-hydroxy-3-methylglutaryl coenzyme A reductase

LIMK1 LIM kinase 1

LNAA Large neutral amino acids

PAH Phenyalanine hydroxylase

Phe Phenylalanine

PKU Phenylketonuria

Rac 1 Ras-related C3 botulinum toxin substrate 1

ROS Reactive oxygen species

TPH-2 Tryptophan hydroxylase 2

Trp Tryptophan

Tyr Tyrosine

UMP Uridine-5’-monophosphate


5

79

Chapter 5

ABSTRACT

Phenylketonuria (PKU) is an inherited metabolic disorder where disrupted conversion of

Phe into tyrosine leads to accumulation of phenylalanine (Phe) in blood and brain. Increased

Phe impairs brain functioning by negatively affecting four domains: neurotransmitter

metabolism, white matter integrity, oxidative balance, and synapse functioning. Traditionally,

PKU treatment aims to lower blood Phe concentrations, however, because treatment is often

difficult to maintain, blood Phe concentrations can rise and fluctuate in PKU patients.

Therefore, a treatment strategy focusing on relieving the Phe effects on brain functioning

by means of specific nutrients could yield new treatment possibilities. In this review, the

possibility of an additional nutritional intervention for PKU is presented through reviewing

the beneficial effects of nutritional components in the healthy or diseased brain in these four

domains. Based on the described positive effects in the non-PKU-literature, the hypothesized

alternative nutritional treatment for PKU should include omega-3 fatty acids, B-vitamins,

and antioxidants.


80

Chapter 5

1. INTRODUCTION

Hippocrates stated, “Let food be thy medicine and medicine be thy food”. This statement

illustrates the age-old belief that food can be used to treat a disease. In recent years, the

concept that nutrition can be used to aid cognition and cognitive disorders, has regained

more attention1,2. The rapid increase in research and thereby knowledge has raised awareness

into the widespread possibilities of different nutritional components as a treatment strategy

for disorders affecting neurocognition.

If any disease should be addressed in which the importance of nutrition has been recognized

at an early stage, it is phenylketonuria (PKU; OMIM # 261600). This inherited metabolic

disease is caused by mutations in the gene encoding for the hepatic enzyme phenylalanine

hydroxylase (PAH) responsible for converting phenylalanine (Phe) into tyrosine (Tyr). The

loss of functionality of the enzyme results in high concentrations of Phe in blood and brain.

These increased concentrations of Phe can affect four domains of brain functioning through

1) disrupting the neurotransmitter metabolism of especially serotonin and dopamine3,

2) altering the white matter integrity4, increasing oxidative stress5, and affecting synapse

functioning6. In untreated patients, this results in mental disablement, problems with

movement, and seizures7. To minimize these consequences, current dietary treatment aims

to severely restrict Phe intake as early as possible with a protein restricted diet plus an

artificial amino acid mixture. Despite this treatment, subtle and specific deficits in cognitive

functioning, such as processing speed, attention, and working memory are found in early-

treated PKU patients8,9. The association between Phe concentrations and symptomology

in patients, treated and untreated, is well established7. Therefore, treatment strategies

in PKU traditionally have focused on lowering Phe concentrations. However, as current

dietary treatment is often difficult to maintain, Phe concentrations can rise and fluctuate

in PKU patients10. An alternative intervention strategy focusing on reducing the functional

consequences of high Phe on the four above mentioned domains by means of specific

nutrients could be of great interest.

Applying nutrients to aid brain functioning was examined, among others, by the Wurtman lab.

This resulted in a specific formulation of nutrients registered as Fortasyn ® Connect (FC)11.

FC includes the omega-3 PUFAs DHA and EPA, but also choline, UMP, phospholipids, folic

acid, vitamins B6, B12, C, E, and selenium12. These nutrients constitute the precursors and

cofactors for the formation of membranes through the biosynthetic “Kennedy pathway”13,

and dietary supplementation with these nutrients has been shown to improve brain function

(for review 12).

In this review, the affected four functional domains neurotransmitter metabolism, white

matter integrity, oxidative stress, and synaptic functioning will be discussed. Hereafter, these


5

81

Chapter 5

domains will be discussed in light of possible targets of nutrients present in FC to battle

PKU-specific damage to them. Literature concerning these nutrients in PKU patients and/or

models of the disease is limited. Therefore, particularly nutrients that have beneficial effects

in the healthy or diseased brain other than PKU will also be discussed as potential candidates

to relieve cognitive deficits in PKU.

2. THE AFFECTED DOMAINS:

2.1 Neurotransmitter metabolism

The deficiency in the conversion of Phe to Tyr causes problems with neurotransmitter

metabolism via different routes. Besides the poor intrinsic synthesis of Tyr, high blood Phe

levels interfere with the brain’s availability of other large neutral amino acids (LNAAs),

including Tyr and Tryptophan (Trp), via interfering with transport over the blood-brain

barrier 14,15. In a direct matter, reduced Tyr availability in the brain leads to impaired

dopamine synthesis, as Tyr is the amino acid precursor for dopamine. Indirectly, Phe impairs

the availability of other LNAAs such as Trp, therefore diminishing the synthesis of serotonin,

which has Trp as its precursor. Moreover, high brain Phe concentrations inhibit the activity

of the enzymes Tyr- and Trp hydroxylases that are important for the rate-limiting steps in

the conversion of Tyr and Trp to dopamine and serotonin, respectively16. Indeed, lower

than normal levels of dopamine and serotonin metabolites have been observed in the CSF

of PKU patients3. In addition, reduced levels of monoamines (serotonin, dopamine and

norepinephrine) have been shown in the brain of mouse models of PKU17–21.

2.2 White matter integrity

Myelin alterations in PKU, first reported in 195022, have become a consistent feature of PKU

in vitro and in vivo models, untreated, and treated PKU patients4,23. In patients, metabolic

control expressed as plasma Phe, brain Phe, and the fluctuations in Phe during the life time

is associated with the degree of white matter abnormalities4,24–28. Nevertheless, the exact

influence of Phe on myelin is not clear yet. For instance, in cell culture, oligodendrocytes

subjected to high concentrations of Phe switch phenotype from a myelinated to a non-

myelinated form29. However, Phe and/or the metabolites of Phe (phenylpyruvate, and

phenylacetate) do not affect oligodendrocyte progenitor cell proliferation (development),

oligodendrocyte migration (function) nor induce mortality of oligodendrocytes (survival)30.

This indirect effect could be via the effect of Phe on cholesterol and protein synthesis. Both

processes are necessary for the production and maintenance of myelin sheaths. Cholesterol

synthesis is affected through the negative effect of Phe on the rate-controlling enzyme,

3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR). Both in PKU mice as well as in

Phe-exposed oligodendrocyte cultures, the activity of this enzyme is reduced 31. The negative

effect of Phe on protein synthesis is confirmed in vitro and in vivo in the PKU mouse model

and in PKU patients32–34. High concentrations of Phe, initiated by the PAH inhibitor alpha-


82

Chapter 5

methylphenylalanine, are suggested to influence protein synthesis through inhibiting protein

synthesis initiation and protein elongation34,35. Taken together, the myelin deficits found in

PKU are more likely to be caused by the effect of Phe on cholesterol and protein synthesis

rather than by a direct effect of Phe on oligodendrocytes. This does not exclude other direct

effects of Phe on myelin.

2.3 Oxidative stress

Oxidative stress plays a role in the pathogenesis of several neurocognitive disorders and has

been studied in PKU (reviewed by Ribas et al.5). Oxidative stress is an imbalance between

(increased) production and/or (decreased) removal of reactive species. This imbalance can be

caused by accumulation of reactive species and/or decreased antioxidant defense. Multiple

arguments support the potential role of oxidative stress in the pathophysiology of PKU.

Firstly, the accumulation of Phe together with its metabolites can increase the generation

of reactive species mostly derived from oxygen (reactive oxygen species, ROS), that in turn

can react with biomolecules causing oxidative damage to proteins, lipids, carbohydrates,

and DNA. As a consequence, cell injury or even cell death can occur. Secondly, in general,

compared with other organs, the brain is especially susceptible to oxidative stress due to its

relatively poor antioxidant defense and its high oxygen consumption36. Thirdly, the Phe-

restricted diet may hamper the intake of antioxidants and/or their precursors in treated

patients, leading to oxidative stress by reducing antioxidant defenses5,37. Finally, metabolites

of Phe inhibit antioxidant enzymes38,39. These arguments are supported by several findings

confirming the presence of oxidative stress within PKU, shown in vitro37,40,41, in the brains of

animal models of PKU (chemically-induced hyperphenylalaninemia rat model:40–43; genetic

PKU mouse model BTBR:44,45; C57BL/6:46), and in plasma of patients47–52. Furthermore,

antioxidant defenses are lower in PKU patients by means of lower activity of antioxidant

enzymes, higher biomolecule damage and lower availability of antioxidants in blood49,50,53–55.

2.4 Synapse functioning

Together with the previously discussed myelination problems, Bauman and Kemper 56(1982)

reported morphological changes in dendritic arborizations and reduced numbers of synaptic

spines in untreated PKU patients. Likewise, in treated PKU patients, reduced synaptic or

neuronal density is suggested because of the reduced grey matter found in specific regions

of the brain57. Generally, the altered synaptic functioning in PKU is demonstrated by 1)

changes in synaptic morphology, 2) reduced expression of proteins involved in synaptic

functioning, and 3) functional outcome changes (synaptic efficacy). The first aspect is

supported with research, in vivo and in vitro, showing a decreased number of synapses,

reduced width of the synaptic cleft, reduced thickness of the post-synaptic density, altered

arborization of dendritic trees, and reduced neurite length 44,58–61. A causal role of Phe on

these structural changes was found through the effect of Phe on the pathway important

for dendritic elongation and arborization, F-actin remodeling of the cytoskeleton. High


5

83

Chapter 5

concentrations of Phe in vitro affects F-actin remodeling through reducing the expression

of Cofilin, phosphorylation status of Cofilin and the activity of Ras-related C3 botulinum

toxin substrate 1 (Rac1), GTPase being important for phosphorylation of Cofilin via LIM

kinase 1 (LIMK1)61,62. The morphological changes are shown by altered expression of the

presynaptic markers synaptophysin and synaptosomal-associated protein-25, postsynaptic

markers synaptopodin and spinopodin, synaptic functioning related proteins synapsin

2 and dihydropyrimidinase-related protein 26,60,63. Taken together, these changes result in

functional outcome changes in long-term potentiation, a form of synaptic strengthening

relevant to learning and memory, and the ability for the PKU BTBR mouse to master a

learning and memory task64.

In summary, a nutritional intervention in PKU should preferably have the following features:

a) increase neurotransmitter metabolism for serotonin and dopamine, b) improve white

matter integrity, c) increase oxidative defenses, and d) improve synaptic functioning. In the

next section, nutrients affecting these four domains will be discussed.

3. NUTRIENTS AFFECTING BRAIN STRUCTURE AND FUNCTION

3.1 Can nutritional intervention improve neurotransmitter metabolism for serotonin and

dopamine?

In PKU, the precursors of the neurotransmitter pathways and enzymes of the rate-limiting

steps are affected. Although this is only a part of the synthesis pathway, all possible targets

that can positively influence synthesis will be discussed (the effect of nutrients on serotonin

is reviewed65,66). Various nutrients can intervene in the synthesis pathway and release of

neurotransmitters, for example vitamin D, vitamin B6, and omega-3 fatty acids. This is first

highlighted by in vivo experiments that revealed that vitamin D can increase the expression

of tryptophan hydroxylase 2 (TPH-2), the rate-limiting enzyme within serotonin synthesis67.

Second, the co-enzymatic form of vitamin B6, pyridoxal phosphate, is an important cofactor

in the neurotransmitter pathways of serotonin but also in others such as melatonin, dopamine,

norepinephrine, and gamma-aminobutyric acid (GABA)68. Third, serotonin release from

the pre-synapse can be inhibited by E2 series prostaglandins69. These prostaglandins are

produced from the unsaturated omega-6 fatty acid, arachidonic acid (AA), while the E3

series prostaglandins are produced from the omega-3 fatty acid eicosapentaenoic acid (EPA).

The production of these prostaglandins is affected by the competition of EPA and AA at

the cyclooxygenase pathway. A ratio in favor of EPA inhibits the production of E2 series

prostaglandins from AA70. This finding suggests that EPA supplementation, via inhibition of

E2 series prostaglandins, could promote the release of serotonin from pre-synapses. Finally,

fatty acids can affect cell membrane fluidity and consequently the receptor availability of e.g.

serotonin and dopamine71,72. In addition, DHA supplementation in rats, via micro-emulsions

with linseed oil, resulted in an increase in serotonin and dopamine concentrations in the


84

Chapter 5

brain73. Omega-3 fatty acid supplementation also had a positive effect on dopamine in a rat

model of Parkinson’s disease74 and prevented dopamine-deficits induced by food allergies in

mice75. In the first study, supplementation of DHA and/or uridine-5′-monophosphate (UMP)

increased dopamine concentrations and the activity of Tyr hydroxylase, the rate-limiting

step in dopamine synthesis. Interestingly, the combination of DHA and UMP increased the

beneficial effects even more, which indicates that the combination of certain nutrients could

increase the positive effects of a single nutrient. In conclusion, nutrients, such as vitamin B6,

vitamin D, fatty acids, and UMP can mediate neurotransmitter metabolism by regulating

neurotransmitter uptake, synthesis and release. However, research with these nutrients

relating to neurotransmitter concentrations in PKU is very limited. Merely one study

examined the effect of B6 treatment on serotonin in PKU patients76. In this study, a seven

days B6 treatment in non-treated PKU patients did not significantly change blood serotonin

concentration. Although this study did not show positive results, more PKU specific studies

are needed for definite conclusions. In light of the clear beneficial effects of nutrients in

other research fields, a combination of different nutrients could yield positive effect(s) in

neurotransmitter metabolism in PKU.

3.2 Can a nutritional intervention improve white matter integrity?

In general, various nutrients are important for myelination and myelin recovery. For

example, iron, B6, and B12 deficiencies can cause problems with myelination77–79, omega-3

fatty acid supplementation supported myelination in a model of traumatic brain injury80,

vitamin D3 increased myelination in a model of nerve injury81, and in a chronic cerebral

hypoperfusion model, L-carnitine led to increased myelination82. These findings highlight

the possible positive effect of several nutrients on myelination. However, the implications

of these studies for PKU are not yet clear, as in these studies improved myelination is often

expressed by myelin sheath thickness or myelin markers82. In PKU, these parameters have

not been measured. A measure that is affected in PKU is cholesterol and protein synthesis,

which is considered essential in myelination. Therefore, selectively increasing e.g. cholesterol

biosynthesis by increasing the activity the rate-controlling enzyme, HMGR, could yield

possible treatment strategies for PKU. Possible candidates are omega-3 fatty acids as

treatment of one and two weeks in glial cells increased HMGR activity in primary glial

cell cultures83. To conclude, various nutrients are important for myelination. However, the

significance of these nutrients for this specific domain in PKU patients is not clear yet.

3.3 Can a nutritional intervention restore oxidative balance or increase oxidative defenses?

Restoring the balance between reactive species and antioxidants by supplementing with

antioxidants or their precursors could have beneficial effects for PKU patients. Several

studies examined antioxidant treatments in PKU models. Moraes and coworkers extensively

examined the positive effects of lipoic acid in PKU in in vitro and in vivo experiments40,84. They

showed in a chemically induced hyperphenylalaninemia rat model (repetitive injections of Phe


5

85

Chapter 5

and alpha-methyl-Phe as PAH inhibitor) as well as in Phe-treated brain homogenates of rats,

that lipoic acid administration had a positive effect on antioxidant enzyme activity and non-

enzymatic antioxidant systems that were impaired by Phe40,84. Furthermore, in another acute

hyperphenylalaninemia model in which rodents received intracerebroventricular injections

of Phe before training in a behavioral paradigm, Phe changed the behavior and increased

oxidative stress. These effects could be counteracted by pretreatment with creatine and/or

pyruvate intraperitoneally85,86. Finally, in a rat model of maternal hyperphenylalaninemia,

vitamin C, vitamin E, as well as melatonin showed positive effects on parameters of oxidative

stress caused by Phe87,88. In PKU patients, L-carnitine and selenium had a beneficial effect on

the oxidative stress parameters89. In conclusion, increasing the availability of antioxidants

may improve patients’ oxidative defenses, thereby reducing oxidative stress.

3.4 Can a nutritional intervention improve synaptic functioning?

The use of a nutritional intervention to improve synaptic functioning is often discussed in

relation to early life interventions by either replenishing deficiencies – if these occur - or

supplementing certain nutrients during pregnancy up to early adolescence90. For instance,

supplementation of vitamin B12 during pregnancy up to three months increased brain-derived

neurotrophic factor (BDNF) gene expression and protein concentrations in the hippocampus

of male Wistar rats91. When adding omega 3-fatty acids to the same supplementation

period, the BDNF gene expression and protein concentration were significantly higher in

the hippocampus compared to the vitamin B12 supplementation group, and it increased the

BDNF concentrations also in the cortex91. Furthermore, supplementation of DHA and/or

uridine during gestation and early-life positively affected pre- and postsynaptic markers as

well as hippocampal dendritic spine density92. Nutrient supplementation studies also show

benefits later in life. This finding is illustrated by research showing that supplementation of

DHA increases dendritic spine density in the hippocampus in adult gerbils93. Supplementation

of DHA, EPA, UMP or a combination of DHA with UMP and EPA with UMP also increased

pre- and postsynaptic protein expression in adult gerbils94. On a functional level, in vitro

experiments in hippocampal primary cultures have shown that DHA supplementation could

increase synaptic activity 95. In conclusion, supplementation of especially DHA, EPA, and

UMP solely or in combination can have a positive effect on synaptic functioning.

4. REVIEWING EXISTING LITERATURE IN PKU

At the beginning of this review, four domains were introduced that are thought to contribute

to the cognitive deficits observed in PKU patients. However, these domains are not separate

entities but are highly interrelated, each contributing to the overall cognitive functioning of an

individual. Apart from oxidative stress, research specifically focused on the effect of nutrients

in PKU is very limited. Some studies examined the effects of nutrient supplementation on the

overall cognitive functioning of PKU patients96–99. Most of these studies have focused on DHA


86

Chapter 5

and/or EPA supplementation and find inconclusive results. Some studies report beneficial

effects after supplementation on coordination, fine motor skills, and EEG measurements of

processing visual stimuli96–98. Others do not find beneficial effects of DHA supplementation

on cognitive processing speed and executive functioning99. Several arguments could explain

why these results are contradicting. Firstly, the duration of treatment is of great importance.

Recuperation from abnormalities as a result from omega-3 fatty acid deprivation requires

weeks to months for different cell types and organelles of the rodent brain100. The possible

transcending positive effect of these fatty acids in PKU could take even longer. Secondly, the

targeted patient group is always key in the design of the study. In healthy subjects, omega-3

fatty acid supplementation increases cognitive performance in infants but not in other age

groups101. In PKU, different patient groups can be identified, e.g. early treated, compliant,

non-compliant, and recently a new group is developing: early-treated PKU patients in late-

life. This group is new because screening and early dietary treatment of patients was initiated

approximately 40-50 years ago, depending on the country. Therefore, age-differences and

different treatment-histories in PKU patients should be taken into consideration when

designing an interventional study with a combination of specific nutrients. Finally, providing

a combination of specific nutrients or multiple nutrients in one pathway could elicit an effect

that cannot be seen when only a single nutrient is offered91,94.

5. PERSPECTIVES OF A NUTRITIONAL INTERVENTION FOR PKU

The beneficial effects of the various nutrients previously described could also be discussed

in light of the effect on neuronal membrane, one of the sites at which the four identified

domains in PKU converge. The neuronal membranes are the principal site of action for

many neuronal activities, such as synaptic functioning (including receptor and ion

channel activity), neurotransmitter release and optimal exchange of nutrients and other

molecules102,103. In addition, myelin is largely made up of lipids that can be derived from

the same precursors as those that make up the neuronal membrane. Finally, antioxidants

protect the neuronal membrane from oxidative stress, thus maintaining its integrity, stability,

and ultimately its function. Neuronal membranes are mainly composed of phospholipids,

the most abundant of which are generated primarily via the well-characterized metabolic

pathway known as the Kennedy pathway11. The rate of phospholipid synthesis through the

Kennedy pathway depends on the availability of three dietary precursors; UMP, choline and

the omega-3 polyunsaturated fatty acid DHA11. Each precursor, on its own, is rate limiting.

Furthermore, in addition to numerous other supportive roles of brain function, certain

B-vitamins, more specifically folic acid and vitamins B6 and B12, act as cofactors by directly

affecting liver metabolism of DHA and choline, thereby increasing their availability for

membrane phospholipid synthesis 12. Furthermore, vitamin C, E, and selenium play critical

roles in protecting the neuronal membrane through their antioxidant properties. Finally,


5

87

Chapter 5

phospholipids exert their supportive role through increasing precursor availability, by acting

as direct precursors to choline104 and by increasing intestinal absorption of DHA and EPA105.

This particular combination of nutrients – named Fortasyn® Connect, containing DHA,

EPA, UMP, choline, folate, vitamin B12, vitamin B6, phospholipids, vitamin C, vitamin

E, and selenium has been shown to positively affect brain phospholipid synthesis11,93,106,107,

neurite outgrowth108,109, the number of dendritic spines92,93, neurotransmitter release and

signaling109,110, levels of pre- or post-synaptic protein11,93,94,109, and levels of phospholipid

also found in myelin109. Moreover, this combination of nutrients has improved white matter

integrity in an animal model of Alzheimer’s disease111. In human subjects, different measures

can be used as a proxy to study functioning of the brain, and more specifically functioning of

synapses. Clinical studies in the context of Alzheimer’s disease have shown that Fortasyn®

Connect leads to improved brain function, and more importantly improvements in memory

performance 112,113. An EEG study in humans substantiates improvements in synaptic

connectivity through demonstrated preservation of functional brain connectivity and brain

network organization114. All these studies together suggest that Fortasyn® Connect could

be of great interest to address cognitive deficits in PKU patients. Testing this combination

of nutrients in a PKU mouse model on the level of the four different domains and cognitive

performance is now warranted. The first proof-of-concept study has indicated that Fortasyn®

Connect could be beneficial for the expression of a postsynaptic marker in a specific region

in the hippocampus in the PKU mouse model 115. This indicates that Fortasyn® Connect

could be beneficial for at least of the domains, namely synaptic functioning. These results

warrant additional exploration of the effects of this specific nutrient combination on

outcome parameters in PKU.

Conflict of Interest (COI) Statement: This manuscript was written by researchers employed

by the University of Groningen and the Beatrix Children’s hospital, University Medical

Center Groningen. Both institutions received funding from Nutricia Advanced Medical

Nutrition, Utrecht, the Netherlands. Three of the co-authors are currently working at this

company (DSC, MR, and MK).


88

Chapter 5

Tab

le 1

: Su

mm

ary

of s

ingl

e nu

trie

nt i

nter

vent

ions

. L

imit

ed s

tudi

es e

xam

ined

sin

gle

nutr

ient

int

erve

ntio

ns i

n PK

U (

depi

cted

in

the

first

row

). T

here

fore

, si

ngle

nutr

ient

s th

at h

ave

bene

ficia

l eff

ects

in t

he h

ealt

hy o

r di

seas

ed b

rain

oth

er t

han

PKU

are

incl

uded

in t

he t

able

(di

vide

d in

thr

ee d

omai

ns).

As

vari

ous

stud

ies

did

exam

ine

the

effe

ct o

f an

tiox

idan

ts o

n ox

idat

ive

stre

ss in

PK

U, o

ther

lite

ratu

re c

once

rnin

g an

tiox

idan

ts a

nd o

xida

tive

str

ess

are

not

incl

uded

.

Om

ega-

3fa

tty

acid

sU

MP

Iron

Vit

amin

B6

Vit

amin

B12

Vit

amin

DL

-car

niti

neA

ntio

xida

nts

PKU

rel

ated

lit

erat

ure

Did

not

si

gnifi

cant

ly

chan

ge b

lood

se

roto

nin

conc

entr

atio

n76

Ben

efici

al

effe

ct f

or

oxid

ativ

e st

ress

pa

ram

eter

s89

Ben

efici

al

effe

ct f

or

oxid

ativ

e st

ress

pa

ram

eter

s40,8

4–89

Neu

rotr

ans-

mit

ter

met

abol

ism

Show

pos

itiv

e ef

fect

s on

dop

amin

e an

d se

roto

nin71

–75

Show

s a

posi

tive

eff

ect

on d

opam

ine75

Co-

enzy

mat

ic

form

of

vita

min

B6

is

an im

port

ant

cofa

ctor

in

the

synt

hesi

s pa

thw

ay o

f se

roto

nin68

Influ

ence

s sy

nthe

sis

path

way

67

Whi

te m

atte

r in

tegr

ity

Prev

ente

d m

yelin

atio

n pr

oble

ms80

Defi

cien

cies

re

sult

in

com

plic

atio

ns77

Defi

cien

cies

re

sult

in

com

plic

atio

ns78

Defi

cien

cies

re

sult

in

com

plic

atio

ns79

Incr

ease

s m

yelin

atio

n81

Incr

ease

d m

yelin

atio

n82

Syna

ptic

fu

ncti

onin

gIn

crea

sed

BD

NF,

pr

e-an

d po

stsy

napt

ic

mar

kers

, hip

poca

mpa

l de

ndri

tic

spin

e de

nsit

y, a

nd s

ynap

tic

acti

vity

91–9

5

Incr

ease

d pr

e-an

d po

stsy

napt

ic

mar

kers

, and

hi

ppoc

ampa

l de

ndri

tic

spin

e de

nsit

y11,9

4

Incr

ease

d B

DN

F91


5

89

Chapter 5

6. REFERENCES

1 Weiser MJ, Butt CM, Mohajeri MH.

Docosahexaenoic Acid and Cognition

throughout the Lifespan. Nutrients 2016; 8.

doi:10.3390/nu8020099.

2 Forbes SC, Holroyd-Leduc JM, Poulin MJ,

Hogan DB. Effect of Nutrients, Dietary

Supplements and Vitamins on Cognition:

a Systematic Review and Meta-Analysis of

Randomized Controlled Trials. Can Geriatr

J 2015; 18: 231–45.






Metab Dis 2000; 23: 313–6.



Metab 2010; 99 Suppl 1: S3-9.




653–62.





ddu515.






2007; 92: 63–70.





2007; 17: 91–101.





Metab; 101: 99–109.





33: 665–70.

11 Wurtman RJ, Cansev M, Sakamoto T, Ulus

IH. Administration of docosahexaenoic

acid, uridine and choline increases levels of

synaptic membranes and dendritic spines in

rodent brain. World Rev Nutr Diet 2009;

99: 71–96.

12 van Wijk N, Watkins CJ, Hageman RJJ,

Sijben JCW, Kamphuis PGHJ, Wurtman

RJ et al. Combined dietary folate, vitamin

B-12, and vitamin B-6 intake influences

plasma docosahexaenoic acid concentration

in rats. Nutr Metab (Lond) 2012; 9: 49.

13 Kennedy EP WS. The function of

cytidine coenzymes in the biosynthesis of

phospholipides. J Biol Chem 1956; 222:

193–214.










Metab 2015; 35: 200–5.





Neurosci Lett 2006; 401: 261–5.


90

Chapter 5

17 Pascucci T, Andolina D, Mela I La,

Conversi D, Latagliata C, Ventura R et al.

5-Hydroxytryptophan rescues serotonin

response to stress in prefrontal cortex

of hyperphenylalaninaemic mice. Int J


18 Pascucci T, Andolina D, Ventura R, Puglisi-

Allegra S, Cabib S. Reduced availability

of brain amines during critical phases of

postnatal development in a genetic mouse

model of cognitive delay. Brain Res 2008;

1217: 232–8.

19 Pascucci T, Ventura R, Puglisi-Allegra

S, Cabib S. Deficits in brain serotonin

synthesis in a genetic mouse model of

phenylketonuria. Neuroreport 2002; 13:

2561–4.

20 Puglisi-Allegra S, Cabib S, Pascucci T,

Ventura R, Cali F, Romano V. Dramatic

brain aminergic deficit in a genetic mouse

model of phenylketonuria. Neuroreport

2000; 11: 1361–4.







One 2015; 10: e0143833.

22 ALVORD EC, STEVENSON LD, VOGEL

FS, ENGLE RL. Neuropathological findings

in phenyl-pyruvic oligophrenia (phenyl-

ketonuria). J Neuropathol Exp Neurol

1950; 9: 298–310.

23 Huttenlocher PR. The neuropathology of

phenylketonuria: human and animal studies.

Eur J Pediatr 2000; 159 Suppl: S102-6.





Mol Genet Metab 2013; 109: 125–31.

25 Anderson PJ, Wood SJ, Francis DE,

Coleman L, Warwick L, Casanelia S et al.

Neuropsychological functioning in children

with early-treated phenylketonuria: impact

of white matter abnormalities. Dev Med

Child Neurol 2004; 46: 230–8.

26 Bick U, Ullrich K, Stöber U, Möller H,

Schuierer G, Ludolph AC et al. White

matter abnormalities in patients with

treated hyperphenylalaninaemia: magnetic

resonance relaxometry and proton

spectroscopy findings. Eur J Pediatr 1993;

152: 1012–20.

27 Leuzzi V, Tosetti M, Montanaro D,

Carducci C, Artiola C, Antonozzi I et

al. The pathogenesis of the white matter

abnormalities in phenylketonuria. A

multimodal 3.0 tesla MRI and magnetic

resonance spectroscopy (1H MRS) study. J


28 Mastrangelo M, Chiarotti F, Berillo L,

Caputi C, Carducci C, Di Biasi C et al. The

outcome of white matter abnormalities in

early treated phenylketonuric patients: A

retrospective longitudinal long-term study.

Mol Genet Metab 2015. doi:10.1016/j.

ymgme.2015.08.005.

29 Dyer CA, Kendler A, Philibotte T, Gardiner

P, Cruz J, Levy HL. Evidence for central

nervous system glial cell plasticity in

phenylketonuria. J Neuropathol Exp Neurol

1996; 55: 795–814.

30 Schoemans R, Aigrot M-S, Wu C, Marée R,

Hong P, Belachew S et al. Oligodendrocyte

development and myelinogenesis are

not impaired by high concentrations of

phenylalanine or its metabolites. J Inherit

Metab Dis 2010; 33: 113–20.


Daikhin E, Kendler A, Nguyen LB et al. Is

there a relationship between 3-hydroxy-

3-methylglutaryl coenzyme a reductase

activity and forebrain pathology in the PKU

mouse? J Neurosci Res 2000; 61: 549–63.


5

91

Chapter 5

32 Smith CB, Kang J. Cerebral protein


phenylketonuria. Proc Natl Acad Sci U S A

2000; 97: 11014–9.

33 Hoeksma M, Reijngoud D-J, Pruim J,

de Valk HW, Paans AMJ, van Spronsen

FJ. Phenylketonuria: High plasma

phenylalanine decreases cerebral protein

synthesis. Mol Genet Metab 2009; 96:

177–82.

34 Hughes J V, Johnson TC. The effects of

phenylalanine on amino acid metabolism

and protein synthesis in brain cells in vitro. J

Neurochem 1976; 26: 1105–13.

35 Binek-Singer P, Johnson TC. The effects of

chronic hyperphenylalaninaemia on mouse

brain protein synthesis can be prevented by

other amino acids. Biochem J 1982; 206:

407–14.

36 Halliwell B GJ. Free radicals in biology and

medicine. 2007.

37 Fernandes CG, Leipnitz G, Seminotti B,

Amaral AU, Zanatta A, Vargas CR et al.

Experimental evidence that phenylalanine

provokes oxidative stress in hippocampus

and cerebral cortex of developing rats. Cell

Mol Neurobiol 2010; 30: 317–26.

38 Mazumder MK, Paul R, Borah A.

β-phenethylamine--a phenylalanine

derivative in brain--contributes to oxidative

stress by inhibiting mitochondrial complexes

and DT-diaphorase: an in silico study. CNS

Neurosci Ther 2013; 19: 596–602.

39 Rosa AP, Jacques CED, Moraes TB,

Wannmacher CMD, Dutra A de M, Dutra-

Filho CS. Phenylpyruvic acid decreases

glucose-6-phosphate dehydrogenase activity

in rat brain. Cell Mol Neurobiol 2012; 32:

1113–8.

40 Moraes TB, Zanin F, da Rosa A, de Oliveira

A, Coelho J, Petrillo F et al. Lipoic acid

prevents oxidative stress in vitro and in

vivo by an acute hyperphenylalaninemia

chemically-induced in rat brain. J Neurol Sci

2010; 292: 89–95.

41 Kienzle Hagen ME, Pederzolli CD,

Sgaravatti AM, Bridi R, Wajner M,

Wannmacher CMD et al. Experimental

hyperphenylalaninemia provokes oxidative

stress in rat brain. Biochim Biophys Acta

2002; 1586: 344–52.

42 Simon KR, Dos Santos RM, Scaini G, Leffa

DD, Damiani AP, Furlanetto CB et al. DNA

damage induced by phenylalanine and its

analogue p-chlorophenylalanine in blood

and brain of rats subjected to a model of

hyperphenylalaninemia. Biochem Cell Biol

2013; 91: 319–24.

43 Mazzola PN, Terra M, Rosa AP, Mescka CP,

Moraes TB, Piccoli B et al. Regular exercise

prevents oxidative stress in the brain of

hyperphenylalaninemic rats. Metab Brain

Dis 2011; 26: 291–7.




Neuroreport 2011; 22: 617–22.

45 Ercal N, Aykin-Burns N, Gurer-Orhan

H, McDonald JD. Oxidative stress in a

phenylketonuria animal model. Free Radic

Biol Med 2002; 32: 906–11.

46 Solverson P, Murali SG, Brinkman AS,

Nelson DW, Clayton MK, Yen C-LE et al.

Glycomacropeptide, a low-phenylalanine

protein isolated from cheese whey, supports

growth and attenuates metabolic stress in

the murine model of phenylketonuria. Am J

Physiol Endocrinol Metab 2012; 302: E885-

95.


92

Chapter 5

47 Sitta A, Barschak AG, Deon M, Barden

AT, Biancini GB, Vargas PR et al. Effect

of short- and long-term exposition to high

phenylalanine blood levels on oxidative

damage in phenylketonuric patients. Int J

Dev Neurosci 2009; 27: 243–7.

48 Gassió R, Artuch R, Vilaseca MA, Fusté

E, Colome R, Campistol J. Cognitive

functions and the antioxidant system in

phenylketonuric patients. Neuropsychology

2008; 22: 426–31.

49 Schulpis KH, Tsakiris S, Traeger-Synodinos

J, Papassotiriou I. Low total antioxidant

status is implicated with high 8-hydroxy-

2-deoxyguanosine serum concentrations in

phenylketonuria. Clin Biochem 2005; 38:

239–42.

50 Artuch R, Colomé C, Sierra C, Brandi

N, Lambruschini N, Campistol J et al. A

longitudinal study of antioxidant status in

phenylketonuric patients. Clin Biochem

2004; 37: 198–203.

51 Sierra C, Vilaseca MA, Moyano D,

Brandi N, Campistol J, Lambruschini

N et al. Antioxidant status in

hyperphenylalaninemia. Clin Chim Acta

1998; 276: 1–9.

52 Wilke BC, Vidailhet M, Favier A, Guillemin

C, Ducros V, Arnaud J et al. Selenium,

glutathione peroxidase (GSH-Px) and lipid

peroxidation products before and after

selenium supplementation. Clin Chim Acta

1992; 207: 137–42.

53 Schulpis KH, Papastamataki M, Stamou

H, Papassotiriou I MA. The effect of diet

on total antioxidant status, ceruloplasmin,

transferrin and ferritin serum levels in

phenylketonuric children. - PubMed -

NCBI. 2010. http://www.ncbi.nlm.nih.gov/

pubmed/20491710 (accessed 3 Sep2015).

54 Colomé C, Artuch R, Vilaseca M-A,

Sierra C, Brandi N, Lambruschini N et al.

Lipophilic antioxidants in patients with

phenylketonuria. Am J Clin Nutr 2003; 77:

185–8.

55 van Bakel MM, Printzen G, Wermuth B,

Wiesmann UN. Antioxidant and thyroid

hormone status in selenium-deficient

phenylketonuric and hyperphenylalaninemic

patients. Am J Clin Nutr 2000; 72: 976–81.

56 Bauman ML, Kemper TL. Morphologic and

histoanatomic observations of the brain in

untreated human phenylketonuria. Acta

Neuropathol 1982; 58: 55–63.





Metab 2016; 118: 3–8.












1983; 8: 157–73.





544–8.




Neurol 2016; 281: 28–36.

http://www.ncbi.nlm.nih.gov/


5

93

Chapter 5





Res 2007; 62: 8–13.










2003; 33: 301–10.

65 Patrick RP, Ames BN. Vitamin D and the

omega-3 fatty acids control serotonin

synthesis and action, part 2: relevance for

ADHD, bipolar disorder, schizophrenia,

and impulsive behavior. FASEB J 2015; 29:

2207–22.

66 Patrick RP, Ames BN. Vitamin D hormone

regulates serotonin synthesis. Part 1:

relevance for autism. FASEB J 2014; 28:

2398–413.

67 Kaneko I, Sabir MS, Dussik CM,

Whitfield GK, Karrys A, Hsieh J-C et

al. 1,25-Dihydroxyvitamin D regulates

expression of the tryptophan hydroxylase 2

and leptin genes: implication for behavioral

influences of vitamin D. FASEB J 2015; 29:

4023–35.

68 Shabbir F, Patel A, Mattison C, Bose S,

Krishnamohan R, Sweeney E et al. Effect

of diet on serotonergic neurotransmission

in depression. Neurochem Int 2013; 62:

324–329.

69 Schlicker E, Fink K, Göthert M. Influence of

eicosanoids on serotonin release in the rat

brain: inhibition by prostaglandins E1 and

E2. Naunyn Schmiedebergs Arch Pharmacol

1987; 335: 646–51.

70 Wada M, DeLong CJ, Hong YH, Rieke

CJ, Song I, Sidhu RS et al. Enzymes and

receptors of prostaglandin pathways

with arachidonic acid-derived versus

eicosapentaenoic acid-derived substrates and

products. J Biol Chem 2007; 282: 22254–

66.

71 Heron DS, Shinitzky M, Hershkowitz

M, Samuel D. Lipid fluidity markedly

modulates the binding of serotonin to

mouse brain membranes. Proc Natl Acad

Sci U S A 1980; 77: 7463–7.

72 Heinrichs SC. Dietary omega-3 fatty acid

supplementation for optimizing neuronal

structure and function. Mol Nutr Food Res

2010; 54: 447–56.

73 Sugasini D, Lokesh BR. Rats given linseed

oil in microemulsion forms enriches

the brain synaptic membrane with

docosahexaenoic acid and enhances the

neurotransmitter levels in the brain. Nutr

Neurosci 2015; 18: 87–96.

74 Cansev M, Ulus IH, Wang L, Maher TJ,

Wurtman RJ. Restorative effects of uridine

plus docosahexaenoic acid in a rat model of

Parkinson’s disease. Neurosci Res 2008; 62:

206–9.

75 de Theije CGM, van den Elsen LWJ,

Willemsen LEM, Milosevic V, Korte-Bouws

GAH, Lopes da Silva S et al. Dietary long

chain n-3 polyunsaturated fatty acids

prevent impaired social behaviour and

normalize brain dopamine levels in food

allergic mice. Neuropharmacology 2015;

90: 15–22.

76 Berman JL, Justice P, Hsia DY. Effect of

vitamin B 6 on blood 5-hydroxytryptamine

concentration. Ann N Y Acad Sci 1969;

166: 97–108.

77 Badaracco ME, Siri MVR, Pasquini JM.

Oligodendrogenesis: the role of iron.

Biofactors 2010; 36: 98–102.


94

Chapter 5

78 Kirksey A, Morré DM, Wasynczuk AZ.

Neuronal development in vitamin B6

deficiency. Ann N Y Acad Sci 1990; 585:

202–18.

79 Agamanolis DP, Chester EM, Victor

M, Kark JA, Hines JD, Harris JW.

Neuropathology of experimental vitamin

B12 deficiency in monkeys. Neurology

1976; 26: 905–14.

80 Pu H, Guo Y, Zhang W, Huang L, Wang G,

Liou AK et al. Omega-3 polyunsaturated

fatty acid supplementation improves

neurologic recovery and attenuates white

matter injury after experimental traumatic

brain injury. J Cereb Blood Flow Metab

2013; 33: 1474–84.

81 Chabas J-F, Stephan D, Marqueste T,

Garcia S, Lavaut M-N, Nguyen C et al.

Cholecalciferol (vitamin D₃) improves

myelination and recovery after nerve injury.

PLoS One 2013; 8: e65034.

82 Ueno Y, Koike M, Shimada Y, Shimura H,

Hira K, Tanaka R et al. L-carnitine enhances

axonal plasticity and improves white-matter

lesions after chronic hypoperfusion in rat

brain. J Cereb Blood Flow Metab 2015; 35:

382–91.

83 Vignikin R, Grundt IK, Scotto J, Wolfrom

C, Raulin J, Gautier M. Effects of

polyunsaturated fatty acids on human and

rat cells. In vitro versus in vivo experiments.

In Vivo 1989; 3: 351–7.

84 Moraes TB, Jacques CED, Rosa AP,

Dalazen GR, Terra M, Coelho JG et al.

Role of catalase and superoxide dismutase

activities on oxidative stress in the brain of

a phenylketonuria animal model and the

effect of lipoic acid. Cell Mol Neurobiol

2013; 33: 253–60.

85 Berti SL, Nasi GM, Garcia C, Castro

FL de, Nunes ML, Rojas DB et al.

Pyruvate and creatine prevent oxidative

stress and behavioral alterations caused

by phenylalanine administration into

hippocampus of rats. Metab Brain Dis

2012; 27: 79–89.

86 Dos Reis EA, Rieger E, de Souza SS, Rasia-

Filho AA, Wannmacher CMD. Effects of

a co-treatment with pyruvate and creatine

on dendritic spines in rat hippocampus

and posterodorsal medial amygdala in a

phenylketonuria animal model. Metab Brain

Dis 2013; 28: 509–17.

87 Martínez-Cruz F, Osuna C, Guerrero JM.

Mitochondrial damage induced by fetal

hyperphenylalaninemia in the rat brain and

liver: its prevention by melatonin, Vitamin

E, and Vitamin C. Neurosci Lett 2006; 392:

1–4.

88 Martinez-Cruz F, Pozo D, Osuna C, Espinar

A, Marchante C, Guerrero JM. Oxidative

stress induced by phenylketonuria in the rat:

Prevention by melatonin, vitamin E, and

vitamin C. J Neurosci Res 2002; 69: 550–8.

89 Sitta a, Vanzin CS, Biancini GB, Manfredini

V, de Oliveira a B, Wayhs C a Y et al.

Evidence that L-carnitine and selenium

supplementation reduces oxidative stress

in phenylketonuric patients. Cell Mol

Neurobiol 2011; 31: 429–36.

90 Prado EL, Dewey KG. Nutrition and brain

development in early life. Nutr Rev 2014;

72: 267–84.

91 Rathod R, Khaire A, Kemse N, Kale A,

Joshi S. Maternal omega-3 fatty acid

supplementation on vitamin B12 rich

diet improves brain omega-3 fatty acids,

neurotrophins and cognition in the Wistar

rat offspring. Brain Dev 2014; 36: 853–63.


5

95

Chapter 5

92 Cansev M, Marzloff G, Sakamoto T, Ulus

IH, Wurtman RJ. Giving uridine and/or

docosahexaenoic acid orally to rat dams

during gestation and nursing increases

synaptic elements in brains of weanling

pups. Dev Neurosci 2009; 31: 181–92.

93 Sakamoto T, Cansev M, Wurtman RJ. Oral

supplementation with docosahexaenoic acid

and uridine-5’-monophosphate increases

dendritic spine density in adult gerbil

hippocampus. Brain Res 2007; 1182: 50–9.

94 Cansev M, Wurtman RJ. Chronic

administration of docosahexaenoic acid or

eicosapentaenoic acid, but not arachidonic

acid, alone or in combination with uridine,

increases brain phosphatide and synaptic

protein levels in gerbils. Neuroscience 2007;

148: 421–31.

95 Cao D, Kevala K, Kim J, Moon H-S, Jun

SB, Lovinger D et al. Docosahexaenoic

acid promotes hippocampal neuronal

development and synaptic function. J

Neurochem 2009; 111: 510–21.

96 Koletzko B, Beblo S, Demmelmair H,

Hanebutt FL. Omega-3 LC-PUFA supply

and neurological outcomes in children

with phenylketonuria (PKU). J Pediatr

Gastroenterol Nutr 2009; 48 Suppl 1: S2-7.

97 Beblo S, Reinhardt H, Demmelmair H,

Muntau AC, Koletzko B. Effect of fish

oil supplementation on fatty acid status,

coordination, and fine motor skills in

children with phenylketonuria. J Pediatr

2007; 150: 479–84.

98 Agostoni C, Verduci E, Massetto N, Fiori

L, Radaelli G, Riva E et al. Long term

effects of long chain polyunsaturated fats in

hyperphenylalaninemic children. Arch Dis

Child 2003; 88: 582–3.

99 Yi SHL, Kable JA, Evatt ML, Singh RH. A

randomized, placebo-controlled, double-

blind trial of supplemental docosahexaenoic

acid on cognitive processing speed

and executive function in females of

reproductive age with phenylketonuria: A

pilot study. Prostaglandins Leukot Essent

Fatty Acids 2011; 85: 317–27.

100 Bourre JM, Durand G, Pascal G, Youyou A.

Brain cell and tissue recovery in rats made

deficient in n-3 fatty acids by alteration of

dietary fat. J Nutr 1989; 119: 15–22.

101 Jiao J, Li Q, Chu J, Zeng W, Yang M, Zhu

S. Effect of n-3 PUFA supplementation on

cognitive function throughout the life span

from infancy to old age: a systematic review

and meta-analysis of randomized controlled

trials. Am J Clin Nutr 2014; 100: 1422–36.

102 Yehuda S, Rabinovitz S, Carasso RL,

Mostofsky DI. The role of polyunsaturated

fatty acids in restoring the aging neuronal

membrane. Neurobiol Aging; 23: 843–53.

103 Vigh L, Escribá P V, Sonnleitner A,

Sonnleitner M, Piotto S, Maresca B et al.

The significance of lipid composition for

membrane activity: new concepts and ways

of assessing function. Prog Lipid Res 2005;

44: 303–44.

104 Wurtman RJ, Hirsch MJ, Growdon JH.

Lecithin consumption raises serum-free-

choline levels. Lancet (London, England)

1977; 2: 68–9.

105 O’Doherty PJ, Kakis G, Kuksis A. Role of

luminal lecithin in intestinal fat absorption.

Lipids 1973; 8: 249–55.

106 Cansev M, Watkins CJ, van der Beek

EM, Wurtman RJ. Oral uridine-5’-

monophosphate (UMP) increases brain

CDP-choline levels in gerbils. Brain Res

2005; 1058: 101–8.


96

Chapter 5

107 Holguin S, Martinez J, Chow C,

Wurtman R. Dietary uridine enhances

the improvement in learning and memory

produced by administering DHA to gerbils.

FASEB J 2008; 22: 3938–46.

108 Pooler AM, Guez DH, Benedictus

R, Wurtman RJ. Uridine enhances

neurite outgrowth in nerve growth

factor-differentiated PC12 [corrected].

Neuroscience 2005; 134: 207–14.






2015; 36: 344–51.






2012; 120: 631–40.

111 Zerbi V, Jansen D, Wiesmann M, Fang X,

Broersen LM, Veltien A et al. Multinutrient

diets improve cerebral perfusion and

neuroprotection in a murine model of

Alzheimer’s disease. Neurobiol Aging 2014;

35: 600–13.

112 Scheltens P, Kamphuis PJGH, Verhey

FRJ, Olde Rikkert MGM, Wurtman RJ,

Wilkinson D et al. Efficacy of a medical

food in mild Alzheimer’s disease: A

randomized, controlled trial. Alzheimers

Dement 2010; 6: 1–10.e1.

113 Scheltens P, Twisk JWR, Blesa R, Scarpini

E, von Arnim CAF, Bongers A et al. Efficacy

of Souvenaid in mild Alzheimer’s disease:

results from a randomized, controlled trial. J

Alzheimers Dis 2012; 31: 225–36.

114 e Waal H, Stam CJ, Lansbergen MM,

Wieggers RL, Kamphuis PJGH, Scheltens P

et al. The effect of souvenaid on functional

brain network organisation in patients with

mild Alzheimer’s disease: a randomised

controlled study. PLoS One 2014; 9:

e86558.








doi:10.3390/nu8040185.


5

97

Chapter 5


CHAPTER 6A specific nutrient combination attenuates the reduced expression of PSD-95 in the proximal dendrites of hippocampal cell body layers in a

mouse model of phenylketonuria

Vibeke M. Bruinenberg1, Danique van Vliet2, Amos Attali3,

Martijn C. de Wilde3, Mirjam Kuhn3, Francjan J. van Spronsen2,

Eddy A. van der Zee 1,*

1Molecular Neurobiology, University of Groningen, Groningen, the Netherlands,2Division of Metabolic Diseases, Beatrix Children’s Hospital, University Medical Center

Groningen, University of Groningen, Groningen, the Netherlands3Nutricia Research, Nutricia Advanced Medical Nutrition, Utrecht, the Netherlands

*Correspondence: [email protected]; Tel.: +31-050-363-2062

mailto:[email protected]

tel:+31-050-363-2062


100

Chapter 6

ABSTRACT

The inherited metabolic disease phenylketonuria (PKU) is characterized by increased

concentrations of phenylalanine in the blood and brain, and as a consequence

neurotransmitter metabolism, white matter, and synapse functioning are affected. A specific

nutrient combination (SNC) has been shown to improve synapse formation, morphology

and function. This could become an interesting new nutritional approach for PKU. To assess

whether treatment with SNC can affect synapses, we treated PKU mice with SNC or an

isocaloric control diet for 12 weeks, starting at postnatal day 31. Immunostaining for post-

synaptic density protein 95 (PSD-95), a postsynaptic density marker, was carried out in

the hippocampus, striatum and prefrontal cortex. Compared to WT mice on normal chow

without SNC, PKU mice on the isocaloric control showed a significant reduction in PSD-95

expression in the hippocampus, specifically in the granular cell layer of the dentate gyrus,

with a similar trend seen in the CA1 and CA3 pyramidal cell layer. No differences were found

in the striatum or prefrontal cortex. PKU mice on a diet supplemented with SNC showed

improved expression of PSD-95 in the hippocampus. This study gives the first indication that

SNC supplementation has a positive effect on hippocampal synaptic deficits in PKU mice.

Keywords: Synaptic proteins; Hippocampus; PSD-95; nutrient combination;

phenylketonuria


6

101

Chapter 6

1. INTRODUCTION

The primary defect in the inherited metabolic disease phenylketonuria (PKU) is the disrupted

phenylalanine (Phe) metabolism, caused by mutations in the gene encoding for the hepatic

enzyme phenylalanine hydroxylase, which normally converts Phe to tyrosine. When no

dietary Phe restriction is applied, this causes an increase in blood and brain Phe concentration

compared to healthy controls. Although many questions still remain to be answered, a clear

correlation between Phe concentration in blood and brain and the cognitive symptoms of

PKU has been shown1–3. Increased Phe concentrations disrupt neurotransmitter metabolism,

white matter integrity and affect synapse functioning in PKU patients and in models of PKU 4–11. Concerning the latter, a disruption of neuronal connectivity and synaptic morphology

became evident in Golgi analyses of both PKU patients and PKU mice, showing a decreased

number of spines, width of the synaptic cleft and thickness of the post-synaptic density,

indicative of reduced synaptic function5,6,12. These observed morphological abnormalities

are corroborated by a decrease in proteins associated with synaptic functioning 9,13,14. As

different markers of synaptic functioning have been examined in relation to PKU, the

postsynaptic marker postsynaptic density-95 (PSD-95) has not. This protein is of interest

since it is highly associated with growth and functioning of dendritic spines and modulates

long-term potentiation, a process important for learning and memory15–17).

Phe-induced neuro-morphological changes are reversible, providing a window of opportunity

for interventions even after the expression of symptoms due to high Phe exposure6,18. Our

study targets these synaptic deficits with a specific nutrient combination (SNC) monitored

via the expression of PSD-95. This SNC contains uridine monophosphate (UMP),

docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), choline, phospholipids, folic acid,

vitamins B12, B6, C, and E, and selenium. This combination provides rate-limiting nutrients

critical for the synthesis of phospholipids, a major component of (synaptic) membranes,

and has shown beneficial effects on synapse formation, morphology and function in mouse

models of Alzheimer’s disease19. Due to the multiple pathways and precursors involved in

membrane formation, intervention with single components of this SNC would, very likely,

lead to sub-optimal synthesis of phospholipids and therefore limited beneficial effects.

Indeed, limited and inconsistent evidence is available for the effect of supplementation with

single components of this SNC in PKU patients20–22. To investigate if SNC can overcome

synaptic deficits in PKU, we study here the effect of SNC on the expression of PSD-95 in the

hippocampus, striatum and prefrontal cortex in the C57BL/6 PKU mouse model.


102

Chapter 6

2. MATERIALS AND METHODS

2.1 Animals and dietary intervention

In this study, 31 day-old male and female homozygous C57BL/6 Pahenu2 (PKU; gender

balanced groups, n=60) mice and their wild-type (WT; n=10) littermates were fed for 12

weeks with different diets. Mice were bred at the University of Groningen, The Netherlands.

At the start of the experiment all mice were housed singly. The genotype of the animals was

established by quantitative PCR analysis from DNA extracts from tail tissue23. PKU mice

were randomly assigned to the following groups: a high-Phe, mid-Phe, or low-Phe diet (Phe

contents of 8.8, 6.4, or 4.4 g/kg diet respectively) either with or without SNC. The Phe-

contents of 8.8 and 6.4 are in the normal range of standard chow. The 4.4 g/kg of Phe in

the food is a slight reduction compared to commercial available standard chows but still

contains the minimal nutritional requirement for laboratory animals24. The different Phe

concentrations in food resulted in the following Phe concentrations in blood: WT control;

49.6±5.9, PKU 8.8; 1841.3±305.4, PKU 6.4; 1413.8±199.8, and PKU 4.4; 1065±150.4

(mean ± standard deviation). WT control mice received a high-Phe diet without SNC. A

WT control group on this same diet with SNC was not included because potential beneficial

effects are considered irrelevant to elucidate the hypothesized mode of action of SNC in the

PKU model. All components were in accordance to the minimal nutritional requirement for

laboratory animals24. This study was approved by the ethical committee of the University of

Groningen, The Netherlands.

2.2 Tissue preparation

After 12 weeks of dietary treatment, all animals were euthanized via a single intraperitoneal

injection of pentobarbital. Blood was collected via heart punction and animals were

transcardially perfused with 4% paraformaldehyde (PFA; in 0.1 M phosphate buffer (PB);

pH7.4). Brains were post-fixed for 24 hours and subsequently rinsed with 0.01 M PB. After

exposing the brains to 30% buffered sucrose, they were snap-frozen with liquid nitrogen

and stored at -80°C.

2.3 Immunohistochemistry

Coronal brain sections (20 µm thick) were processed for immunohistochemical analysis of

the postsynaptic marker PSD-95 with a free-floating technique according to the following

steps: 1) incubation with 0.3% H2O2 for 30 minutes, 2) incubation with 1:1000 monoclonal

mouse anti-PSD-95, Millipore, MABN68, 1% normal goat serum (NGS) and 0.5% Triton-X

for 2 hours in a water bath at 37⁰C, 24 hours at room temperature and subsequent storage

for 48 hours at 4⁰C, 3) incubation with secondary antibody solution (1:500 Biotin-SP-

conjugated affiniPure Goat-anti-Mouse, Jackson, code: 115-0.65-166 Lot# 110630, 1%

NGS and 0.5% Triton-X) for 2 hours at room temperature (RT), 4) incubation with 1:400

AB complex, Vectastain PK-6100 standard in TBS for 2 hours at RT, 5) color development


6

103

Chapter 6

was initiated by the introduction of 100 µl 0.1% H2O2 to the 3,3’-diaminobenzidine (DAB;

7 mg/15 mL) solution. The sections were rinsed multiple times with Tris buffered Saline

(pH 7.4) between the above described steps. The specificity of the primary antibody was

tested with omitting the primary antibody in the protocol of the staining, which resulted in

the absence of detectable immunostaining, and western blot, which showed a band at 95

kDa. The optical density (OD) of the staining was measured with a Quantimet 550 image

analysis system (Leica, Cambridge, UK) as has been used before25,26. In the hippocampus,

10 regions of interest were measured between bregma coordinates -1.34 and -1.82 mm (see

Fig 1 for delineation and abbreviations). In the striatum, the mean OD of three fixed areas

located in the caudoputamen were calculated (between bregma coordinates 1.18 and 0.14

mm). In addition, the infralimbic and prelimbic area of the prefrontal contex were measured

between the bregma coordinates 1.98 and 1.54 mm. The OD of these regions was corrected

for background staining by subtracting the OD of the corpus callosum. Both hemispheres of

three sections of each individual were measured. Due to freeze artifacts three animals were

discarded: one animal from the high-Phe without SNC group and two animals from the

low-Phe without SNC group.


The distribution of all parameters was checked with the Shapiro-Wilk normality test.

Normally distributed data were tested with a One-way ANOVA with the Bonferroni test

as post-hoc test. The Kruskal-Wallis test was used for non-parametric data with the Mann-

Whitney U test as post-hoc test. All statistical analyses were performed with the Statistical

Package for Social Sciences (SPSS) (V 16.0).


104

Chapter 6

Figure 1. PSD-95 expression in the C57BL/6 PKU mouse. (A) An overview picture of the PSD-95

immunostaining. The following 10 areas of interest were measured: (B) CA3: Stratum lucidum (SL),

CA3 pyramidal cell layer (CA3 pyr) (C) DG: outer and middle molecular layer (OML/MML), the inner

molecular layer (IML), inner (DG-IB) and outer blade (DG-OB) of the dentate gyrus, hilus, (D) CA1:

Stratum oriens (SO), CA1 pyramidal cell layer (CA1 pyr) and the Stratum radiatum (SR) (E) a detailed

picture of the granular layers present in the DG. (F) a detailed picture of the CA1 pyramidal cell layer.

Arrows indicate clear staining within the granular layer. The size bar indicates 100 µm. The detail

pictures within E and F are digitally enlarged.


6

105

Chapter 6

3. RESULTS

Body weight and blood Phe concentrations were measured to monitor the dietary treatment.

The absolute Phe intake, corrected for body weight, food intake, and the measured Phe in

the food, confirmed that Phe intake was significantly different between the different Phe

content groups but not between the different Phe content groups and their corresponding

SNC groups (One-way ANOVA df=6 F=64.181, post hoc Bonferroni analysis: High-Phe-

Mid-Phe; p= 0.000 High-Phe-Low-Phe; p=0.000, Mid-Phe-Low-Phe; p=0.000, High-

Phe with and without; p=0.298, Mid-Phe with and without; p=1.000, Low-Phe with and

without; p=1.000).

Furthermore, as clinically relevant, both males and females were used in this study. It is

known from the literature that hippocampal spine density is affected by the estrous cycle

and hormones associated with this cycle 27. However, we did not find significant differences

between males and females in the PSD-95 OD, and therefore pooled values from males and

females.

Non-parametric tests were used to examine the PSD-95 immunoreactivity differences. No

significant differences were found between the Phe-content groups of PKU mice for all brain

regions studied. Therefore, all PKU mice from the different Phe-groups were pooled into

two groups; those with and without SNC supplementation (final groups: WT, PKU with

and PKU without SNC). In the hippocampus, a significant difference was found within the

inner blade and outer blade of the dentate gyrus (Kruskal-Wallis: DG-IB; p=0.009, DG-

OB; p=0.008). Post hoc testing revealed that PSD-95 OD in the DG-IB and DG-OB was

significantly decreased in PKU mice fed with diets without SNC compared to WT by 54%

and 64%, respectively (Mann-Whitney U test DG-IB; p=0.005, DG-OB; p=0.005). Although

these significant differences were still present in DG-IB and DG-OB between the WT and

PKU mice fed with diets with SNC, the decrease was considerably less: 29% and 27%,

respectively (Mann-Whitney U test DG-IB; p=0.031, DG-OB; p=0.026). A clear trend was

observed in the CA1 and CA3 cell layers (Kruskal-Wallis: CA1; p=0,053, CA3; p=0,064),

where PKU mice on diets without SNC showed a reduction in PSD-95 OD of 44% in the

CA1 and 51% in the CA3 compared to WT mice. In the CA1, this difference was attenuated

for the PKU mice fed with diets with SNC, as the difference between this group and WT

mice was only 8%. In the striatum and prefrontal cortex, no significant differences were

found between the groups (Kruskal-Wallis: p=0,830, p=0.930, respectively); no PKU PSD-

95 expression deficit was present in PKU mice, and no change was induced by SNC.


106

Chapter 6

4. DISCUSSION

To the best of our knowledge, this is the first report of reduced hippocampal PSD-95

expression in the PKU mouse model. The most important finding of our study is that SNC

supplementation seems to dampen PKU PSD-95 OD deficits towards WT values in specific

areas of the hippocampus. Therefore, this study indicates that SNC supplementation could

have a positive effect on synaptic functioning by lessening the reduced expression of PSD-

95 in the hippocampus of C57BL/6 PKU mice in the regions affected in PKU. This positive

effect was most clear in the dendrites of the DG granular cells at the level of the cell layer,

and to a lesser extent in CA1 pyramidal cell dendrites at the level of the cell layer.

PSD-95 is a scaffolding protein which is postsynaptically present in glutamatergic and

serotonergic synapses15,28. In general, PSD-95 is implicated in postsynaptic plasticity and

maturation of excitatory synapses via the interchange of AMPA and NMDA receptors in

the postsynaptic compartment15,29–31. The most marked reduction in PSD-95 in the PKU

hippocampus was found in the DG granular layer, and somewhat less prominent in the CA1

and CA3 regions. In all cases, the reduction was limited to the most proximal part of the

dendrites. At present, it is unclear which hippocampal input circuitry anatomically matches

best the affected terminal fields. The hippocampus receives input from various sources,

which deviate in their terminal fields. For example, part of the input from the entorhinal

cortex terminates on the proximal dendrites of DG granular cells and CA3 pyramidal cells,

and the Schaffer collaterals originating from CA3 pyramidal neurons project on the CA1

proximal dendrites32,33. A reduction of PSD-95 in PKU mice, specifically within the proximal

dendrites, could suggest weakening of synaptic connectivity in these neuronal circuits which

could negatively impact learning and memory. The supplementation with SNC attenuates

the PKU-specific reduction in hippocampal PSD-95 expression towards WT levels. Although

the effect was not statistically significant for all regions, SNC treatment seems to particularly

affect the CA1, DG-IB, and DG-OB. Apparently, certain cellular properties of these regions

are more susceptible to the effect of SNC. Alternatively, the duration of the treatment was

not sufficient to have a strong positive effect in all hippocampal regions.

The relation between PSD-95 and the glutamatergic AMPA and NMDA receptors suggests

that the PKU-specific reduction in PSD-95 could specifically affect these receptors. However,

the literature concerning this topic is somewhat contradictory. Martynyuk et al. 34 found a

significant increase in the Glu1 and Glu2/3 subunits of AMPA receptors and a total increase

in NMDA receptor densities, a suggested compensatory mechanism for the acute suppressive

effect of high Phe concentrations on glutamatergic synaptic transmission32. Despite the up-

regulation in postsynaptic glutamate receptors, Martynyuk et al. 34 also report preliminary

data indicating that the functional activity of glutamatergic synaptic transmission in the

PKU brain is still reduced. Although they do not specify to what degree, it is possible to


6

107

Chapter 6

envisage that the reduction in function is associated with the reduction in PSD-95 found in

our study.

In consensus with literature, this study shows reduced levels of a protein associated with

synaptic functioning in PKU mice9,13,14. In contrast, recent literature showed an increase in

synapse number and an increase in the postsynaptic markers synaptopodin and spinophilin

in specific regions of the hippocampus (striatum radiatum CA1 and stratum lucidum CA3)

which could suggest that this results in an increase in PSD-95 in the same regions14. However,

our study did not show significant differences between PKU and WT individuals in the same

hippocampal subregions. Horling and colleagues14 found a specific upregulation of thin and

branched spines, and the postsynaptic markers associated with the cytoskeleton, suggesting

that the less mature spines are affected. These immature spines, which are not fully engaged

in synaptic activity, could contain less PSD-95 compared to the types that were not affected,

e.g. mushroom type. Hence, our data suggest that the increase in the number of spines

and postsynaptic markers found by Horling and colleagues does not come with an overall

increase in PSD-95 expression.

To conclude, this study shows that SNC supplementation could have a positive effect on

PSD-95 expression in specific hippocampal subregions affected in C57BL/6 PKU mice. The

examination of additional pre-and postsynaptic markers and functional outcomes, e.g.

executive functioning, will be key to the subsequent more extensive investigation of synaptic

dysfunction in PKU mice and the beneficial effects of SNC supplementation.

Acknowledgments: The authors thank Jan Keijser, Kunja Slopsema, and Els van der Goot for

their skillful assistance during the studies. The research leading to these results has received

funding from Nutricia Advanced Medical Nutrition.

Author contribution: All authors agreed to be listed and approved the submitted version of

the publication. VMB, DVV, AA, MCDW, MK, FJVS, and EAVZ conceived and designed

the experiments; VMB performed the experiments; VMB analyzed the data; AA, MCDW,

and MK contributed reagents/materials/analysis tools; VMB, DVV, AA, MCDW, MK, FJVS,

and EAVZ wrote the paper.

Conflict of interest: AA, MCDW, and MK are employed by Nutricia Advanced Medical

Nutrition. The content is solely the responsibility of the authors and does not necessarily

represent the official views of Nutricia Research.


108

Chapter 6

Figure 2. PSD-95 expression is reduced specifically in the hippocampus of the PKU mouse

model. (A) No significant differences are found between the three groups in striatum

(Kruskal-Wallis: p=0,830) (B) No significant differences are found between the three groups

in the prefrontal cortex (Kruskal-Wallis: p=0.930) (C) Compared to WT mice on normal

chow without SNC, PKU mice on the isocaloric control showed a significant reduction in

PSD-95 expression in the hippocampus, specifically in the granular cell layer of the dentate

gyrus (Kruskal-Wallis: DG-IB p=0,009, DG-OB p=0,008), with a similar trend in the CA1

and CA3 pyramidal cell layer (Kruskal-Wallis: CA1 pyr p=0,053, CA3 pyr p=0,064). A

significant difference was found between the WT group and both PKU groups for the DG-IB

and DG-OB (WT compared to PKU without SNC: Mann-Whitney U test DG-IB; p=0.005,

DG-OB; p=0.005. WT compared to PKU with SNC: Mann-Whitney U test DG-IB; p=0.031,

DG-OB; p=0.026) (arrow bars depict SEM).


6

109

Chapter 6

5. REFERENCES



27.






2007; 92: 63–70.

3 Jahja R, Huijbregts SCJ, de Sonneville

LMJ, van der Meere JJ, van Spronsen

FJ. Neurocognitive evidence for revision

of treatment targets and guidelines for

phenylketonuria. J Pediatr 2014; 164: 895–

899.e2.

4 Joseph B, Dyer CA. Relationship between

myelin production and dopamine synthesis

in the PKU mouse brain. J Neurochem

2003; 86: 615–26.




Neuroreport 2011; 22: 617–22.












1983; 8: 157–73.

8 Loo YH, Fulton T, Miller K, Wisniewski

HM. Phenylacetate and brain dysfunction

in experimental phenylketonuria: synaptic

development. Life Sci 1980; 27: 1283–90.





544–8.






701–6.





Mol Genet Metab 2013; 109: 125–31.

12 Bauman ML, Kemper TL. Morphologic and

histoanatomic observations of the brain in

untreated human phenylketonuria. Acta

Neuropathol 1982; 58: 55–63.










ddu515.

15 El-Husseini AE, Craven SE, Chetkovich

DM, Firestein BL, Schnell E, Aoki C et al.

Dual palmitoylation of PSD-95 mediates

its vesiculotubular sorting, postsynaptic

targeting, and ion channel clustering. J Cell

Biol 2000; 148: 159–72.


110

Chapter 6

16 Nagura H, Ishikawa Y, Kobayashi K, Takao

K, Tanaka T, Nishikawa K et al. Impaired

synaptic clustering of postsynaptic density

proteins and altered signal transmission

in hippocampal neurons, and disrupted

learning behavior in PDZ1 and PDZ2 ligand

binding-deficient PSD-95 knockin mice. Mol

Brain 2012; 5: 43.

17 van der Zee EA. Synapses, spines and

kinases in mammalian learning and memory,

and the impact of aging. Neurosci Biobehav

Rev 2015; 50: 77–85.

18 Embury JE, Charron CE, Martynyuk A,

Zori AG, Liu B, Ali SF et al. PKU is a

reversible neurodegenerative process within

the nigrostriatum that begins as early as 4

weeks of age in Pah(enu2) mice. Brain Res

2007; 1127: 136–50.

19 van Wijk N, Broersen LM, de Wilde MC,

Hageman RJJ, Groenendijk M, Sijben

JWC et al. Targeting synaptic dysfunction

in Alzheimer’s disease by administering a

specific nutrient combination. J Alzheimers

Dis 2014; 38: 459–79.

20 Beblo S, Reinhardt H, Demmelmair H,

Muntau AC, Koletzko B. Effect of fish

oil supplementation on fatty acid status,

coordination, and fine motor skills in

children with phenylketonuria. J Pediatr

2007; 150: 479–84.

21 Koletzko B, Beblo S, Demmelmair H,

Hanebutt FL. Omega-3 LC-PUFA supply

and neurological outcomes in children

with phenylketonuria (PKU). J Pediatr

Gastroenterol Nutr 2009; 48 Suppl 1: S2-7.

22 Yi SHL, Kable JA, Evatt ML, Singh RH. A

randomized, placebo-controlled, double-

blind trial of supplemental docosahexaenoic

acid on cognitive processing speed

and executive function in females of

reproductive age with phenylketonuria: A

pilot study. Prostaglandins Leukot Essent

Fatty Acids 2011; 85: 317–27.






doi:10.1007/8904_2015_498.

24 APA National Research Council. Nutrient

Requirements of Laboratory AnimalsNo

Title. Fourth rev. The National Academies

Press: Washington DC, 1995.







202–10.

26 Van der Zee EA, Keijser JN. Localization of

pre- and postsynaptic cholinergic markers

in rodent forebrain: a brief history and

comparison of rat and mouse. Behav Brain

Res 2011; 221: 356–66.

27 Shors TJ, Falduto J, Leuner B. The opposite

effects of stress on dendritic spines in

male vs. female rats are NMDA receptor-

dependent. Eur J Neurosci 2004; 19: 145–

50.

28 Allen JA, Yadav PN, Roth BL. Insights

into the regulation of 5-HT2A serotonin

receptors by scaffolding proteins and

kinases. Neuropharmacology 2008; 55:

961–8.

29 Zhang Y, Matt L, Patriarchi T, Malik ZA,

Chowdhury D, Park DK et al. Capping of

the N-terminus of PSD-95 by calmodulin

triggers its postsynaptic release. EMBO J

2014; 33: 1341–53.

30 Yudowski GA, Olsen O, Adesnik H,

Marek KW, Bredt DS. Acute inactivation

of PSD-95 destabilizes AMPA receptors at

hippocampal synapses. PLoS One 2013; 8:

e53965.


6

111

Chapter 6

31 MacGillavry HD, Song Y, Raghavachari

S, Blanpied TA. Nanoscale scaffolding

domains within the postsynaptic density

concentrate synaptic AMPA receptors.

Neuron 2013; 78: 615–22.

32 Xu J-Y, Zhang J, Chen C. Long-lasting

potentiation of hippocampal synaptic

transmission by direct cortical input is

mediated via endocannabinoids. J Physiol

2012; 590: 2305–15.

33 Turner DA, Buhl EH, Hailer NP, Nitsch R.

Morphological features of the entorhinal-

hippocampal connection. Prog Neurobiol

1998; 55: 537–62.

34 Martynyuk AE, Glushakov A V, Sumners

C, Laipis PJ, Dennis DM, Seubert

CN. Impaired glutamatergic synaptic

transmission in the PKU brain. Mol Genet

Metab 2005; 86 Suppl 1: S34-42.


CHAPTER 7Long-term treatment with a specific nutrient

combination in phenylketonuria mice improves recognition memory

Vibeke M. Bruinenberg, Danique van Vliet2, Els van der Goot1,

Minke L. de Vries1, Danielle S. Counotte3, Mirjam Kühn3,

Francjan J. van Spronsen2, Eddy A. van der Zee1

1GELIFES, University of Groningen, Groningen, The Netherlands: 2Child Hosp, Univ

Med Cent, Groningen, The Netherlands; 3Nutricia Research, Nutricia Advanced Medical

Nutrition, Utrecht, The Netherlands


114

Chapter 7

ABSTRACT

Introduction

In phenylketonuria (PKU), a gene mutation in the phenylalanine metabolic pathway causes

accumulation of phenylalanine (Phe) in blood and brain. Although early introduction of a

Phe-restricted diet can prevent severe symptoms from developing, patients who are diagnosed

and treated early still experience deficits in cognitive functioning indicating shortcomings of

current treatment. In the search for new and/or additional treatment strategies, a combination

of specific nutrient combination (SNC) was postulated to improve brain function in PKU. In

this study, we examined the effect of SNC on memory and motor function.

Material & Methods

48 homozygous wild-types (WT, +/+) and 96 PKU BTBRPah2 (-/-) male and female mice

received dietary interventions from postnatal day 31 till 10 months of age. These mice were

subdivided in the following 6 groups: high Phe diet (WT C-HP, PKU C-HP), high Phe plus

specific nutrient combination (WT SNC-HP, PKU SNC-HP), PKU low-Phe diet (PKU C-LP),

and PKU low-Phe diet plus specific nutrient combination (PKU SNC- LP). Memory and

motor function in mice was tested at 3,6, and 9 months after treatment initiation in the open

field (OF), novel object recognition test (NOR), spatial object recognition test (SOR), and

the balance beam (BB).

Results

In the NOR, we found that PKU mice despite being subjected to high Phe conditions could

master the task on all three time points when supplemented with SNC. Under low Phe

conditions, the PKU mice on control diet can master the NOR on all time points and mice

on the supplemented diet can master the task at time point 6 and 9. SNC supplementation

did not consistently influence the performance in the OF, SOR or BB.

Conclusion

This study is the first long-term intervention study in BTBR PKU mice that shows that

SNC supplementation can specifically benefit novel object recognition. Future research is

necessary to identify the mode of action of SNC supplementation.


7

115

Chapter 7

1. INTRODUCTION

The detrimental effects of increased phenylalanine (Phe) concentrations on the brain are

clearly visible in the metabolic disorder, Phenylketonuria (PKU, OMIM 261600). In this

disorder, a mutation in the gene encoding for the hepatic enzyme phenylalanine hydroxylase

causes a disruption in the conversion of Phe to tyrosine. Consequently, when no restriction

is made in natural protein intake, Phe accumulates in blood and brain. Neonatal screening

facilitates early introduction of treatment preventing symptoms such as severe cognitive

disabilities and epilepsy. Nonetheless, even early-continuously-treated patients experience

deficits in cognitive functioning, in for instance processing speed, attention, working memory

and social-cognitive functioning1–3, highlighting that current treatment is not optimal.

In the search for new and/or additional treatment strategies, a combination of specific nutrients

(SNC) was postulated to relieve the functional and neurobiological effects of increased Phe4.

The specific nutrients selected were originally combined to facilitate the Kennedy pathway

as they are important precursors, cofactors and antioxidants for this pathway. This pathway

is important in phospholipid synthesis, a key feature of the neuronal membrane. Functional

neuronal membranes are important for synaptic functioning and neurotransmitter release5,6,

domains affected in PKU. Furthermore, other PKU-related problems in, for instance, white

matter integrity and oxidative stress could benefit from these nutrients as antioxidants

present in the SNC could relieve oxidative stress7–9 and the phospholipids present in the SNC

are an important part of myelin10. Therefore, the specific nutrient combination (SNC) aims

to detain the effect of Phe on neurotransmitter metabolism, white matter integrity, oxidative

stress and synaptic functioning, in the end, positively affecting functional outcome.

The period in which SNC supplementation could have an added effect on the current

recommended life-long treatment with a Phe restricted diet in PKU patients is not clear.

Although life-long treatment is recommended, at present, little is known about the progression

of the disorder under this treatment during aging as it is implemented approximately 50-

60 years ago. Therefore, the aim of this study is twofold: 1) to investigate a phe-restricted

treatment in an aging PKU mouse model, 2) to examine the effect of SNC on the behavioral

performance of PKU mice under high Phe and low Phe conditions.

2. METHODS

2.1 Animals

A breeding colony of heterozygous (+/-) mating pairs generated 48 wild-types (WT, +/+) and

96 PKU BTBRPah2 (-/-) male and female mice. Original breeding pairs were kindly provided

by prof. Puglisi-Allegra from the Sapienza, University of Roma, Rome, Italy. On postnatal

day (PND) 28 the animals were weaned and the genetic status of the animals was established


116

Chapter 7

via quantitative PCR analysis on DNA extracted from ear tissue (as previously described11).

After weaning, all littermates were kept in the breeding cage (26x42x15 cm) without the

mother until PND 31. On PND 31, the animals were group housed in sex-matched pairs

of two in cages of the same dimensions (26x42x15 cm) with sawdust bedding and cage

enrichment in the form of nesting material, paper rolls, and a small wooden stick. To prevent

fighting among the males, a red transparent house was added in their cages in the adult

stage. The condition of the housing facility was kept constant at a temperature of 21±1 °C

with a 12/12 light/dark cycle. The animals received fresh food every day (between zeitgeber

time (ZT) 8-10) and had ad libitum access to water. Leftover food was collected every day

before given fresh food. Together with a thorough search of bedding after cage cleaning,

the difference with the offered food gave an estimation of weekly food intake per pair.

Furthermore, body weight of the mice was measured during these weekly cage cleaning (ZT

8-10). The dietary intervention started at PND 31 until 10 months of age. The length of the

experiment required clear humane endpoints. These were set on a decrease in body weight of

15% together with other sickness behavior e.g. inactive behavior, arched back. If one of the

pair of mice was excluded from the experiment, females were placed in pairs of three. Males

were kept solitary. All experimental procedures were approved by an independent ethics

committee for animal experimentation (6504E, Groningen, the Netherlands) and complied

with the principles of good laboratory animal care following the European Directive for the

protection of animals used for scientific purposes.

2.2. Dietary intervention

The dietary intervention started on PND 31. At this time point, pairs of mice were assigned

to one of the following six groups: WT control high Phe diet (WT C-HP), WT high Phe diet

plus SNC (WT SNC-HP), PKU high Phe diet (PKU C-HP), PKU high Phe diet plus SNC

(PKU SNC-HP), PKU low-Phe diet (PKU C-LP), and PKU low-Phe diet plus SNC (PKU

SNC-LP). The high Phe diet is a normal diet for WT animals. Each group consisted of 12

males and 12 females. As the mice were at the pre-adolescence stage at the beginning of the

experiments, the diet was based on the growth diet AIN-93G. In the adult stage (13 weeks),

the mice were switched to diets based on the maintenance diet AIN-93M manufactured by

the same supplier (Research Diet Services BV, Wijk bij Duurstede, The Netherlands). The

key characteristics of the diets were kept the same; normal diet with or without SNC had Phe

concentrations of 6.2 g/kg and tyrosine concentrations of 15 g/kg and low-Phe diet (based

on previous literature12) had Phe concentrations of 2.0 g/kg and tyrosine concentrations of

15 g/kg. The specifics of the diets are depicted in Table 1.


7

117

Chapter 7

Table 1. Nutritional content of experimental diets. * The corresponding mineral and vitamin premixes

to the growth (G: AIN-93G) or maintenance (M: AIN-93M) diets were used.

g /kg diet C-HP SNC-HP C-LP SNC-HP

G M G M G M G M

Carbohydrates 666,5 718,4 638,6 690,5 670,7 722,6 642,8 694,7

Fat 50,0 50,0 50,0 50,0 50,0 50,0 50,0 50,0

Dietary fibre 50,0 50,0 50,0 50,0 50,0 50,0 50,0 50,0

Protein 186,0 134,1 186,0 134,1 181,8 129,9 181,8 129,9

Amino acids

Alanine 4,6 3,3 4,6 3,3 4,6 3,3 4,6 3,3

Arginine 6,4 4,5 6,4 4,5 6,4 4,5 6,4 4,5

Aspartic acid 12,2 8,0 12,2 8,0 12,2 8,0 12,2 8,0

Cystine 3,7 2,4 3,7 2,4 3,7 2,4 3,7 2,4

Glutamic acid 36,3 25,5 36,3 25,5 36,3 25,5 36,3 25,5

Glycine 3,2 2,3 3,2 2,3 3,2 2,3 3,2 2,3

Histidine 4,6 3,3 4,6 3,3 4,6 3,3 4,6 3,3

Isoleucine 8,2 5,9 8,2 5,9 8,2 5,9 8,2 5,9

Leucine 15,7 10,9 15,7 10,9 15,7 10,9 15,7 10,9

Lysine 16,3 9,2 16,3 9,2 16,3 9,2 16,3 9,2

Methionine 4,6 3,3 4,6 3,3 4,6 3,3 4,6 3,3

Phenylalanine 6,2 6,2 6,2 6,2 2,0 2,0 2,0 2,0

Proline 20,5 14,3 20,5 14,3 20,5 14,3 20,5 14,3

Serine 9,7 6,7 9,7 6,7 9,7 6,7 9,7 6,7

Threonine 6,7 4,7 6,7 4,7 6,7 4,7 6,7 4,7

Tryptophan 2,1 1,6 2,1 1,6 2,1 1,6 2,1 1,6

Tyrosine 15,0 15,0 15,0 15,0 15,0 15,0 15,0 15,0

Valine 10,0 7,0 10,0 7,0 10,0 7,0 10,0 7,0

Mineral premix* 35,0 35,0 35,0 35,0 35,0 35,0 35,0 35,0

Vitamin premix* 10,0 10,0 10,0 10,0 10,0 10,0 10,0 10,0

Additives 2,5 2,5 2,5 2,5 2,5 2,5 2,5 2,5

SNC 27,5 27,5 27,5 27,5

Totaal (g) 1000 1000 1000 1000 1000 1000 1000 1000

Energie (kcal/kg diet) 3859,9 3859,9 3748,4 3748,4 3859,9 3859,9 3748,4 3748,4


118

Chapter 7

2.3 Behavioral paradigms

During the dietary intervention, the animals were behaviorally assessed every 12 weeks

starting at four months of age. Five days before each test session, a blood spot was taken.

Each test session consisted of an open field (OF), novel object recognition (NOR), spatial

object recognition (SOR) and a balance beam (BB). The animals were tested between ZT1-6.

All procedures and experimental setup were described in our previous study13. In short, the

habituation phase of the NOR was used as OF. On day 1 of the testing session, the animals

were placed in the middle of a square arena (50x50x35 cm) to explore the arena freely for

ten minutes. The subsequent day the animals could explore two identical objects for ten

minutes in the familiarization phase of the NOR. Again 24 hours later, one of the objects

was replaced with a novel object wherein the mouse could explore this new setting for 10

minutes. After a period of 5 days, the animals were tested in the SOR. The first day the animals

were exposed to four sessions of 6 minutes. The first session was similar to the habituation

phase of the NOR. In the second to the fourth session, the animals could freely explore

three different objects (in shape, color, and texture) in a specific configuration. Between

sessions, the animals were placed back in the home cage for 2 minutes. The second day, one

of the objects was moved to a different location. The objects, the starting condition, and the

displaced object were randomized over trails. Both the NOR and SOR were performed in

a separate room recorded with a camera (Panasonic WVCP500) connected to a computer

outside the room with Media recorder (Noldus, The Netherlands). The balance beam was

performed in the housing facility 24 hours later. During this task, the animals had to cross

a square wooden beam (length 1 m, width 5 mm, height 10 mm, horizontally positioned 50

cm above the underlying surface) over four distances (10, 40, 75, and 100 cm). The final

distance was used as read-out trail. In this trail, the number of correct steps and total steps

necessary to cross the beam were manually scored and calculated to a percentage. A step was

considered correct if the hind paw had a full placement on the beam at the initiation and end

of the forward movement.

The open field was analyzed with Ethovision v.11 (Noldus, The Netherlands). In this

analysis, the arena was divided into a center zone, four border zones, and four corner zones14.

Activity was quantified by the distance moved and anxiety-like behavior was examined by

the preference of the animal to seek out the more sheltered zones, the corners. In the NOR

and SOR, the exploration time of each object was manually scored with the program ELINE

(made in house). For the NOR, the discrimination index (DI) was calculated by the time

spent exploring the novel object minus the time exploring the same object divided by the

total exploration time of both objects15. For the SOR, the exploration time of the first three

training sessions was compared to the time exploring in the test session. The mice mastered

these learning paradigms when they explored either the novel object or the relocated object

above change level.


7

119

Chapter 7

2.4 Statistics

All statistical analysis was performed with SPSS 22.0. All data were checked for normality

(Shapiro-Wilk test) and homogeneity of variance (Levene’s test). Food intake was tested

non-parametrically with a Kruskal-Wallis and post hoc analysis was done with a Mann-

Whitney U test. A fixed effects linear mixed model was used to test repeated measurements

of body weight, and the behavioral paradigms. As the groups were not fully balance between

the genotypes (WT mice are not able to receive low Phe diet), two models were tested; 1) a

factorial analysis of the factors: time, genotype, and specific nutrient combination was used

to investigate differences between WT and PKU mice on high Phe diet and the influence

of SNC supplementation within these groups, 2) a factorial analysis of the factors: time,

specific nutrient combination, and Phe condition was used to examine differences between

the four different diets in PKU mice (C-HP, SNC-HP, C-LP, and SNC-LP). For body weight,

we assume that the body weight measurements taken near each other are more related to

each other than the measurements taken with a larger time interval (for example we expect

that the body weight measurement of week 13 is more similar to week 14 than week to

41). Therefore, the repeated covariance type was set to first order autoregressive. For the

behavioral this assumption was not made, therefore a diagonal covariance type was selected.

Finally, the ability to master the task was investigated by comparing the DI to change level

(0) with a t-test. No corrections were made for multiplicity. A p-value equal to or less than

0.05 was considered significant. If not differently specified, data are expressed as mean ±

standard error of the mean.

3. RESULTS

3.1 General health, body weight, and food intake

In the course of the experiment, 21 animals were excluded from the experiment. The excluded

animals were not in a specific treatment group (Kruskal-Wallis test, groups p=0.081) and

dropout was not skewed by genotype or sex (Kruskal-Wallis test, genotype p=0.134, sex

p=0.480). The general health of the animals was, among others, monitored by body weight

and food intake. Both parameters were split for growth diet and maintenance diet, the first 9

weeks and starting from 3 months respectively. Furthermore, male and female were analyzed

separately as food intake and body weight was different between the sexes. In addition,

graphs and analysis was split for all groups on a high Phe diet (model 1) and all PKU groups

(model 2). In figure 1A-B, an increase in body weight over time is found in males and females

(Female; time p<0.001, Male; time: p<0.001). In females, the progression of the body weight

differed between WT and PKU mice (genotype x time p<0.001) and an interaction was

found between genotype and SNC supplementation (genotype x time x SNC p=0.005). In

male, similar results were found but no interaction was found with SNC supplementation

(time p<0.001, genotype x time p<0.001, genotype x time x SNC p=0.871). In figure 1C-D


120

Chapter 7

the curves of all PKU groups are depicted. Again, an increase in body weight was observed

for both sexes (Female; time p<0.001, Male; time: p<0.001). In both sexes, this increase

of body weight over time was different between high Phe and low Phe conditions (Female:

Phe condition x time p=0.002, Male: Phe condition x time p=0.009). SNC supplementation

did not significantly contribute to this model. In figure 1E-F, the average daily food intake

is depicted. A mere indication of the differences in food intake can be drawn from these

data, as only group housed individuals of the same genotype were included. Nevertheless,

no differences were found in food intake between the groups in female mice (p=0.173), and

in male mice only between WT C-HP and PKU SNC-HP (p=0.036). In maintenance diet

(Figure 2A-D), the growth of the animals persisted (Fig 2A Female; time p<0.001, Fig 2B

Male; time: p<0.001, Figure 2C Female; time p<0.001, Figure 2D Male; time: p<0.001). In

male mice, the differences in the increase of body weight over time between WT and PKU on

high Phe diet were still present (genotype x time p=0.002) but in females this interaction was

no longer significant (genotype x time p=0.754). In PKU mice (figure 2C-D), similar results

were found (Female: Phe condition x time p<0.001, Male Phe condition x time p=0.002).

Daily food intake was also similar to the results found in growth diet (Male: WT C-HP and

PKU SNC-HP p=0.036).

3.2 Open field

The distance covered in the open field was used to explore differences in novelty-induced

exploration. Gender differences were observed, and therefore, male and female mice were

analyzed separately. In figure 3A trough 3D, it is evident that all groups move less through

the maze (Fig 3A Female; time p<0.001, Fig 3B Male; time: p<0.001, Figure 3C Female;

time p<0.001, Figure 3D Male; time: p<0.001). In female mice, the WT mice covered

more distance in the maze compared to PKU high Phe mice (p<0.001). In male mice, the

progression over time was different between WT and PKU high Phe mice (p=0.013) but no

main effect was found (p=0.663). The distance moved was differently influenced by SNC

supplementation in WT and PKU mice (p=0.001). In female PKU mice (Figure 3C), PKU

mice on low Phe diet covered more distance through the maze compared to PKU mice on

high Phe diet (p=0.022). Furthermore, the progression over time was different between these

groups (p=0.017). In male PKU mice (Figure 3D), the difference between high Phe and low

Phe diet was inversed. The mice in the high Phe condition moved more through the maze

compared to the low Phe condition (p=0.006). The progress over time was not different

between the conditions (p=0.254).

In addition to the distance moved through the arena, the preference of the mice to explore

more sheltered areas of the arena was investigated in the open field. This was done by

examining time spent in the corners. Over time, the time spent in the corners was not constant

(Fig 4A Female; time p<0.001, Fig 4B Male; time: p<0.001, Figure 4C Female; time p<0.001,

Figure 4D Male; time: p<0.001). In the females, the PKU high Phe mice spent less time in


7

121

Chapter 7

the corners compared WT mice (Fig 4A, genotype p<0.001) in which the progress in time

was also different (p=0.040). In male mice, no difference was observed between WT and

PKU high Phe mice or the progression in time (genotype=0.906, time x genotype=0.055). In

the PKU mice, a trend was observed between low and high Phe conditions in female mice

(p=0.064) but not in male mice (p=0.586).

Figure 1 Growth diet. Results are separated for females and male (graphs A,C,E and graphs B,D,F,

respectively). In figure A and B, the bodyweight curves of the first eight weeks of treatment, starting on

postnatal day 31, are depicted for all groups on high Phe diet (WT C-HP, WT SNC-HP, PKU C-HP, PKU

SNC-HP). In figure C and D, the body weight curves for all PKU mice groups are depicted. Mean daily

food intake is depicted in graph E and F (median depicted). Graphs A-D: mean± standard error of the

mean (SEM), x-axis depict days. Graphs E-F: median.


122

Chapter 7

Figure 2 Maintenance diet. Graphs are identically organized as figure 2. In graphs A-D, the bodyweight

curves of the last 28 weeks of dietary treatment are depicted, starting at week 13. In graphs E-F, mean

daily food intake is depicted. Graphs A-D: mean± SEM, x-axis depict weeks. Graphs E-F: median


7

123

Chapter 7

Figure 3 Distance moved in open field. (A) Female mice on high Phe diet, (B) male mice on high Phe diet,

(C) female PKU mice, and (D) male PKU mice. (mean± SEM)

Figure 4 Time spent in corners of the maze. The time spent in the corners of the maze is thought to

represent anxiety-like behavior as the mice seek out the more sheltered areas of the arena. (A) Female

mice on high Phe diet, (B) male mice on high Phe diet, (C) female PKU mice, and (D) male PKU mice.

(mean± SEM)


124

Chapter 7

3.3 Learning and memory paradigms: NOR and SOR

No differences were observed in sex, and therefore, males and females were analyzed

together. In the model, a significant difference was found between WT and PKU high Phe diet

in DI (p<0.001). SNC supplementation improved the performance of PKU mice (p<0.001)

whereas no differences were found between Phe conditions (p=0.324) or a different response

of Phe conditions to the SNC supplementation (p=0.236). Although this statistical analysis

highlight the difference between the groups, it doesn’t give insight in the ability of the mice

to master the learning and memory paradigm. To investigate this, DI was compared to

change level. From figure 5A, it is clear that the mice of the WT-groups (C-HP t(23)=3.407,

p=0.002, SNC-HP t(23)=3.715, p=0.001), PKU SNC-HP (t(20)=2.915, p=0.009), and PKU

C-LP (t(23)=3.646 p=0.001) are able to master the task after three months of treatment.

However, the PKU C-HP (t(22)=0.070 p=0.944) and PKU SNC-LP (t(23)=1.707 p=0.103)

did not. After six months of treatment (Figure 5B), all groups except for the PKU C-HP

learned the task (WT C-HP t(23)=7.789 p<0.001, WT SNC-HP t(23)=6.924 p<0.001, PKU

C-HP t(20)=0.826 p=0.418, PKU SNC-HP t(18)=3.573 p=0.002, PKU C-LP t(23)=2.137,

p=0.043, PKU SNC-LP t(22)=2.648 p=0.015). After the nine month of treatment, for a

second time, all groups mastered the NOR task, with the exception of PKU C-HP (WT

C-HP t(21)=3.482 p=0.002, WT SNC-HP t(20)=3.081 p= 0.006, PKU C-HP t(21)=1.729

p=0.098, PKU SNC-HP t(15)=6.037 p<0.001, PKU C-LP t(22)=2.230 p=0.036, PKU

SNC-LP t(20)=5.461, p<0.001). In PKU mice, the SNC supplementation did not affect the

time spent on exploring the objects ( p=0.294). PKU on high Phe diet did spent more time

exploring the objects compared to the low Phe diet groups (p=0.012). In WT mice, SNC

supplementation increased the exploration (p=0.033).

The analysis of the SOR data, did not reveal a PKU phenotype of the PKU control high Phe

group compared to the WT group (p=0.768). Upon a closer look, by comparing the DI to

change level and eliminating values two standard deviations outside the mean, similar results

were found after three months of treatment as previously described in the NOR. The mice

of the WT-groups (C-HP t(23)=2.450, p=0.022, SNC-HP t(22)=2.123, p=0.045), PKU SNC-

HP (t(19)=2.228, p=0.038), and PKU C-LP (t(23)=2.193 p=0.037) are able to master the

task after three months of treatment. The PKU C-HP (t(19)=-.069 p=0.946) and PKU SNC-

LP (t(23)=1.385 p=0.179) did not. However, the WT mice did no longer master the SOR

after six months of treatment (C-HP t(22)=2.450, p=0.074, SNC-HP t(23)=1.719, p=0.099).


7

125

Chapter 7

Figure 5 Novel object recognition. Discrimination index ((exploration novel object- exploration same

object)/total exploration time) is tested against change level (0). * represent a significant difference from

change level. (mean± SEM)

3.4 Balance beam

The relative number of correct steps was used to investigate the motor performance. In both

females and males (Figure 6A-B), a clear difference was observed between WT and PKU

mice on high Phe diet (Fig 6A Female; p<0.001, Fig 4B Male; p<0.001). In female PKU mice

(Figure 6A), SNC supplementation reduced the relative number of correct steps (p=0.037).

In male PKU mice, this effect was not observed (p=0.785). When comparing low and high

Phe conditions (Figure 6C-D), only female mice performed better in the low Phe groups

(Figure 6C Female; fit of model AIC=1050.248, p<0.001, Figure 6D Male; fit of model

AIC=1217.239, p=0.863). SNC supplementation did not influence the performance of the

PKU mice groups (female: p=0.587, male: p=0.671).


126

Chapter 7

Figure 6 Motor performance. The relative number of correct steps made in the probe trail (100 cm) is

depicted. (A) Female mice on high Phe diet, (B) male mice on high Phe diet, (C) female PKU mice, and

(D) male PKU mice. (mean± SEM).

4. DISCUSSION

In this study, a long-term dietary intervention with SNC supplementation, a low-Phe diet or

a combination of these diets was investigated in male and female BTBR PKU mice. These

groups of mice were compared to WT controls with or without supplementation. During

the 9 months of intervention, the animals were tested three time (after 3, 6, and 9 months

of treatment) in the open field, NOR, SOR and the balance beam. In the NOR, we found

that PKU mice despite being subjected to high Phe conditions could master the NOR at all

three time points when supplemented with SNC. Under low Phe conditions, the PKU mice

on control diet could master the NOR on all time points and mice on the supplemented

diet could master the task at time point 6 and 9. SNC supplementation did not consistently

influence the performance in the open field, SOR or the balance beam. This indicates that

SNC supplementation specifically influences the performance in the NOR.

4.1 A long-term study: Opportunities and limitations

This study was the first to investigate the long-term effect on behavior of different treatments

in the BTBR PKU mouse model. As a consequence, we were unprepared for the loss in

animals during the experiment due to early aging. This led to unbalanced groups and smaller

numbers of animals to be tested. However so, we believe that the exclusion of animals from

the experiment was not skewed towards any experimental group and that the remaining

animals were in good condition, enabling us to draw firm conclusions. Nevertheless, this

study shows that future studies should be aware of this early drop-out of BTBR mice.


7

127

Chapter 7

In this study, we performed multiple rounds of behavioral testing in the same animal to

examine changes over time. In the open field, we found a reduction in locomotor activity and

an increase in time spent in the corners even in the WT mice. Although this is not described

in BTBR mice, our results are in line with other mouse studies that show reduced locomotor

activity in aging mice in the open field16,17. The preference for a certain location in the maze

is thought to depend on the properties of the maze and lighting conditions that could explain

the mixed results found for this parameter between studies16,17. In the NOR and the balance

beam, no clear differences were found over time that suggest that either the multiple testing

rounds or the aging effect of a period of 6 months does not influence the performance in

these tasks. In contrast, the SOR was affected by either one or both of these factors. At

time point 3, the WT groups showed similar abilities to master the task compared to the

NOR. However, at latter time points, the WT individuals were not able to master this task.

Although it is possible that multiple rounds of behavioral testing can influence this outcome,

impairments of spatial memory are reported in normal aging mice and BTBR mice18–21.

4.2 Timing of treatment

Early intervention in PKU patients can prevent the irreversible cognitive disabilities found

in untreated or late-diagnosed PKU patients22, suggesting a specific window of treatment.

Although guidelines are given, this window is not that exactly defined22. For example, a Phe-

restricted diet can still have positive effects in late-diagnosed PKU patients23. In our current

study, we have introduced the SNC supplementation and low-Phe conditions at PND 31. At

this time point, the maturation of the brain and the characteristic behavior in mice is thought

to represent the adolescence stage in humans24. The introduction of our treatment would,

therefore, surpass the early intervention window of PKU treatment to prevent cognitive

disabilities. Nevertheless, the PKU mice on a control low Phe diet did master the NOR

paradigm. Suggesting, at least in PKU mice, that the low Phe conditions introduced later in

life can be beneficial for object recognition memory. Furthermore, no early cognitive decline

in novel object recognition was observed under these conditions.

The timing of diet was also important in the SNC supplementation. Under high Phe conditions,

PKU mice that received SNC supplementation were able to master the NOR task at all three

time points. In contrast to the SNC supplementation in low Phe conditions, where the animals

only mastered the NOR task at time point 6 and 9. The original basis SNC supplementation

in Alzheimer’s disease was the idea that Alzheimer’s patients had a greater need for renewal

of synapses than healthy aged-matched controls25. By supplementing specific nutrients, this

nutritional need could be met and consequently improve synaptic functioning25. The positive

results of SNC in the high Phe condition and the low Phe condition on latter time points

could, therefore, be a consequence of meeting a nutritional need for the renewal of synapses.

A need that perhaps was not present at time point 3.


128

Chapter 7

4.3 Specificity of SNC supplementation

Besides the beneficial effect of the SNC nutrients on the Kennedy pathway, the nutrients

(separately) of the SNC combination are likely to positively affect synaptic functioning,

neurotransmitter metabolism, white matter integrity, and oxidative stress. In this study, we

were not able to explore the underlying molecular mechanism in which SNC supplementation

exerted its positive effect in the brain. However, by comparing the different outcome

parameters, we could hypothesize certain brain regions and domains to be affected. In the

PKU mice, SNC supplementation (only in females) and low Phe conditions improved body

weight. An outcome parameter, at times, used as an indication of efficacy of treatment in

PKU mice26,27. Therefore, the improvements found in body weight could indicate efficacy of

treatment by positively effecting growth and/or metabolic stress in PKU26. Future research is

needed to establish the effects of SNC on body composition, energy balance, and the possible

difference between male and female mice in this response. In the behavioral paradigms,

SNC supplementation specifically improved the NOR. The long-term object recognition

protocol used in this study is thought to involve the hippocampal system15,28. This brain

region receives input from the perirhinal cortex, which in turn collects information from

other brain regions involved in visual, olfactory, and somatosensory perception. All these

brain regions are important in object recognition, and the consolidation, acquisition and

retrieval of the memory necessary for mastering the NOR paradigm15,29. The positive effect

of SNC supplementation on the performance in the NOR could possibly come from the

effect of SNC on synaptic plasticity within the hippocampus, important in the novel object

recognition30. Although neurotransmitter release and signaling are positively affected by

SNC supplementation10,31, it is not clear if one or more of the these domains (white matter

integrity, neurotransmitter metabolism and

4.4 CONCLUSION

This study is the first long-term intervention study in BTBR PKU mice that shows that

SNC supplementation can specifically benefit novel object recognition. Future studies are

necessary to identify the mode of action of SNC supplementation.


7

129

Chapter 7

5. REFERENCES











2007; 17: 91–101.





Metab; 101: 99–109.








doi:10.3390/nu8040185.

5 Yehuda S, Rabinovitz S, Carasso RL,

Mostofsky DI. The role of polyunsaturated

fatty acids in restoring the aging neuronal

membrane. Neurobiol Aging; 23: 843–53.

6 Vigh L, Escribá P V, Sonnleitner A,

Sonnleitner M, Piotto S, Maresca B et al.

The significance of lipid composition for

membrane activity: new concepts and ways

of assessing function. Prog Lipid Res 2005;

44: 303–44.

7 Martínez-Cruz F, Osuna C, Guerrero JM.

Mitochondrial damage induced by fetal

hyperphenylalaninemia in the rat brain and

liver: its prevention by melatonin, Vitamin

E, and Vitamin C. Neurosci Lett 2006; 392:

1–4.

8 Martinez-Cruz F, Pozo D, Osuna C, Espinar

A, Marchante C, Guerrero JM. Oxidative

stress induced by phenylketonuria in the rat:

Prevention by melatonin, vitamin E, and

vitamin C. J Neurosci Res 2002; 69: 550–8.

9 Sitta a, Vanzin CS, Biancini GB, Manfredini

V, de Oliveira a B, Wayhs C a Y et al.

Evidence that L-carnitine and selenium

supplementation reduces oxidative stress

in phenylketonuric patients. Cell Mol

Neurobiol 2011; 31: 429–36.






2015; 36: 344–51.






doi:10.1007/8904_2015_498.

12 Pascucci T, Giacovazzo G, Andolina

D, Accoto A, Fiori E, Ventura R et

al. Behavioral and neurochemical

characterization of new mouse model of

hyperphenylalaninemia. PLoS One 2013; 8:

e84697.













202–10.


130

Chapter 7

15 Antunes M, Biala G. The novel object

recognition memory: neurobiology, test

procedure, and its modifications. Cogn

Process 2012; 13: 93–110.

16 Shoji H, Takao K, Hattori S, Miyakawa

T. Age-related changes in behavior in

C57BL/6J mice from young adulthood to

middle age. Mol Brain 2016; 9: 11.

17 Brouwer-Brolsma EM, Schuurman T, de

Groot LCPMG, Feskens EJM, Lute C,

Naninck EFG et al. No role for vitamin

D or a moderate fat diet in aging induced

cognitive decline and emotional reactivity in

C57BL/6 mice. Behav Brain Res 2014; 267:

133–143.

18 Weber M, Wu T, Hanson JE, Alam NM,

Solanoy H, Ngu H et al. Cognitive Deficits,

Changes in Synaptic Function, and Brain

Pathology in a Mouse Model of Normal

Aging. eNeuro 2015; 2. doi:10.1523/

ENEURO.0047-15.2015.

19 Saroja SR, Kim E-J, Shanmugasundaram

B, Höger H, Lubec G. Hippocampal

monoamine receptor complex levels linked

to spatial memory decline in the aging

C57BL/6J. Behav Brain Res 2014; 264: 1–8.





Res 2008; 1210: 179–88.

21 Stapley NW, Guariglia SR, Chadman KK.

Cued and contextual fear conditioning in

BTBR mice is improved with training or

atomoxetine. Neurosci Lett 2013; 549:

120–4.







8587(16)30320-5.

23 Koch R, Moseley K, Ning J, Romstad A,

Guldberg P, Guttler F. Long-term beneficial

effects of the phenylalanine-restricted

diet in late-diagnosed individuals with

phenylketonuria. Mol Genet Metab 1999;

67: 148–55.

24 Semple BD, Blomgren K, Gimlin K,

Ferriero DM, Noble-Haeusslein LJ. Brain

development in rodents and humans:

Identifying benchmarks of maturation and

vulnerability to injury across species. Prog

Neurobiol 2013; 106–107: 1–16.






Dis 2014; 38: 459–79.

26 Solverson P, Murali SG, Brinkman AS,

Nelson DW, Clayton MK, Yen C-LE et al.

Glycomacropeptide, a low-phenylalanine

protein isolated from cheese whey, supports

growth and attenuates metabolic stress in

the murine model of phenylketonuria. Am J

Physiol Endocrinol Metab 2012; 302: E885-

95.

27 Ney DM, Hull AK, van Calcar SC, Liu

X, Etzel MR. Dietary glycomacropeptide

supports growth and reduces the

concentrations of phenylalanine in

plasma and brain in a murine model of

phenylketonuria. J Nutr 2008; 138: 316–22.

28 Reger ML, Hovda DA, Giza CC. Ontogeny

of Rat Recognition Memory measured

by the novel object recognition task. Dev

Psychobiol 2009; 51: 672–678.

29 Oliveira AMM, Hawk JD, Abel T, Havekes

R. Post-training reversible inactivation of

the hippocampus enhances novel object

recognition memory. Learn Mem 2010; 17:

155–160.


7

131

Chapter 7

30 Sarkisyan G, Hedlund PB. The 5-HT7

receptor is involved in allocentric spatial

memory information processing. Behav

Brain Res 2009; 202: 26–31.






2012; 120: 631–40.


CHAPTER 8Large neutral amino acid supplementation exerts its effect through three synergistic mechanisms:

proof of principle in phenylketonuria mice

Danique van Vliet1,2, Vibeke M. Bruinenberg2, Priscila N. Mazzola1,2,

Martijn H.J.R. van Faassen3, Pim de Blaauw3, Ido P. Kema3, M. Rebecca

Heiner-Fokkema3, Rogier D. van Anholt4, Eddy A. van der Zee2,

Francjan J. van Spronsen1*

1University of Groningen, University Medical Center Groningen, Beatrix Children’s

Hospital, Groningen, The Netherlands. 2University of Groningen, Center of Behavior and

Neurosciences, Department of Molecular Neurobiology, Groningen, The Netherlands. 3University of Groningen, University Medical Center Groningen, Department of

Laboratory Medicine, Groningen, The Netherlands.4Independent Researcher, Deventer,

The Netherlands.

PLoS One. 2015 Dec 1;10(12):e0143833. doi: 10.1371/journal.pone.0143833.

eCollection 2015.


134

Chapter 8

ABSTRACT

Background

Phenylketonuria (PKU) was the first disorder in which severe neurocognitive dysfunction

could be prevented by dietary treatment. However, despite this effect, neuropsychological

outcome in PKU still remains suboptimal and the phenylalanine-restricted diet is very

demanding. To improve neuropsychological outcome and relieve the dietary restrictions

for PKU patients, supplementation of large neutral amino acids (LNAA) is suggested as

alternative treatment strategy that might correct all brain biochemical disturbances caused

by high blood phenylalanine, and thereby improve neurocognitive functioning.

Objective

As a proof-of-principle, this study aimed to investigate all hypothesized biochemical

treatment objectives of LNAA supplementation (normalizing brain phenylalanine, non-

phenylalanine LNAA, and monoaminergic neurotransmitter concentrations) in PKU mice.

Methods: C57Bl/6 Pah-enu2 (PKU) mice and wild-type mice received a LNAA supplemented

diet, an isonitrogenic/isocaloric high-protein control diet, or normal chow. After six weeks

of dietary treatment, blood and brain amino acid and monoaminergic neurotransmitter

concentrations were assessed.

Results

In PKU mice, the investigated LNAA supplementation regimen significantly reduced blood

and brain phenylalanine concentrations by 33% and 26%, respectively, compared to normal

chow (p<0.01), while alleviating brain deficiencies of some but not all supplemented LNAA.

Moreover, LNAA supplementation in PKU mice significantly increased brain serotonin

and norepinephrine concentrations from 35% to 71% and from 57% to 86% of wild-type

concentrations (p<0.01), respectively, but not brain dopamine concentrations (p=0.307).

Conclusions

This study shows that LNAA supplementation without dietary phenylalanine restriction

in PKU mice improves brain biochemistry through all three hypothesized biochemical

mechanisms. Thereby, these data provide proof-of-concept for LNAA supplementation as

a valuable alternative dietary treatment strategy in PKU. Based on these results, LNAA

treatment should be further optimized for clinical application with regard to the composition

and dose of the LNAA supplement, taking into account all three working mechanisms of

LNAA treatment.


8

135

Chapter 8

1. INTRODUCTION

Phenylketonuria (PKU; OMIM 261600) is the first disorder in which severe neurocognitive

dysfunction could be prevented by dietary treatment. It is caused by a deficient activity of

the hepatic enzyme phenylalanine hydroxylase (PAH; EC 1.14.16.1), normally converting

phenylalanine (Phe) to tyrosine. If left untreated, classical PKU symptomatology is almost

exclusively restricted to the brain, including severe neurocognitive dysfunction, seizures, and

psychiatric problems, correlating with high blood Phe concentrations1.

This selective brain vulnerability to high blood Phe concentrations is hypothesized to be

related to the transport characteristics for Phe at the blood-brain barrier (BBB)2,3. At the

BBB, the large neutral amino acid transporter 1 (LAT1) is the predominant transport system

for all large neutral amino acids (LNAA), and is saturated for >95%4. Combined with the

fact that LAT1 shows a high affinity to Phe, increased blood Phe concentrations strongly

increase brain Phe influx, outcompeting the transport of other LNAA5-8. Based on both the

increased Phe and the decreased non-Phe LNAA transport across the BBB, different brain

biochemical disturbances underlie brain dysfunction in PKU3,9. High brain Phe concentrations

have been found to be neurotoxic and to affect brain metabolism10-14, while reduced brain

availability of non-Phe LNAA has been related to impaired cerebral protein synthesis6,15.

In addition, impaired cerebral monoaminergic neurotransmitter synthesis may result from

outcompeted brain uptake of their amino acid precursors tyrosine and tryptophan16, and/or

from an inhibitory effect of high brain Phe concentrations on tyrosine hydroxylase (TH) and

tryptophan hydroxylase (TPH)17.

Thus far, blood Phe reduction has been the primary target of treatment in PKU. This can

be accomplished by a severe Phe-restricted diet and, in some patients, by pharmacological

treatment with tetrahydrobiopterin. However, early- and continuously treated PKU patients

still show impaired executive functioning and are prone to develop anxiety and depressive

symptoms18,19. Moreover, the Phe-restricted diet is socially demanding and hard to comply

with20. Therefore, an alternative pathophysiology-based treatment strategy directly targeting

the brain is required. One such possible treatment strategy includes supplementation of LNAA

(without Phe) that aims to restore the disturbed LNAA transport across the BBB without

dietary Phe restriction. Based on aforementioned hypotheses on PKU pathophysiology,

LNAA supplementation could serve to: 1) decrease brain Phe, 2) increase brain non-Phe

LNAA, and/or 3) increase brain monoaminergic neurotransmitter concentrations21.

Previous research on LNAA treatment in PKU has primarily focused on brain and blood Phe

reduction as treatment objective22-28. In addition, LNAA supplementation in PKU patients

was recently found to increase blood and urine melatonin concentrations, which might

reflect increased brain serotonin synthesis29. However, not all brain biochemical treatment


136

Chapter 8

objectives have been investigated. In consequence, optimal composition and dosing of

LNAA treatment is currently unknown, limiting its clinical application. As a first step to

develop an optimal LNAA treatment regimen, the aim of the present study was to assess all

abovementioned hypothesized biochemical treatment objectives of LNAA supplementation

in a PKU mouse model.

2. MATERIAL & METHODS

2.1 Animals

To establish a new breeding colony, breeding pairs of C57Bl/6 Pah-enu2 mice had been

kindly provided by Prof. B. Thöny from the division of Clinical Chemistry and Biochemistry

of the University Children’s Hospital in Zurich in Switzerland. From heterozygous (+/-)

mating, wild-type (WT, +/+), heterozygous, and PKU (-/-) mice of both sexes were obtained.

After weaning at four weeks of age, genetic characterization was performed by quantitative

PCR analysis on DNA extracted from ear tissue. Animals were housed individually at

21±1ºC on a 12-hr light-dark cycle (7:00 am-7:00 pm), and water and AM-II food pellets

(Arie Block BV, Woerden, The Netherlands) were offered ad libitum. In total, 42 WT (21

male, 21 female) and 46 PKU (23 male, 23 female) mice were used. This study was carried

out in strict accordance with the recommendations in the Guide for the Care and Use of

Laboratory Animals of the National Institutes of Health (S1 File; ARRIVE guidelines

checklist). The protocol was approved by the Institutional Animal Care and Use Committee

of the University of Groningen (Permit Number: 6504A).

2.2 Experimental design

At postnatal day 37, animals were assigned to one of three treatment groups based on

genotype and sex, receiving either normal chow, a high-protein diet, or a LNAA supplemented

diet. Dietary treatment was continued for six weeks. During the first week of treatment,

body weight and food intake were measured daily, after which body weight and food intake

were determined at weekly intervals. Food intake was manually assessed by the difference

between food given and left on the cages’ tops using a scale. Spilled food was not measured

because it has been shown to represent less than 0.1 g/day/mouse30. After six weeks of

dietary treatment, animals were euthanized by combined heart puncture and decapitation

under inhalation-anesthetics with isoflurane 2-3 hours after the beginning of the light phase.

2.3 Experimental diets

The basal diet during the experiment was based on the composition of AIN-93M31, which

was also administered in unadjusted form to the untreated control group (normal chow).

The experimental LNAA diet was based on the LNAA regimen as used in the study by Pietz

et al.26. It was produced by adding LNAA to the basal diet at the expense of cornstarch

on a weight-for-weight basis. The added amount of LNAA was equal to the amount of


8

137

Chapter 8

(natural) protein in the basal diet, in effect doubling the amount of protein/amino acids in

the LNAA supplemented diet. The LNAA added in the LNAA supplemented diet included

equal amounts of l-tyrosine, l-tryptophan, l-valine, l-isoleucine, l-leucine, l-methionine, and

l-histidine. To control for the extra amount of protein in the LNAA supplemented diet, a

high-protein control diet was included. This high-protein diet was produced by adding extra

casein to the AIN-93M diet at the expense of cornstarch on a weight-for-weight basis, and

was calculated to result in an isonitrogenic and isocaloric control diet for the experimental

LNAA diet. Diets were prepared by Research Diet Services B.V. (Wijk bij Duurstede, The

Netherlands).

2.4 Biochemical analyses

To obtain plasma and brain material for biochemical analyses, blood was collected by heart

puncture and whole brains were removed. Blood was centrifuged at 1500 g for 10 min and

plasma was collected and stored at -80 ºC until further analysis. The cerebrum was snap

frozen in liquid nitrogen and stored at -80 ºC until further preparation. Frozen cerebrum was

crushed in liquid nitrogen and divided into aliquots. Frozen brain powder for amino acid

measurements was processed to 20% (weight: volume (w:v)) homogenates in phosphate-

buffered saline (pH 7.4), and for tryptophan, indole and catecholamine measurements to

2% (w:v) homogenates in acetic acid (0.08 M). Brain homogenates were sonified on ice at

11-12 W. Next, samples were centrifuged at 800 rcf for 10 min (4 ºC), and the supernatant/

internatant was put on ice to be used for further analysis.

For brain amino acid (except for tryptophan) measurements, norleucine in sulfosalicylic

acid was added as an internal standard to the 20% brain homogenate (1:1, v:v). Samples

were vortexed and centrifuged at 20.800 rcf for 4 min. Plasma amino acid measurements

were performed according to the same method, using 50 µl plasma instead of 20% brain

homogenate. Amino acid concentrations were measured with a method based on ion

exchange chromatography with post column derivatization with Ninhydrin on a Biochrom

30+ analyser (Pharmacia Biotech, Cambridge, UK).

For tryptophan and monoaminergic neurotransmitter measurements, an anti-oxidative

solution was prepared in demineralised water (0.4 g/l ascorbic acid and 1.616 g/l

ethylenediaminetetraacetic acid). For tryptophan and indole measurements, 25 µl of the

anti-oxidative solution was added to 25 µl of the 2% brain homogenate. For catecholamine

measurements, 40 µl of the anti-oxidative solution was added to 10 µl of the 2% brain

homogenate. Plasma tryptophan measurements were performed using 25 µl plasma instead

of 2% brain homogenate. Analysis of tryptophan and monoaminergic neurotransmitter

concentrations was performed using liquid chromatography in combination with isotope

dilution mass spectrometry, essentially as described by Van de Merbel et al.32.


138

Chapter 8

2.5 Statistical analyses

Statistical analyses were performed using the software IBM SPSS Statistics for Windows,

Version 22.0. (Armonk, NY: IBM Corp.). Data of the one animal that was euthanized

preterm, were excluded from analyses. All tests were performed two-sided at a significance

level of α=0.05.

Analyses on brain and blood biochemistry as well as on weekly food intake (per g body

weight) were performed by two-way ANOVA with genotype and diet as independent

variables. In case of not normally distributed data (assessed by Shapiro-Wilk test) or unequal

variances (assessed by Levene’s test), analyses were performed on log-transformed data.

If the interaction between genotype and diet and/or a main effect of diet was found to be

significant, data were further analyzed by one-way ANOVA and Tukey’s post-hoc tests for

PKU and WT mice separately.

The effect of dietary treatment on body weight was analyzed for WT and PKU male and

female mice separately by repeated-measures ANOVA with one between factor (diet, three

levels: normal chow, high-protein diet, and LNAA diet) and one within factor (time, 7 levels:

0, 1, 2, 3, 4, 5, and 6 weeks) and Tukey’s post-hoc analysis.

To investigate whether brain Phe concentrations in PKU mice were primarily determined by

blood Phe concentrations or by dietary treatment, multiple linear regression analysis was

performed with blood Phe concentrations and dietary treatment as independent variables.

Data are expressed as mean ± standard deviation (SD).

3. RESULTS

3.1 Food and LNAA intake

Amino acid contents of the different diets are presented in Table 1.

Weekly food intake (expressed as g food/g body weight/week), as shown in Fig 1, decreased

during the first weeks for all treatment groups, stabilizing in the later weeks of dietary

treatment. In both the fifth and sixth week of dietary treatment, two-way ANOVA analyses

showed a significant main effect of genotype on food intake (p<0.01). Moreover, in both

weeks, a significant main effect of dietary treatment (p<0.01), and a significant interaction

between genotype and dietary treatment on food intake was observed (p<0.01 for week 5,

p<0.05 for week 6). In PKU mice, food intake in both weeks was lower on high-protein

diet than on normal chow (p<0.05), while being even lower on LNAA supplemented diet

(p<0.01). In WT mice, food intake in both weeks did not significantly differ for any of the

dietary treatments (p=0.376 and p=0.322). Based on the weekly food intakes and amino acid

contents of the different diets, mean daily intakes of individual LNAA during the six week


8

139

Chapter 8

dietary treatment were calculated for all experimental groups as shown in the Supplemental

Table 1 (S1 Table).

Table 1. Nutritional content of the experimental diets (g/kg diet).

Nutritional content* normal chow LNAA diet high-protein diet

Carbohydrates 674 550 551

Fat 41 41 41

Dietary fibre 50 50 50

Protein 124 248 248

Amino acids**

LNAA L-Phenylalanine 6.0 6.1 (0.1) 12.2 (6.2)

L-Tyrosine 4.8 20.1 (15.3) 12.1 (7.3)

L-Valine 7.4 25.0 (17.6) 15.9 (8.5)

L-Isoleucine 5.9 22.9 (17.0) 12.4 (6.4)

L-Leucine 10.9 28.0 (17.1) 23.1 (12.2)

L-Methionine 3.0 19.7 (16.7) 6.9 (3.9)

L-Histidine 3.2 19.0 (15.8) 6.8 (3.5)

L-Threonine 5.3 5.7 (0.3) 11.3 (5.9)

non-LNAA L-Aspartic acid 9.3 9.7 (0.4) 19.4 (10.1)

L-Serine 7.7 7.9 (0.2) 15.8 (8.1)

L-Glutamic acid 28.2 29.9 (1.7) 59.6 (31.4)

Glycine 2.7 2.7 (0.0) 5.2 (2.5)

L-Alanine 3.9 4.2 (0.3) 8.2 (4.3)

L-Lysine 9.1 9.9 (0.8) 19.5 (10.4)

L-Arginine 4.2 4.7 (0.5) 9.5 (5.3)

Contents are not shown for L-Tryptophan, L-Proline, and L-cyst(e)ine, as these were not measured due

to technical limitations. Differences with LNAA contents of normal chow are stated in brackets. LNAA,

large neutral amino acid.

*Mineral and vitamin premixes were also included in accordance with the composition of the AIN93M

diet30.

**Dietary contents as measured in samples of prepared food pellets.


140

Chapter 8

Fig 1. Weekly food intake for WT (A) and PKU (B) mice on different diets

Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were n=14, n=14,

and n=14 for WT mice respectively, while being n=15, n=14, and n=15 for PKU mice. Error bars

represent SEM.

3.2 Body weight and general health

At initiation of treatment, body weight of PKU mice (male 13.7 ± 3.6 g; female: 12.8 ± 2.1 g)

was lower than of WT mice (male 18.9 ± 1.5 g; female: 15.6 ± 1.8 g), but did not significantly

differ between dietary groups in PKU nor WT mice. Body weight curves during treatment

were significantly lower for WT female mice on LNAA supplemented diet compared to

either normal chow (p<0.05) or high-protein diet (p<0.01), but did not significantly differ

between dietary treatments for WT male (p=0.485) and PKU male or PKU female mice

(p=0.397 and p=0.343) (Fig 2).

During the experiment, one animal (WT female on LNAA supplemented diet) was euthanized

on the 19th day after inclusion, because of too much weight loss. Pathological examination

showed hydrocephalus, which is sometimes found in C57Bl/6 (both WT and PKU) mice.

Fig 2. Body weights during the experiment

Mean body weights for A) male and B) female WT (dashed lines) and PKU (solid lines) mice on different

diets. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were n=14,

n=14, and n=14 for WT mice respectively, while being n=15, n=14, and n=15 for PKU mice. Error bars

represent SEM.


8

141

Chapter 8

3.3 Plasma amino acids

Plasma concentrations of individual LNAA in PKU and WT mice on control and LNAA

supplemented diets are depicted in Fig 3. Two-way ANOVA analyses showed a significant

main effect of genotype on plasma Phe, tyrosine, tryptophan (p<0.01), and threonine

concentrations (p<0.05). In PKU compared to WT mice on normal chow, plasma Phe

concentrations were increased by almost 30-fold. Plasma tyrosine, tryptophan, and

threonine concentrations in PKU mice were reduced to 55%, 77%, and 79%, respectively,

of concentrations in WT mice on normal chow. For other LNAA, no significant main effect

of genotype was observed on plasma concentrations.

A significant main effect of dietary treatment was observed on plasma concentrations of all

LNAA except for threonine (p=0.073 for threonine; p<0.05 for tyrosine; p<0.01 for all other

LNAA). Moreover, two-way ANOVA analyses showed a significant interaction between

genotype and dietary treatment on plasma Phe and methionine concentrations (p<0.01

for both). In PKU mice, plasma Phe concentrations on LNAA supplemented diet were

significantly reduced to 67% of concentrations on normal chow (p<0.01), while plasma Phe

concentrations on high-protein diet were significantly higher than on normal chow (p<0.01).

In WT mice on LNAA, plasma Phe concentrations were reduced compared to control diets

(p<0.05), but concentrations on high-protein diet did not significantly differ from those on

normal chow (p=0.929). Plasma concentrations of supplemented LNAA were higher on

LNAA supplementation compared to control diets, both in PKU and WT mice, although this

did not reach statistical significance for all LNAA.

Plasma concentrations of non-LNAA amino acids in PKU and WT mice on control and

LNAA supplemented diets are presented in Supplemental table 2 (S2 Table). In both PKU

and WT mice, plasma glycine and lysine concentrations on LNAA supplemented diet were

lower compared to control diets (p<0.05), just not reaching statistical significance for lysine

in PKU mice (p=0.051). In addition, plasma serine concentrations were lower on LNAA

supplementation compared to control diets in WT mice (p<0.05), but not in PKU mice

(p=0.407).


142

Chapter 8

Fig 3. Plasma LNAA concentrations

Plasma concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine, F)

leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after six weeks of receiving

different diets. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were

n=14, n=12, and n=14 for WT mice respectively, while being n=14, n=12, and n=15 for PKU mice.

Untransformed data are expressed as mean ± SEM.

* p<0.05; ** p<0.01; § p<0.05 and §§ p<0.01 compared to WT mice on normal chow.

3.4 Brain amino acids

Brain concentrations of individual LNAA in PKU and WT mice on control and LNAA

supplemented diets are depicted in Fig 4. Two-way ANOVA analyses showed a significant

main effect of genotype on brain concentrations of all LNAA except for methionine (p<0.01

for all LNAA but methionine, p=0.523 for methionine). In PKU compared to WT mice on

normal chow, brain Phe concentrations were increased by 8.3-fold. Also, brain histidine

concentrations in PKU mice were elevated to 139% of WT concentrations on normal chow.

Brain concentrations of all other non-Phe LNAA but methionine were reduced in PKU

mice on normal chow, ranging from 52% of concentrations in corresponding WT mice for

tyrosine to 77% for leucine.

A significant main effect of dietary treatment was observed on brain Phe, tryptophan,

methionine, and threonine concentrations (p<0.01 for all). Moreover, two-way ANOVA

analyses showed a significant interaction between genotype and dietary treatment on brain

Phe, methionine, and histidine concentrations (p<0.01 for Phe and methionine, p<0.05 for

histidine). Brain Phe concentrations in PKU mice on LNAA supplementation were reduced to


8

143

Chapter 8

74% of concentrations on normal chow (p<0.01), still being 6.1-fold higher when compared

to WT concentrations on normal chow. Brain Phe concentrations in PKU mice on high-

protein diet were higher than in PKU mice on normal chow (p<0.05). Brain tryptophan,

histidine, and methionine concentrations in PKU mice on LNAA supplementation were

significantly higher when compared to PKU mice on normal chow (p<0.05), resulting in

concentrations of 100% and 166% of WT concentrations on normal chow for tryptophan

and histidine, and an elevation by 3.6-fold for methionine. In contrast, brain threonine

concentrations in PKU mice on LNAA supplementation were lower when compared to PKU

mice on control diets (p<0.01).

In WT mice, brain Phe concentrations on LNAA supplementation tended to be lower when

compared to normal chow, although this just did not reach statistical significance (p=0.053).

Similar to PKU mice, brain methionine concentrations were higher, whereas brain threonine

concentrations were lower on LNAA supplementation as compared to control diets (p<0.01

for all).

Brain concentrations of non-LNAA amino acids in PKU and WT mice on control and LNAA

supplemented diets are presented in Supplemental Table 3 (S3 Table). In both PKU and

WT mice, brain serine and glycine concentrations on LNAA supplemented diet were lower

compared to control diets (p<0.05), although this did not reach statistical significance for

glycine in PKU mice on LNAA supplementation compared to high-protein diet (p=0.064). In

addition, in WT mice only, brain lysine concentrations were lower (p<0.01), whereas brain

taurine concentrations were higher on LNAA supplementation compared to control diets

(p<0.05).


144

Chapter 8

Fig 4 Brain LNAA concentrations

Brain concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine, F)

leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after six weeks of receiving

different diets. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet were

n=13, n=12, and n=14 for WT mice respectively, while being n=14, n=12, and n=14 for PKU mice.


* p<0.05; ** p<0.01; § p<0.05 and §§ p<0.01 compared to WT mice on normal chow.

3.5 Brain monoaminergic neurotransmitters

Brain monoaminergic neurotransmitter and associated metabolite concentrations in PKU

and WT mice are depicted in Fig 5. In the catecholamine pathway, two-way ANOVA

analyses showed significant main effects of genotype on brain dopamine and norepinephrine

concentrations (p<0.01 for both). Brain dopamine and norepinephrine concentrations in

PKU mice on normal chow were reduced to 76% and 57%, respectively, of concentrations

in WT mice on the same diet. In the serotonergic pathway, significant main effects of

genotype were observed on brain concentrations of serotonin and its associated metabolite

5-hydroxyindoleacetic acid (5-HIAA) (p<0.01 for both). Brain serotonin and 5-HIAA

concentrations in PKU mice on normal chow were decreased to 35% and 26%, respectively,

of concentrations in corresponding WT mice.

Dietary treatment had no significant effect on brain catecholamine or serotonin concentrations

in WT mice, while in PKU mice it did. A significant main effect of dietary treatment was


8

145

Chapter 8

observed on brain catecholamine, serotonin, and 5-HIAA concentrations (p<0.01 for all

but dopamine, p<0.05 for dopamine). Moreover, two-way ANOVA analyses showed a

significant interaction between genotype and dietary treatment on brain norepinephrine,

serotonin, and 5-HIAA (p<0.01 for all), but not dopamine concentration (p=0.766).

In the catecholamine pathway, LNAA supplementation in PKU mice resulted in significantly

higher brain norepinephrine concentrations compared to normal chow (p<0.01), and partially

restored its deficit to an average of 86% of concentrations in WT mice on normal chow. In

contrast, brain dopamine concentrations did not significantly differ in PKU mice between the

dietary treatments (p=0.307). In WT mice, no significant differences were observed between

any of the dietary treatments for neither dopamine (p=0.104) nor norepinephrine (p=0.283).

In the serotonergic pathway, in PKU mice on LNAA supplementation, both brain serotonin

and 5-HIAA concentrations were significantly increased when compared to control diets

(p<0.01), partially restoring their concentrations to an average of 71% and 67%, respectively,

of concentrations in WT mice on normal chow. In WT mice on LNAA supplementation,

brain serotonin concentrations tended to be higher compared to normal chow (p=0.051), and

brain 5-HIAA concentrations tended to be higher compared to high-protein diet (p=0.097),

but both did not reach statistical significance.

Fig 5 Brain monoaminergic neurotransmitter concentrations

Brain concentrations of A) dopamine, B) norepinephrine, C) serotonin in WT and PKU mice after six

weeks of receiving different dietary treatments. Numbers of mice on normal chow, LNAA supplemented

diet, and high-protein diet were n=13, n=12, and n=14 for WT mice respectively, while being n=15,

n=13, and n=15 for PKU mice. Untransformed data are expressed as mean ± SEM.

**p<0.01; §§ p<0.01 compared to WT mice on normal chow.

3.6 Relation between plasma and brain Phe

To investigate whether the reduction of brain Phe concentrations on LNAA supplementation

in PKU mice was primarily related to an effect at the BBB or especially related to reduced

blood Phe concentrations, the relationship between blood and brain Phe concentrations was

assessed in PKU mice on LNAA supplementation and control diets (Fig 6). Multiple linear

regression analysis showed that brain Phe concentrations in PKU mice were significantly


146

Chapter 8

predicted (adjusted R2=0.801, F=75.525, p<0.01) by both blood Phe concentrations

(B=0.127, SE B=0.026, β=0.521) and LNAA supplemented diet (B=-166.940, SE B=39.006,

β=-0.451). Brain non-Phe LNAA concentrations in PKU mice on normal chow, LNAA

supplementation, and high-protein diet did not show a clear relationship with either their

respective blood concentrations nor with blood Phe concentrations (data not shown).

Fig 6 Plasma versus brain Phe concentrations in PKU mice on different dietary treatments

Relationship between plasma Phe and brain Phe concentrations in PKU mice on normal chow (n=13),

LNAA supplemented diet (n=12), and high-protein diet (n=14).

3.7 Relation between brain monoaminergic neurotransmitters and their precursors

To investigate whether the increase of brain serotonin and norepinephrine on LNAA

supplementation in PKU mice was primarily due to (1) increased brain availability of

their precursors, or to (2) enhanced conversion of their precursors, brain monoaminergic

neurotransmitters were assessed in relation to their respective (amino acid) precursors (Fig

7).

Two-way ANOVA analyses showed a significant main effect of genotype on ratios of brain

dopamine/tyrosine, norepinephrine/dopamine, and serotonin/tryptophan (p<0.01 for all),

but not norepinephrine/tyrosine concentrations (p=0.184). Ratios of brain dopamine/

tyrosine were increased, while rations of brain norepinephrine/dopamine and serotonin/

tryptophan concentrations were reduced in PKU compared to WT mice on normal chow.

A significant main effect of dietary treatment was observed on ratios of brain norepinephrine/

dopamine concentrations only (p<0.01). In addition, two-way ANOVA analyses showed


8

147

Chapter 8

a significant interaction between genotype and dietary treatment on ratios of brain

norepinephrine/dopamine and serotonin/tryptophan concentrations (p<0.01 for both).

In PKU mice on LNAA supplementation, ratios of brain norepinephrine/dopamine were

increased compared to control diets (p<0.01). Also, ratios of brain serotonin/tryptophan

concentrations in PKU mice on LNAA supplementation were higher as compared to control

diets (p<0.05).

Fig 7 Ratios of brain monoaminergic neurotransmitters to precursors

Ratios of brain A) dopamine/tyrosine, B) norepinephrine/tyrosine, C) norepinephrine/dopamine, and

D) serotonin/tryptophan concentrations in WT and PKU mice after six weeks of receiving different

dietary treatments. Numbers of mice on normal chow, LNAA supplemented diet, and high-protein diet

were n=13, n=12, and n=14 for WT mice respectively, while being n=14, n=12, and n=14 for PKU mice.


*p<0.05; **p<0.01; and § p<0.05; §§ p<0.01 compared to WT mice on normal chow.

4. DISCUSSION

This study is the first to investigate all hypothesized biochemical treatment effects of LNAA

supplementation using one LNAA supplementation regimen and a single experimental

design. Besides reducing blood Phe concentrations, the present study showed that LNAA

supplementation without dietary Phe restriction in PKU mice could directly improve brain

biochemistry through three mechanisms: 1) reducing brain Phe concentrations, 2) attenuating

the brain deficiencies of some, but not all, LNAA, and 3) increasing brain serotonin and

norepinephrine, but not dopamine concentrations. Before discussing these results in more

detail, we will first address some methodological issues.


148

Chapter 8

Firstly, the present experiment was performed in Pah-enu2 (PKU) mice, a well-established

model that resembles the genetics, biochemistry and neurobiology of classical PKU in

humans. Biochemically, PKU mice show high blood and brain Phe concentrations in

combination with brain non-Phe LNAA and monoaminergic neurotransmitter deficits that

also characterize human PKU biochemistry. Km-values for LNAA transport at the BBB

have not been determined for (PKU) mice33. However, Km-values for individual LNAA as

determined in vivo in rats and in human brain capillaries showed a significant correlation34,

while being approximately 8-40 times lower for humans than for rats. This could imply

that competition between Phe and non-Phe LNAA for transport across the BBB takes place

at lower plasma concentrations in humans than in rats (and maybe mice), so that LNAA

supplementation might be even more effective in PKU patients. One of the important

advantages of this PKU mouse model over clinical studies is the possibility to measure not

only Phe (that can be determined in humans by magnetic resonance spectroscopy (MRS))

but also non-Phe LNAA and monoaminergic neurotransmitter concentrations in brain (that

at present cannot be measured by MRS).

Secondly, the LNAA supplemented diet used was based on the study by Pietz et al. (1999) that

investigated the effect of concomitant LNAA supplementation during an oral Phe challenge

on brain Phe uptake and EEG activity in PKU patients26. The LNAA supplementation

regimen used by Pietz et al. consisting of equal amounts (150 mg/kg body weight) of all non-

Phe LNAA except for threonine, in total, approximated the daily dietary protein intake for

adults. To translate this acute regimen for PKU patients to chronic treatment in PKU mice,

the total amount of added LNAA in the present study was equal to the amount of natural

protein in the basal diet. In full accordance with the study by Pietz et al., threonine was not

supplemented, even though Sanjurjo et al. (2003) have shown threonine supplementation

alone (50 mg/kg/d) reduced blood Phe concentrations by 36% in PKU patients35.

4.1 LNAA supplementation reduces blood Phe concentrations

Although LNAA supplementation is suggested to improve brain metabolism primarily by

restoring the unbalanced LNAA transport at the BBB, LNAA supplementation in PKU mice

was also found to significantly reduce blood Phe concentrations to 67% of concentrations

on normal chow. This is in accordance with previous studies on LNAA supplementation in

PKU mice showing plasma Phe reductions to 47.0-63.5% of concentrations in untreated

PKU controls23,24. LNAA supplementation has been hypothesized to exert this effect through

competition with Phe for uptake at the gut-blood barrier21, or through increased Phe

utilization due to higher net protein synthesis21. In support of this last hypothesis, food

intake of PKU mice during the final weeks of the experiment was significantly lower on

LNAA supplemented diet than on control diets, while body weight did not significantly

differ. This may suggest that LNAA supplementation indeed induced anabolism in PKU

mice, thereby demanding a lower dietary protein (and thus food) intake, and by that


8

149

Chapter 8

contributing to the observed plasma Phe reduction. As expected, plasma concentrations

of supplemented LNAA in PKU mice were all increased. Surprisingly, however, plasma

tyrosine concentrations in PKU mice remained low-normal on the currently applied LNAA

supplemented diet. Even when correcting for the 20% of the supplemented tyrosine that

is assumed not to be absorbed in the gastrointestinal tract21, tyrosine intake still was 3.5

times higher in the LNAA supplemented diet compared to normal chow. Similar to plasma

tyrosine concentrations, brain tyrosine concentrations were not significantly increased on

LNAA supplemented diet either, while brain norepinephrine - the end product of tyrosine-

derived neurotransmitter metabolism - was significantly increased on LNAA supplemented

diet. Therefore, a possible explanation might be that all supplemented tyrosine was used to

partly restore the profound brain norepinephrine deficiency, and thereby did not result in

increased plasma and brain tyrosine concentrations.

4.2 LNAA supplementation reduces brain Phe concentrations, while attenuating brain

deficiencies of some but not all non-Phe LNAA

In brain, Phe concentrations on LNAA supplementation in PKU mice were significantly

reduced by 26% compared to concentrations on normal chow. This is in good agreement

with previous studies on LNAA supplementation in both PKU patients25 and mice24, showing

brain Phe reductions of 20-46%. Moreover, it may well support the finding of a clear

competitive effect on Phe transport across the BBB in PKU patients by Pietz et al. (1999)

using a comparable LNAA supplement26. As besides brain Phe, blood Phe concentrations

were also reduced in PKU mice on LNAA supplementation, the question arises whether the

reduced brain Phe concentrations might be due to the reduced plasma Phe concentrations

rather than a direct effect at the BBB level. Multiple linear regression analysis suggests,

however, that LNAA supplementation reduced brain Phe concentrations in PKU mice

through a combined effect of both plasma Phe reduction and enhanced competition at the

BBB.

This is the first time that brain non-Phe LNAA concentrations have been reported in response

to LNAA supplementation in PKU. The LNAA supplementation regimen that was used,

changed most brain non-Phe LNAA concentrations, restoring brain tryptophan in PKU mice

to WT concentrations. Brain methionine concentrations were even significantly increased by

5.5-fold in PKU mice on LNAA supplementation compared to normal chow, corresponding

with the similarly strong increases in blood. Although the cerebral and systemic effects

and possible toxicity due to these strongly elevated methionine concentrations are not

fully understood36, at least these results warrant against indiscriminate supplementation

of methionine in PKU. Also, brain histidine concentrations in PKU mice were even

further increased on LNAA supplementation. From the fact that histidinaemia, in which

brain histidine concentrations are much more increased, is not associated with any brain

dysfunction, we may conclude that this elevation of brain histidine as observed in PKU mice


150

Chapter 8

probably does not have clinical significance37. On the other hand, brain concentrations of

threonine, which was not included in the LNAA supplement, were significantly reduced in

both PKU and WT mice on LNAA supplemented diet. This further supports the idea that

highly unbalanced LNAA intake may induce brain deficiencies of some LNAA.

It can be concluded from these results that LNAA supplementation in PKU mice indeed

attenuates brain Phe concentrations and attenuates brain deficiencies of (at least some) non-

Phe LNAA. At the same time, results suggest that the relationships between brain non-Phe

LNAA concentrations and their respective plasma concentrations as well as plasma Phe

concentrations are complex and differ for each non-Phe LNAA, given the amount of LNAA

supplementation used in this study. Development of the optimal LNAA supplementation

regimen that can both effectively reduce brain Phe concentrations and improve brain

concentration of all non-Phe LNAA therefore clearly deserves further research.

4.3 LNAA treatment improves brain serotonin and norepinephrine, but not dopamine,

concentrations

Besides its effect on brain LNAA concentrations, LNAA supplementation in PKU mice

significantly increased brain serotonin from 35% to 71% of concentrations in WT mice.

Also, brain norepinephrine in PKU mice on LNAA supplementation increased from 57%

to 86% of concentrations in WT mice, whereas brain dopamine concentrations remained

unchanged. Although brain monoaminergic neurotransmitter concentrations in response

to LNAA supplementation have not been reported previously, a recent study on LNAA

supplementation in PKU patients showed increased melatonin (a serotonin metabolite)

concentrations in plasma and urine, which - according to the authors- could be a possible

new marker for brain serotonin synthesis in PKU patients29. As C57Bl/6 is one of many

mouse strains being deficient in melatonin38, unfortunately, we were unable to correlate brain

serotonin and plasma melatonin concentrations. Regarding the clinical importance of brain

monoaminergic neurotransmitters in PKU, traditionally, especially brain dopamine deficiency

has been associated with cognitive and mood disturbances in PKU39,40. However, brain

norepinephrine impairments may have been underestimated, while cerebral norepinephrine

abnormalities have been associated with many (neuro)psychiatric disorders41.

Both insufficient precursor availability and impaired TH and TPH activity by inhibition

of excessive brain Phe concentrations have been hypothesized to account for the brain

monoaminergic neurotransmitter deficits in PKU. The present results suggest that the

relative contribution of each of these mechanisms may be different for the dopaminergic

and serotoninergic pathways in PKU. Regarding the brain catecholamine deficiencies, the

increased ratio of brain dopamine/tyrosine and unaffected ratio of brain norepinephrine/

tyrosine in PKU mice could be explained in two ways, each supporting one of the two

aforementioned main theories on brain monoaminergic neurotransmitter deficiencies in


8

151

Chapter 8

PKU. Firstly, it may indicate that insufficient brain tyrosine availability rather than inhibition

of TH by high Phe would be responsible for the brain catecholamine deficiencies observed

in PKU. This would support the report by Fernstrom et al. (2007) concluding that increased

brain Phe is not likely to impair catecholamine synthesis in PKU, whereas low brain tyrosine

does42. In consequence, this would implicate that even higher blood tyrosine concentrations

may be needed to restore brain dopamine concentrations. Secondly, the increased ratio

of brain dopamine/tyrosine and unaffected ratio of brain norepinephrine/tyrosine in PKU

compared to WT mice on normal chow may be explained by the fact that brain dopamine

is not exclusively derived from brain tyrosine. This would support the report by Ikeda et al.

(1967) showing that TH, at least in vitro, could synthesize catecholamines also from Phe,

which is abundant in the PKU brain. This would suggest that insufficient precursor amino

acid availability in brain would not be the primary mechanism underlying reduced dopamine

concentrations, but inhibition of TH by high Phe is43. In consequence, this would imply that

further reduction of brain Phe concentrations would probably be most effective to increase

brain dopamine concentrations in PKU. Regarding the observed serotonin deficits in PKU,

the reduced ratios of brain serotonin/tryptophan in PKU mice suggest that inhibition of TPH

by high Phe does play an important role in the cerebral serotonin impairments characterizing

PKU. This is in good agreement with the in vitro observation that Phe inhibits TPH more

strongly than TH44. To further discriminate between the importance of both hypothesized

mechanisms underlying brain monoaminergic neurotransmitter impairments in PKU, future

studies need to investigate the effects of selective brain tyrosine and tryptophan increase and

selective brain Phe reduction on monoaminergic neurotransmitter concentrations in PKU

mice.

To conclude, this study was the first to investigate all hypothesized biochemical treatment

objectives of LNAA supplementation in PKU. Results in PKU mice showed that LNAA

supplementation improves brain biochemistry in PKU by three synergistic mechanisms.

Thereby, this study provides proof-of-concept for LNAA supplementation as a possible

alternative treatment strategy for PKU that improves brain biochemistry by targeting

the unbalanced LNAA transport across the BBB. Before clinical application should be

considered, however, further optimization of LNAA treatment with regard to the LNAA

being supplemented and their dose is required, taking into account all three brain biochemical

treatment objectives.

ACKNOWLEDGEMENTS

The authors express their gratitude to Mrs. H.A. Kingma, Mrs. E.Z. Jonkers, Mrs. K. Boer,

and Mrs. H. Adema for their analytical support.


152

Chapter 8

REFERENCES


Phenylketonuria. Lancet 2010 Oct

23;376(9750):1417-1427.

2 Pardridge WM. Blood-brain barrier carrier-

mediated transport and brain metabolism

of amino acids. Neurochem Res 1998

May;23(5):635-644.


DJ. Brain dysfunction in phenylketonuria:

is phenylalanine toxicity the only

possible cause? J Inherit Metab Dis 2009

Feb;32(1):46-51.

4 Smith QR. Transport of glutamate and

other amino acids at the blood-brain barrier.

J Nutr 2000 Apr;130(4S Suppl):1016S-22S.

5 Knudsen GM, Hasselbalch S, Toft PB,

Christensen E, Paulson OB, Lou H. Blood-

brain barrier transport of amino acids

in healthy controls and in patients with

phenylketonuria. J Inherit Metab Dis

1995;18(6):653-664.

6 de Groot MJ, Hoeksma M, Reijngoud DJ,

de Valk HW, Paans AM, Sauer PJ, et al.

Phenylketonuria: reduced tyrosine brain

influx relates to reduced cerebral protein

synthesis. Orphanet J Rare Dis 2013 Sep

4;8(1):133.

7 Shulkin BL, Betz AL, Koeppe RA, Agranoff

BW. Inhibition of neutral amino acid

transport across the human blood-brain

barrier by phenylalanine. J Neurochem

1995 Mar;64(3):1252-1257.

8 Oldendorf WH, Sisson BW, Silverstein A.

Brain uptake of selenomethionine Se 75. II.

Reduced brain uptake of selenomethionine

Se 75 in phenylketonuria. Arch Neurol 1971

Jun;24(6):524-528.

9 de Groot MJ, Hoeksma M, Blau

N, Reijngoud DJ, van Spronsen FJ.

Pathogenesis of cognitive dysfunction in

phenylketonuria: review of hypotheses. Mol

Genet Metab 2010;99 Suppl 1:S86-9.


DJ, Paans AM, van Spronsen FJ.




Metab 2014 Oct 29.

11 Glushakov AV, Glushakova O, Varshney

M, Bajpai LK, Sumners C, Laipis PJ, et

al. Long-term changes in glutamatergic

synaptic transmission in phenylketonuria.

Brain 2005 Feb;128(Pt 2):300-307.

12 Martynyuk AE, Glushakov AV, Sumners

C, Laipis PJ, Dennis DM, Seubert

CN. Impaired glutamatergic synaptic

transmission in the PKU brain. Mol Genet

Metab 2005 Dec;86 Suppl 1:S34-42.


Daikhin E, Kendler A, Nguyen LB, et al. Is

there a relationship between 3-hydroxy-3-

methylglutaryl coenzyme a reductase activity

and forebrain pathology in the PKU mouse?

J Neurosci Res 2000 Sep 1;61(5):549-563.

14 Horster F, Schwab MA, Sauer SW,

Pietz J, Hoffmann GF, Okun JG, et al.

Phenylalanine reduces synaptic density in

mixed cortical cultures from mice. Pediatr

Res 2006 Apr;59(4 Pt 1):544-548.

15 Smith CB, Kang J. Cerebral protein


phenylketonuria. Proc Natl Acad Sci U S A

2000 Sep 26;97(20):11014-11019.

16 Hommes FA, Lee JS. The control of

5-hydroxytryptamine and dopamine

synthesis in the brain: a theoretical

approach. J Inherit Metab Dis

1990;13(1):37-57.


8

153

Chapter 8

17 Pascucci T, Andolina D, Mela IL,

Conversi D, Latagliata C, Ventura R,

et al. 5-Hydroxytryptophan rescues

serotonin response to stress in prefrontal

cortex of hyperphenylalaninaemic mice.

Int J Neuropsychopharmacol 2009

Sep;12(8):1067-1079.

18 Smith I, Knowles J. Behaviour in early

treated phenylketonuria: a systematic

review. Eur J Pediatr 2000 Oct;159 Suppl

2:S89-93.

19 Jahja R, Huijbregts SC, de Sonneville

LM, van der Meere JJ, van Spronsen FJ.

Neurocognitive evidence for revision

of treatment targets and guidelines

for phenylketonuria. J Pediatr 2014

Apr;164(4):895-899.e2.

20 MacDonald A. Diet and compliance in

phenylketonuria. Eur J Pediatr 2000

Oct;159 Suppl 2:S136-41.

21 van Spronsen FJ, de Groot MJ, Hoeksma

M, Reijngoud DJ, van Rijn M. Large neutral

amino acids in the treatment of PKU: from

theory to practice. J Inherit Metab Dis 2010

Dec;33(6):671-676.

22 Matalon R, Michals-Matalon K, Bhatia

G, Burlina AB, Burlina AP, Braga C, et al.

Double blind placebo control trial of large

neutral amino acids in treatment of PKU:

effect on blood phenylalanine. J Inherit

Metab Dis 2007 Apr;30(2):153-158.


G, Grechanina E, Novikov P, McDonald

JD, et al. Large neutral amino acids in the

treatment of phenylketonuria (PKU). J

Inherit Metab Dis 2006 Dec;29(6):732-738.

24 Matalon R, Surendran S, Matalon KM,

Tyring S, Quast M, Jinga W, et al. Future

role of large neutral amino acids in

transport of phenylalanine into the brain.

Pediatrics 2003 Dec;112(6 Pt 2):1570-1574.

25 Moats RA, Moseley KD, Koch R, Nelson

M,Jr. Brain phenylalanine concentrations

in phenylketonuria: research and treatment

of adults. Pediatrics 2003 Dec;112(6 Pt

2):1575-1579.


E, Rating D, Boesch C, et al. Large


transport into brain tissue in patients

with phenylketonuria. J Clin Invest 1999

Apr;103(8):1169-1178.


Rocca A, Joy P, Kemp A, et al. The effects



study. Mol Genet Metab 2007

May;91(1):48-54.


M,Jr, Moats RA. Large neutral amino acid



2003 Jun;79(2):110-113.



melatonin synthesis in phenylketonuria:

a new biomarker. J Pediatr 2013

May;162(5):999-1003.

30 Bachmanov AA, Reed DR, Tordoff MG,

Price RA, Beauchamp GK. Nutrient

preference and diet-induced adiposity in

C57BL/6ByJ and 129P3/J mice. Physiol

Behav 2001 Mar;72(4):603-613.

31 Reeves PG, Nielsen FH, Fahey GC,Jr. AIN-

93 purified diets for laboratory rodents:

final report of the American Institute of

Nutrition ad hoc writing committee on the

reformulation of the AIN-76A rodent diet. J

Nutr 1993 Nov;123(11):1939-1951.

32 van de Merbel NC, Hendriks G, Imbos

R, Tuunainen J, Rouru J, Nikkanen H.

Quantitative determination of free and total

dopamine in human plasma by LC-MS/

MS: the importance of sample preparation.

Bioanalysis 2011 Sep;3(17):1949-1961.


154

Chapter 8

33 Martynyuk AE, van Spronsen FJ, Van

der Zee EA. Animal models of brain

dysfunction in phenylketonuria. Mol Genet

Metab 2010;99 Suppl 1:S100-5.

34 Hargreaves KM, Pardridge WM. Neutral

amino acid transport at the human blood-

brain barrier. J Biol Chem 1988 Dec

25;263(36):19392-19397.

35 Sanjurjo P, Aldamiz L, Georgi G, Jelinek J,

Ruiz JI, Boehm G. Dietary threonine reduces

plasma phenylalanine levels in patients

with hyperphenylalaninemia. J Pediatr

Gastroenterol Nutr 2003 Jan;36(1):23-26.

36 de Rezende MM, D’Almeida V. Central and

systemic responses to methionine-induced

hyperhomocysteinemia in mice. PLoS One

2014 Aug 25;9(8):e105704.

37 Coulombe JT, Kammerer BL, Levy HL,

Hirsch BZ, Scriver CR. Histidinaemia. Part

III: Impact; a prospective study. J Inherit

Metab Dis 1983;6(2):58-61.

38 Roseboom PH, Namboodiri MA, Zimonjic

DB, Popescu NC, Rodriguez IR, Gastel JA,

et al. Natural melatonin ‘knockdown’ in

C57BL/6J mice: rare mechanism truncates

serotonin N-acetyltransferase. Brain Res

Mol Brain Res 1998 Dec 10;63(1):189-197.

39 Christ SE, Huijbregts SC, de Sonneville

LM, White DA. Executive function in

early-treated phenylketonuria: profile and

underlying mechanisms. Mol Genet Metab

2010;99 Suppl 1:S22-32.

40 Surtees R, Blau N. The neurochemistry

of phenylketonuria. Eur J Pediatr 2000

Oct;159 Suppl 2:S109-13.

41 Sara SJ. The locus coeruleus and

noradrenergic modulation of cognition. Nat

Rev Neurosci 2009 Mar;10(3):211-223.

42 Fernstrom JD, Fernstrom MH. Tyrosine,

phenylalanine, and catecholamine synthesis

and function in the brain. J Nutr 2007

Jun;137(6 Suppl 1):1539S-1547S; discussion

1548S.

43 Ikeda M, Levitt M, Udenfriend S.

Phenylalanine as substrate and inhibitor

of tyrosine hydroxylase. Arch Biochem

Biophys 1967 May;120(2):420-427.





Neurosci Lett 2006 Jul 3;401(3):261-265.


8

155

Chapter 8

S1 T

able

. Ave

rage

LN

AA

inta

kes

of t

he d

iffe

rent

exp

erim

enta

l gro

ups

(mg/

g bo

dy w

eigh

t/da

y)

WT

PKU

norm

al

chow

LN

AA

diet

high

-pro

tein

diet

norm

al

chow

LN

AA

diet

high

-pro

tein

diet

Phen

ylal

anin

e0.

92

±0.

090.

88±

0.07

1.81

±0.

151.

15±

0.18

0.97

±0.

122.

19±

0.13

Tyro

sine

0.74

±

0.08

2.91

±0.

241.

80±

0.15

0.92

±0.

143.

20±

0.38

2.17

±0.

13

Val

ine

1.14

±

0.12

3.62

±0.

302.

37±

0.19

1.42

±0.

223.

98±

0.47

2.85

±0.

17

Isol

euci

ne0.

91

±0.

093.

32±

0.28

1.84

±0.

151.

13±

0.18

3.65

±0.

432.

22±

0.13

Leu

cine

1.68

±

0.17

4.06

±0.

343.

44±

0.28

2.09

±0.

324.

46±

0.53

4.14

±0.

25

Met

hion

ine

0.46

±

0.05

2.85

±0.

241.

03±

0.08

0.57

±0.

093.

14±

0.37

1.24

±0.

07

His

tidi

ne0.

49

±0.

052.

75±

0.23

1.01

±0.

080.

61±

0.10

3.03

±0.

361.

22±

0.07

Thr

eoni

ne0.

82

±0.

080.

83±

0.07

1.68

±0.

141.

02±

0.16

0.91

±0.

112.

03±

0.12

LN

AA

inta

ke is

giv

en in

mg/

g bo

dy w

eigh

t/da

y, e

xpre

ssed

as

mea

n ±

SD.

Die

tary

inta

ke is

not

sho

wn

for

Try

ptop

han,

as

this

cou

ld n

ot b

e m

easu

red

in t

he f

ood

pelle

ts.

Num

bers

of

mic

e on

nor

mal

cho

w, L

NA

A s

uppl

emen

ted

diet

, and

hig

h-pr

otei

n di

et w

ere

n=13

, n=1

3, a

nd n

=14

for

WT

mic

e re

spec

tive

ly, w

hile

bei

ng

n=15

, n=1

4, a

nd n

=15

for

PKU

mic

e.

SUPPORTING INFORMATION


156

Chapter 8

S2 T

able

. Pla

sma

non-

LN

AA

am

ino

acid

con

cent

rati

ons

afte

r si

x w

eeks

of

rece

ivin

g di

ffer

ent

diet

s

WT

PKU

Nor

mal

chow

LN

AA

diet

Hig

h-pr

otei

n

diet

Nor

mal

chow

LN

AA

diet

Hig

h-pr

otei

n

diet

Taur

ine

425

±16

951

3±

267

334

±16

129

4±

120 a

348

±72

#25

6±

66#

Asp

arti

c ac

id19

±7

16±

716

±8

17±

816

±9

12±

4

Seri

ne20

3±

46**

144

±36

**#

182

±39

#18

9±

5417

2±

5116

4±

46

Asp

arag

ine

71±

2061

±21

60±

1764

±31

68±

2849

±19

Glu

tam

ate

48±

3041

±39

36±

1831

±16

a32

±19

26±

10

Glu

tam

ine

585

±81

558

±75

539

±10

855

0±

157*

506

±86

422

±70

*

Prol

ine

191

±95

159

±76

232

±89

153

±67

165

±51

169

±72

Gly

cine

249

±30

**13

0±

50**

##22

2±

26##

232

±89

**14

4±

52**

#19

6±

45#

Ala

nine

749

±20

967

2±

259

636

±19

458

7±

142 a

695

±17

8##48

2±

160##

Cit

rulli

ne77

±14

86±

1976

±17

92±

17a*

*88

±15

77±

16*

Orn

ithi

ne67

±19

55±

1576

±30

72±

3369

±26

61±

16

Lysi

ne55

0±

160*

*30

0±

64**

##55

2±

140##

426

±13

0 a32

2±

7238

7±

97

Arg

inin

e11

3±

2987

±17

105

±30

77±

24aa

68±

2081

±19

Plas

ma

conc

entr

atio

ns a

re e

xpre

ssed

in µ

mol

/l (m

ean

± SD

).

Con

cent

rati

ons

in P

KU

mic

e on

nor

mal

cho

w a

re c

ompa

red

to W

T m

ice

on n

orm

al c

how

(a

<0.0

5 an

d aa

<0.0

1).

Wit

hin

the

grou

ps o

f W

T a

nd P

KU

mic

e, c

once

ntra

tion

s th

at d

iffe

r be

twee

n di

etar

y tr

eatm

ent

grou

ps a

re in

dica

ted

(*<0

.05;

**<0

.01;

#<0

.05;

and

##<

0.01

).


8

157

Chapter 8

S2 T

able

. Pla

sma

non-

LN

AA

am

ino

acid

con

cent

rati

ons

afte

r si

x w

eeks

of

rece

ivin

g di

ffer

ent

diet

s

WT

PKU

Nor

mal

chow

LN

AA

diet

Hig

h-pr

otei

n

diet

Nor

mal

chow

LN

AA

diet

Hig

h-pr

otei

n

diet

Taur

ine

425

±16

951

3±

267

334

±16

129

4±

120 a

348

±72

#25

6±

66#

Asp

arti

c ac

id19

±7

16±

716

±8

17±

816

±9

12±

4

Seri

ne20

3±

46**

144

±36

**#

182

±39

#18

9±

5417

2±

5116

4±

46

Asp

arag

ine

71±

2061

±21

60±

1764

±31

68±

2849

±19

Glu

tam

ate

48±

3041

±39

36±

1831

±16

a32

±19

26±

10

Glu

tam

ine

585

±81

558

±75

539

±10

855

0±

157*

506

±86

422

±70

*

Prol

ine

191

±95

159

±76

232

±89

153

±67

165

±51

169

±72

Gly

cine

249

±30

**13

0±

50**

##22

2±

26##

232

±89

**14

4±

52**

#19

6±

45#

Ala

nine

749

±20

967

2±

259

636

±19

458

7±

142 a

695

±17

8##48

2±

160##

Cit

rulli

ne77

±14

86±

1976

±17

92±

17a*

*88

±15

77±

16*

Orn

ithi

ne67

±19

55±

1576

±30

72±

3369

±26

61±

16

Lysi

ne55

0±

160*

*30

0±

64**

##55

2±

140##

426

±13

0 a32

2±

7238

7±

97

Arg

inin

e11

3±

2987

±17

105

±30

77±

24aa

68±

2081

±19

Plas

ma

conc

entr

atio

ns a

re e

xpre

ssed

in µ

mol

/l (m

ean

± SD

).

Con

cent

rati

ons

in P

KU

mic

e on

nor

mal

cho

w a

re c

ompa

red

to W

T m

ice

on n

orm

al c

how

(a

<0.0

5 an

d aa

<0.0

1).

Wit

hin

the

grou

ps o

f W

T a

nd P

KU

mic

e, c

once

ntra

tion

s th

at d

iffe

r be

twee

n di

etar

y tr

eatm

ent

grou

ps a

re in

dica

ted

(*<0

.05;

**<0

.01;

#<0

.05;

and

##<

0.01

).

S3 T

able

. Bra

in n

on-L

NA

A a

min

o ac

id c

once

ntra

tion

s af

ter

six

wee

ks o

f re

ceiv

ing

diff

eren

t di

ets

WT

PKU

Nor

mal

chow

LN

AA

diet

Hig

h-pr

otei

n

diet

Nor

mal

chow

LN

AA

diet

Hig

h-pr

otei

n

diet

Taur

ine

9913

±70

2*10

610

±48

8*##

9839

±53

4##10

324

±10

5411

041

±83

110

933

±68

4

Asp

arti

c ac

id48

33±

402

5036

±45

049

36±

433

4471

±45

9 a45

01±

348

4556

±31

7

Seri

ne10

12±

96**

617

±10

2**##

1012

±93

##11

37±

98aa

**87

2±

174*

*##11

21±

146##

Asp

arag

ine

80±

972

±12

78±

1476

±23

72±

1474

±8

Glu

tam

ate

1033

4±

562

1015

7±

553

1033

6±

439

9624

±63

6 aa96

27±

825

9554

±67

9

Glu

tam

ine

4702

±18

8538

21±

677#

4846

±99

2#42

64±

1862

4405

±12

9336

63±

743

Prol

ine

131

±55

151

±55

131

±65

146

±88

138

±76

144

±70

Gly

cine

1496

±15

2**

1153

±14

3**##

1467

±15

7##18

17±

373 aa

*14

66±

285*

1724

±26

5

Ala

nine

874

±10

884

0±

120

816

±13

076

0±

84aa

745

±12

377

6±

95

GA

BA

3876

±49

039

41±

514

3834

±47

335

84±

514

3596

±50

337

16±

525

Lysi

ne32

8±

37**

282

±28

**##

329

±42

##30

4±

4828

9±

4930

4±

40

Arg

inin

e26

0±

6926

5±

6526

1±

8022

5±

8623

7±

9023

2±

73B

rain

con

cent

rati

ons

are

expr

esse

d in

nm

ol/g

wet

wei

ght

(mea

n ±

SD).

Con

cent

rati

ons

in P

KU

mic

e on

nor

mal

cho

w a

re c

ompa

red

to W

T m

ice

on n

orm

al c

how

(a

<0.0

5 an

d aa

<0.0

1).

Wit

hin

the

grou

ps o

f W

T a

nd P

KU

mic

e, c

once

ntra

tion

s th

at d

iffe

r be

twee

n di

etar

y tr

eatm

ent

grou

ps a

re in

dica

ted

(*<0

.05;

**<0

.01;

#<0

.05;

and

##<

0.01

).


CHAPTER 9Therapeutic brain modulation with targeted Large Neutral Amino Acid supplements in the Pah-enu2

phenylketonuria mouse model

D. van Vliet, V.M. Bruinenberg, P.N. Mazzola, H.J.R. van Faassen, P. de

Blaauw, T. Pascucci, S. Puglisi-Allegra, I.P. Kema, M.R. Heiner-Fokkema,

E.A. van der Zee, F.J. van Spronsen

1University of Groningen, University Medical Center Groningen, Beatrix Children’s

Hospital, Groningen, The Netherlands (DvV, PNM, FJvS). 2University of Groningen,

Groningen Institute for Evolutionary Life Sciences (GELIFES), Department of Molecular

Neurobiology, Groningen, The Netherlands (VMB, PNM, EAvdZ). 3University of

Groningen, University Medical Center Groningen, Department of Laboratory Medicine,

Groningen, The Netherlands (HJRvF, PdB, IPK, MRHF). 4Sapienza University, Fondazione

Santa Lucia, Department of Psychology and Centro “Daniel Bovet”, Rome, Italy (TP,

SPA). 5Fondazione Santa Lucia, IRCCS, Rome, Italy (TP, SPA)

Am J Clin Nutr. 2016 Nov;104(5):1292-1300. Epub 2016 Sep 21.


160

Chapter 9

Sources of support: This research was funded by a research grant from the National PKU

Alliance (USA) and the University Medical Center of Groningen. Experimental diets were

provided by Nutricia Research.

Running head: Towards LNAA treatment for PKU

Keywords: phenylketonuria, inborn error of metabolism, large neutral amino acids

Abbreviations

BBB blood-brain barrier

5-HIAA 5-hydroxyindoleacetic acid

His histidine

Ile isoleucine

LAT1 large neutral amino acid transporter type 1

Leuleucine

LNAA large neutral amino acids

Met methionine

PAH phenylalanine hydroxylase

Phe phenylalanine

PKU phenylketonuria

Thr threonine

Tyr tyrosine

Trp tryptophan

Val valine

VIL valine, isoleucine, and leucine

WT wild-type


9

161

Chapter 9

ABSTRACT

Background:

Phenylketonuria treatment consists mainly of a phenylalanine-restricted diet, which leads

to suboptimal neurocognitive and psychosocial outcomes. Supplementation of large neutral

amino acids (LNAAs) has been suggested as an alternative dietary treatment strategy to

optimize neurocognitive outcome in phenylketonuria and has been shown to influence 3

brain pathobiochemical mechanisms in phenylketonuria, but its optimal composition has

not been established.

Objective:

In order to provide additional pathobiochemical insight and develop optimal LNAA

treatment, several targeted LNAA supplements were investigated with respect to all 3

biochemical disturbances underlying brain dysfunction in phenylketonuria.

Design:

Pah-enu2 (PKU) mice received 1 of 5 different LNAA supplemented diets beginning at

postnatal day 45. Control groups included phenylketonuria mice receiving an isonitrogenic

and isocaloric high-protein diet or AIN-93M diet, and wild-type mice receiving the AIN-

93M diet. After 6 weeks, brain and plasma amino acid profiles and brain monoaminergic

neurotransmitter concentrations were measured.

Results:

Brain Phe concentrations were most effectively reduced by supplementation of LNAAs,

such as Leu and Ile, with a strong affinity for the LNAA transporter type 1. Brain non-

Phe LNAAs could be restored on supplementation, but unbalanced LNAA supplementation

further reduced brain concentrations of those LNAAs that were not (sufficiently) included

in the LNAA supplement. To optimally ameliorate brain monoaminergic neurotransmitter

concentrations, LNAA supplementation should include Tyr and Trp together with

those LNAAs that effectively reduce brain Phe concentrations. The requirement for Tyr

supplementation is higher than it is for Trp, and the relative effect of brain Phe reduction is

higher for serotonin than for dopamine and norepinephrine.

Conclusions:

The study shows that all 3 biochemical disturbances underlying brain dysfunction in

phenylketonuria can be targeted by specific LNAA supplements. The study thus provides

essential information for the development of optimal LNAA supplementation as an

alternative dietary treatment strategy to optimize neurocognitive outcome in patients with

phenylketonuria.


162

Chapter 9

1. INTRODUCTION

Phenylketonuria (PKU; Online Mendelian Inheritance in Man no. 261600) is an inborn

error of phenylalanine (Phe) metabolism, characterized by an impaired conversion of Phe to

tyrosine (Tyr). Left untreated, high blood Phe concentrations correlate with classical PKU

symptoms, including severe neurocognitive dysfunction, seizures, and psychiatric problems.

Based on this correlation, blood Phe reduction by a Phe-restricted diet is the treatment of

choice1.

Although the symptoms of PKU are almost exclusively restricted to brain dysfunction and this

is known to correlate with blood Phe concentrations, with the current blood Phe-lowering

treatment strategies, neurocognitive and psychosocial outcomes remain suboptimal2,3 and

treatment adherence is known to decline with age4. An alternative pathophysiology-based

treatment directly targeting brain biochemistry to improve brain function of patients with

PKU is therefore highly anticipated.

In the pathophysiology of PKU, disturbed amino acid transport across the blood-brain barrier

(BBB) plays a central role, with increased brain Phe influx outcompeting the brain influx

of other large neutral amino acids (LNAAs) that share the same transport system5. Three

main hypotheses have been postulated to explain the mechanism(s) by which disturbed BBB

transport of LNAAs impairs brain function in PKU6. The first hypothesis states that brain

dysfunction is primarily the consequence of neurotoxic high brain Phe concentrations. The

second hypothesis, substantiated by impaired cerebral protein synthesis in PKU7, postulates

that insufficient availability of non-Phe LNAAs to the brain is an additional mechanism. The

third hypothesis presumes that especially impaired cerebral monoaminergic neurotransmitter

synthesis is of specific importance.

Founded on these hypotheses, dietary supplementation of LNAAs has been suggested as a

possible alternative treatment strategy for PKU that could target all the pathophysiological

mechanisms causing brain dysfunction in PKU. Previous studies have investigated various

LNAA supplements in patients with PKU and Black and Tan Brachyury (BTBR) Pah-

enu2 (PKU) mice8-23. In theory, the various LNAA supplements may have served different

biochemical pathways inside the brain, but most studies have focused primarily on the

effects on blood and brain Phe concentrations and showed inconsistent results24.

In a proof-of-principle study, we investigated all of the hypothesized biochemical treatment

objectives, and showed that LNAA supplementation 1) reduced brain Phe concentrations, 2)

attenuated the brain deficiencies of some but not all supplemented LNAAs, and 3) increased

concentrations of brain neurotransmitters in PKU mice25. LNAA supplementation could,

therefore, serve different brain biochemical treatment goals; however, thus far, insufficient


9

163

Chapter 9

understanding of the effects of various LNAA supplements and optimal LNAA composition

hampers clinical application.

Our study attempted to correlate biochemical brain treatment objectives with specific

requirements for the composition of LNAA supplementation by therapeutic modulation of

blood and brain biochemistry with different LNAA supplements in BTBR Pah-enu2 PKU

mice.


2.1 Animals

This study was performed in BTBR Pah-enu2 mice. The Pah-enu2 mouse is a well-

established PKU mouse model that resembles the genetics, biochemistry, and neurobiology

of PKU in humans26. As previously described, one of the important advances of this mouse

model over the human PKU model is that brain concentrations of LNAAs other than Phe

and monoaminergic neurotransmitters can be measured directly25. From heterozygous (+/-)

mating, we obtained wild-type (WT, +/+), heterozygous, and PKU (-/-) mice of both sexes.

After weaning at 4 wk of age, genetic characterization was performed by quantitative

polymerase chain reaction analysis on DNA extracted from ear tissue. Water and RMH-B

food pellets (Arie Block BV) were offered ad libitum. From the start of the experiment,

animals were individually housed and kept at 21±1ºC on a 12-h light-dark cycle (0600-

1800). In total, we used 16 WT mice (8 male, 8 female) and 112 PKU (56 male, 56 female)

mice. All procedures and treatments were carried out in strict accordance with the National

Research Council guidelines. The experimental protocol was approved by the Institutional

Animal Care and Use Committee of the University of Groningen (Permit Number: 6504D).

2.2 Experimental design

At postnatal day 45, animals were included in the experiment, and PKU mice were assigned

to 1 of 7 different dietary treatment groups. Following the order in which the animals

were born, PKU mice were successively assigned to each of the 7 experimental groups.

This procedure was carried out for male and female mice separately and avoided assigning

littermates to the same experimental group as much as possible (Supplemental Figure 1).

During the first week of dietary treatment, body weight and food intake were measured

daily. Afterward, body weight and food intake were determined weekly. Dietary treatment

was continued for 6 wk. At the end of the experiment, animals were killed by combined

heart puncture and decapitation under inhalation anesthetics with isoflurane.

2.3 Experimental diets

The basic diet was AIN-93M27, which was administered in unadjusted form to the PKU

and WT control groups. The compositions of the investigated LNAA-supplemented diets


164

Chapter 9

were principally based on theoretical considerations regarding optimal regimens to achieve

each of the biochemical treatment objectives of LNAA treatment in PKU24. To reduce brain

Phe concentrations, the reported effects of Val, Ile, and Leu13,14 and that especially Leu and

Ile but not valine (Val) have relatively low Michaelis-Menten constant values for transport

across the BBB5,28 made us hypothesize that a Leu+Ile-supplemented diet may be especially

effective. To stimulate cerebral protein synthesis, however, supplementation of all LNAAs

competing with the high Phe concentrations in blood for transport across the BBB may be

required24. Moreover, to explicitly increase brain availability of amino acid precursors for

monoaminergic neurotransmitter synthesis, a Tyr+Trp supplemented diet was suggested as

being more effective. In addition, aside from theoretical considerations, a Thr-supplemented

diet was investigated because Thr supplementation was shown to be beneficial in reducing

plasma Phe concentrations in patients with PKU23.

The experimental LNAA diets were produced by adding LNAAs to the AIN-93M diet at

the expense of cornstarch on a weight-for-weight basis. The added amount of Tyr and Trp

in the Tyr+Trp-supplemented diet was calculated to be 20% and 10%, respectively, of the

amount of protein in the AIN-93M diet (124.12 g/kg diet), which corresponds to ~200 and

100 g/kg body weight in humans, if compared with a mean natural protein intake in humans

of 1 g · kg body weight-1 · d-1. Similarly, the added amount of Leu and Ile in the Leu+Ile-

supplemented diet was calculated to be 20% and 15%, respectively. The added amount of

Thr in the Thr-supplemented diet was calculated to be 5% of the amount of protein in the

AIN-93M diet. The total amount of added LNAAs in both diets containing additional non-

Phe LNAAs –with or without Thr [LNAA(+Thr) and LNAA(-Thr) diets]– was equal to the

amount of protein in the AIN-93M diet (124.12 g/kg diet). The LNAA mixtures included

equal amounts of 17.7 mg/kg [in LNAA(-Thr)] or 15.5 mg/kg diet [in LNAA(+Thr)] of

l-Tyr, l-Trp, l-Val, l-Ile, l-Leu, l-methionine (Met), and l-histidine (His) [and l-Thr in the

LNAA(+Thr) diet only]. The high-protein diet was produced by adding extra casein to the

AIN-93M diet at the expense of cornstarch on a weight-for-weight basis. The added amount

of extra casein was calculated to result in an isonitrogenic and isocaloric control diet for the

diets posing the highest amino acid loads [the LNAA(-Thr) and LNAA(+Thr) diets]. Diets

were prepared by Research Diet Services B.V. Amino acid analyses in the different diets are

presented in Supplemental Table 1.

2.4 Brain collection and biochemical analyses

To obtain brain material for biochemical analyses, whole brains were removed. Brains

were divided into cerebellum, brain stem, and cerebrum, the latter being further divided

into 2 hemispheres. The collected brain samples were individually snap frozen in liquid

nitrogen and stored at -80ºC until further preparation. One-half cerebrum and blood

samples were further processed for the analyses of brain and plasma amino acid and

monoaminergic neurotransmitter concentrations, as described previously25. Monoaminergic


9

165

Chapter 9

neurotransmitters (monoamines) and associated metabolites for which concentrations in

the brains were assessed included dopamine, norepinephrine, and normetanephrine in the

catecholamine pathway, and serotonin and 5-hydroxyindoleacetic acid (5-HIAA) in the

serotonergic pathway.

2.5 Statistical analyses

Statistical analyses have been performed on the data collected on all of the animals except

for one mouse that died prematurely. Statistical analyses were performed with the use of

IBM SPSS Statistics for Windows, Version 22.0. All of the tests were performed 2-sided at a

significance level of α=0.05. Data were expressed as means ± SDs unless otherwise indicated.

Brain and plasma biochemistry was analyzed in 2 steps. If data were not normally distributed

(assessed by Shapiro-Wilk test) or in case of unequal variances (assessed by Levene’s test),

then analyses were performed on log-transformed data. First, each experimental group was

individually compared with PKU mice receiving the AIN-93M diet through use of Student’s

t tests and Bonferroni correction for multiple testing. Second, all of the experimental groups

that were significantly different from PKU mice on AIN-93M diet were compared by 1-factor

ANOVA and Tukey’s post hoc analysis.

The effect of dietary treatment on body weight was analyzed on log-transformed data by

repeated-measures ANOVA and Tukey’s post hoc analysis, with one between-subjects factor

(treatment group, 8 levels), one within-subjects factor (time, 7 levels: 0,1, 2, 3, 4, 5, and 6

wk), and sex as a covariate. Weekly food intake (per gram of body weight) was analyzed by

1-factor ANOVA with Tukey’s post hoc analysis.

To assess which parameters of brain Phe, Tyr, and Trp concentrations correlated with brain

monoaminergic neurotransmitter concentrations in PKU mice, we performed multiple

linear regression analyses using backward selection. These analyses were performed for

brain serotonin, dopamine, and norepinephrine concentrations as dependent variables, with

genotype and brain Phe, Tyr, and Trp concentrations as independent variables.

3. RESULTS

3.1 General health and dietary intake

All of the experimental diets were tolerated well by the mice. Of the 128 mice included in the

experiment, 1 PKU male mouse receiving the Leu+Ile-supplemented diet died unexpectedly

31 d after inclusion. Postmortem macroscopic pathological examination showed no

pathology. A wound in the neck of one PKU male mouse receiving the Thr-supplemented

diet was found during the final week of the experiment caused by excessive grooming. Such

excessive grooming is sometimes observed in mice, especially male BTBR (both WT and


166

Chapter 9

PKU) mice. Body weight curves during 6-wk-long dietary treatment were different for male

and female mice (p<0.001), but they did not significantly differ between treatment groups

(p=0.402) (Supplemental Figure 2).

Weekly food intake (expressed as g food · g body weight-1 · wk-1) decreased after the first

week for all experimental groups, and remained relatively stable in the later treatment weeks

(data not shown). Based on the weekly food intakes and amino acid contents of the different

diets, mean daily intakes of individual LNAAs during the last week of the 6-wk dietary

treatment were calculated for all of the experimental groups and presented in Supplemental

Table 2.

3.2 Plasma LNAAs

Plasma LNAA concentrations in PKU mice receiving the AIN-93M diet and experimental

diets and in WT and PKU control animals are shown in Figure 1. In PKU mice receiving the

AIN-93M diet, plasma Phe concentrations were 490% higher than the concentrations in WT

animals receiving the AIN-93M diet (p<0.001; Figure 1A), whereas plasma concentrations

of non-Phe LNAAs were similar or lower than in WT mice (Figure 1B-I).

When assessing the LNAA-supplemented diets, plasma Phe concentrations in PKU mice

receiving LNAA(+Thr) and LNAA(-Thr) diets were 23% lower than the concentrations

observed in the AIN-93M diet (p<0.01 for both; Figure 1A). On selective supplementation

of Tyr+Trp, Leu+Ile, or Thr, however, plasma Phe concentrations did not significantly

differ from those in the AIN-93M diet, whereas with the high-protein diet, plasma Phe

concentrations were higher than they were with the AIN-93M diet (p<0.001; Figure 1A).

Plasma non-Phe LNAA concentrations were significantly higher in mice receiving diets in

which these particular non-Phe LNAAs had been supplemented than they were in PKU

mice receiving the AIN-93M diet; the exception was plasma Tyr and His concentrations

in LNAA(+Thr), which were not statistically significantly different from concentrations in

PKU mice receiving the AIN-93M diet (p=0.062 and p=0.190, respectively; Figure 1B-I). In

PKU mice receiving the high protein diet, plasma Tyr, Val, Ile, and Leu concentrations were

higher than in PKU mice receiving the AIN-93M diet (p<0.01), but these elevations were

significantly less than those observed in mice receiving the experimental diets (Figure 1B-I).

3.3 Brain LNAAs

Brain concentrations of individual LNAAs in PKU mice receiving the experimental diets and

in WT as well as in PKU control animals are shown in Figure 2. Brain Phe concentrations in

PKU mice receiving the AIN-93M diet were 310% higher than concentrations in WT mice

receiving the AIN-93M diet (p<0.001; Figure 2A). Brain His concentrations in PKU mice

receiving the AIN-93M diet were 49% higher than in WT mice receiving the AIN-93M diet

(p<0.001; Figure 2H). Brain concentrations of all other non-Phe LNAAs were lower in PKU


9

167

Chapter 9

mice receiving the AIN-93M diet, ranging from 66% of concentrations in corresponding

WT mice for Tyr to 85% for Met (Figure 2B-G,I).

Figure 1. Plasma concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine,

F) leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after 6 wk of receiving

different diets. Numbers of mice are n=15 or n=16 for all treatment groups. Untransformed data are

expressed as means ± SEMs. * p<0.05; ** p<0.01; *** p<0.001 (2-sided) compared with PKU mice

receiving the AIN-93M diet unless otherwise indicated. Statistical analyses were performed in 2 steps:

1) each experimental group was individually compared with PKU mice receiving the AIN-93M diet by

using Student’s t tests and Bonferroni correction for multiple testing, and 2) all experimental groups

that were significantly different from PKU mice receiving the AIN-93M diet were compared by 1-factor

ANOVA and Tukey’s post hoc analysis. If data were not normally distributed (assessed by Shapiro-

Wilk test), or showed unequal variances (assessed by Levene’s test), analyses were performed on log-

transformed data. LNAA, large neutral amino acid; PKU, phenylketonuria; WT, wild-type


168

Chapter 9

Brain Phe concentrations on LNAA(-Thr)-, LNAA(+Thr)-, and Leu+Ile-supplemented diets

were comparable, being 25-29% lower than concentrations in PKU mice receiving the AIN-

93M diet (p<0.001; Figure 2A). On selective supplementation of Tyr+Trp or Thr, however,

brain Phe concentrations in PKU mice did not differ (p=1.000 for both), whereas brain

Phe concentrations in the high-protein diet were even higher than they were in PKU mice

receiving the AIN-93M diet (p<0.05).

All brain non-Phe LNAA disturbances could be improved by either one or more of the

experimental diets. As may be observed in Figure 2B-I, almost all non-Phe LNAA

concentrations were higher if being supplemented in the diet while in general being lower

than concentrations in PKU mice receiving the AIN-93M diet if not being supplemented,

specifically for brain Met, His, and Thr concentrations. Compared with PKU mice receiving

the AIN-93M diet, the LNAA(-Thr) diet resulted in higher brain concentrations of all

supplemented non-Phe LNAAs (p<0.05 for Tyr and p<0.001 for others), except for Ile,

Leu, and Met (p=0.093; p=0.236; and p=0.115, respectively). Brain concentrations of Thr,

which was not included in the LNAA(-Thr) diet, were even lower than they were in PKU

mice receiving the AIN-93M diet (p<0.001; Figure 2I). The LNAA(+Thr) diet showed

similar results, but brain non-Phe LNAA concentrations were lower than they were in

the LNAA(-Thr) diet, and in contrast to the LNAA(-Thr) diet, brain Thr concentrations

were higher than they were in PKU mice receiving the AIN-93M diet (p<0.001). Selective

Tyr+Trp supplementation restored brain Tyr and Trp concentrations to WT levels, but

further impaired brain Thr concentrations compared with PKU mice receiving the AIN-

93M diet (p<0.001). Similarly, on selective Leu+Ile supplementation, only brain Ile and Leu

concentrations were higher than in PKU mice receiving the AIN-93M diet (p<0.05 for both).

Besides reducing brain Phe concentrations, Leu+Ile supplementation also resulted in lower

brain Met, His, and Thr –but not Tyr and Trp– concentrations than the concentrations

in PKU mice receiving the AIN-93M diet (p<0.001 for all). Selective Thr supplementation

provided higher brain Thr concentrations than those in PKU mice receiving the AIN-93M

diet (p<0.001) without affecting the brain concentrations of any other LNAAs, including

Phe. The high-protein control diet resulted in even higher brain His concentrations than

those in PKU mice receiving the AIN-93M diet (p<0.05).

3.4 Brain monoaminergic neurotransmitters

Brain monoamine and associated metabolite concentrations in PKU mice receiving

the experimental diets as well as in WT and PKU control animals are shown in Figure

3. In the catecholamine pathway, brain dopamine, norepinephrine, and normetanephrine

concentrations in PKU mice receiving the AIN-93M diet were, respectively, 85% (p<0.01),

61% (p<0.001), and 82% (p<0.05) of the concentrations in WT mice receiving the AIN-

93M diet. Tyr+Trp, LNAA(-Thr), and LNAA(+Thr) diets similarly resulted in higher brain

norepinephrine concentrations than those in PKU mice receiving the AIN-93M diet (p<0.001


9

169

Chapter 9

for all), and partially restored its deficit to 79-85% of the concentrations in WT mice (Figure

3B). Brain normetanephrine concentrations were higher in these 3 LNAA-supplemented

diets than those in PKU mice receiving the AIN-93M diet (p<0.01), and they no longer

differed from WT levels (p=0.360; Figure 3C). For brain dopamine, exclusively the Tyr+Trp

diet resulted in higher concentrations than those in PKU mice receiving the AIN-93M diet

(p<0.05; Figure 3A). Selective Leu+Ile or Thr supplementation as well as the high-protein

diet did not significantly change brain dopamine or norepinephrine concentrations.

Figure 2. Brain concentrations of A) phenylalanine, B) tyrosine, C) tryptophan, D) valine, E) isoleucine,

F) leucine, G) methionine, H) histidine, and I) threonine in WT and PKU mice after 6 wk of receiving

different diets. Numbers of mice are n=15 or n=16 for all treatment groups. Untransformed data are

expressed as means ± SEMs. * p<0.05; ** p<0.01; *** p<0.001 (2-sided) compared with PKU mice

receiving the AIN-93M diet unless otherwise indicated. Statistical analyses were performed in 2 steps:

1) each experimental group was individually compared with PKU mice receiving the AIN-93M diet by

using Student’s t tests and Bonferroni correction for multiple testing, and 2) all experimental groups

that were significantly different from PKU mice receiving the AIN-93M diet were compared by 1-factor

ANOVA and Tukey’s post hoc analysis. If data were not normally distributed (assessed by Shapiro-

Wilk test), or showed unequal variances (assessed by Levene’s test), analyses were performed on log-

transformed data. LNAA, large neutral amino acid; PKU, phenylketonuria; WT, wild-type


170

Chapter 9

In the serotonergic pathway, brain serotonin and 5-HIAA concentrations in PKU mice

receiving the AIN-93M diet were 46% and 27%, respectively, of concentrations in WT mice

receiving the AIN-93M diet (p<0.001 for both; Figure 3D,E). The Tyr+Trp diet resulted in

higher brain serotonin and 5-HIAA concentrations than those in PKU mice receiving the

AIN-93M diet (p<0.001 for both) and partially restored their deficiencies to, respectively,

64% and 46% of the concentrations in WT mice. In mice receiving the LNAA(-Thr) and

LNAA(+Thr) diets, brain serotonin concentrations were further restored to 83%, and brain

5-HIAA concentrations were 71% and 65%, respectively, of WT concentrations (p<0.001

for all). Selective supplementation of Leu+Ile or Thr did not demonstrate a significant effect

on either brain serotonin or 5-HIAA concentrations if compared with PKU mice receiving

the AIN-93M diet (p=0.421 for Thr diet on 5-HIAA, and p=1.000 for other), whereas brain

5-HIAA concentrations were even lower in PKU mice receiving the high-protein diet than

the AIN-93M diet (p<0.001).

Figure 3. Brain concentrations of A) dopamine, B) norepinephrine, C) normetanephrine, D) serotonin,

and E) 5-hydroxyindoleacetic acid (5-HIAA) in WT and PKU mice after 6 wk of receiving different

diets. Numbers of mice are n=15 or n=16 for all treatment groups. Untransformed data are expressed

as means ± SEMs. * p<0.05; ** p<0.01; *** p<0.001 (2-sided) compared with PKU mice receiving

the AIN-93M diet unless otherwise indicated. Statistical analyses were performed in 2 steps: 1) each

experimental group was individually compared with PKU mice receiving the AIN-93M diet by using

Student’s t tests and Bonferroni correction for multiple testing, and 2) all experimental groups that were

significantly different from PKU mice receiving the AIN-93M diet were compared by 1-factor ANOVA

and Tukey’s post hoc analysis. If data were not normally distributed (assessed by Shapiro-Wilk test),

or showed unequal variances (assessed by Levene’s test), analyses were performed on log-transformed

data. LNAA, large neutral amino acid; PKU, phenylketonuria; WT, wild-type


9

171

Chapter 9

3.5 Relation between brain monoaminergic neurotransmitters and brain amino acid

biochemistry

To further investigate the correlation between brain amino acid and monoamine

concentrations and the possible mechanism(s) by which LNAA supplementation in PKU

mice restored brain monoamine concentrations, linear regression analyses were performed.

Assessing the catecholamine pathway, multivariate linear regression analyses showed

that both brain dopamine and norepinephrine concentrations could be predicted by a

combination of brain Phe and Tyr concentrations (R2=0.127, p<0.001 for dopamine;

R2=0.563, p<0.001 for norepinephrine; Figure 4A,B), showing a negative correlation with

brain Phe concentrations and a positive correlation with brain Tyr concentrations. When

considering brain Phe and Tyr concentrations, genotype no longer demonstrated a significant

correlation (p=0.780 for dopamine; p=0.704 for norepinephrine). Moreover, no interaction

was observed between brain Phe and Tyr concentrations (p=0.319 for dopamine; p=0.263

for norepinephrine). In the serotonergic pathway, brain serotonin concentrations could be

predicted by brain Phe and Trp concentrations and genotype (R2=0.753, p<0.001; Figure

4C) without significant interactions between these variables. In this model, brain serotonin

concentrations were negatively correlated with brain Phe levels and positively correlated

with brain Trp concentrations. In addition, when corrected for both brain Phe and Trp

concentrations, brain serotonin concentrations in PKU mice were 0.49 nmol/g wet weight

lower than in WT mice.

Figure 4. Predicted compared with actual brain concentrations of A) dopamine, B) norepinephrine,

and C) serotonin in WT and PKU mice after 6 wk of receiving different diets. Lines of equality x=y are

added for comparative illustration. Numbers of mice are n=16 for WT and n=110 for PKU. To assess

which parameters of brain phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp) concentrations

were correlated with brain monoaminergic neurotransmitter concentrations in PKU mice, multiple

linear regression analyses by use of backward selection were performed. Both brain dopamine and

norepinephrine concentrations could be predicted by a combination of brain Phe (negatively correlated)

and Tyr (positively correlated) concentrations (R2=0.127, p<0.001 for dopamine; R2=0.563, p<0.001

for norepinephrine), with no significant correlation with genotype and no significant interaction

between brain Phe and Tyr. Brain serotonin concentrations could be predicted by brain Phe (negatively

correlated) and Trp (positively correlated) concentrations as well as genotype (0.49 nmol/g wet weight

lower than in WT mice, when corrected for Phe and Trp) (R2=0.753, p<0.001) without significant

interactions between these parameters. PKU, phenylketonuria; WT, wild-type .


172

Chapter 9

4. DISCUSSION

Our study compared different LNAA supplements with respect to all biochemical brain and

blood treatment objectives of LNAA treatment in PKU to provide further pathobiochemical

insight and identify novel therapeutic options. After comparison of the response of (brain)

biochemical impairments in PKU to different LNAA supplements, 5 main results were

identified: 1) plasma Phe reduction could be accomplished by high-dose supplementation

of all LNAAs (either with or without Thr) but not on selective supplementation of Leu+Ile,

Tyr+Trp, or Thr; 2) brain Phe concentrations were similarly reduced on supplementation

of all LNAAs (either with or without Thr) and on selective supplementation of Leu+Ile but

not Tyr+Trp or Thr; 3) brain non-Phe LNAA concentrations could be effectively restored

on supplementation, but were more impaired if they were not included in selective LNAA

supplements; and 4) brain monoaminergic neurotransmitter concentrations improved by

increasing precursor amino acids (Tyr+Trp diet) rather than by selectively reducing brain Phe

(Leu+Ile diet); the combination of both strategies [on LNAA(+Thr) and LNAA(-Thr) diets]

was most effective, especially for the serotonergic pathway.

Thus far, plasma Phe reduction has been the primary target of all of the treatment strategies

in PKU. Although LNAA supplementation in PKU is suggested to improve brain metabolism

primarily through its effect on the transport of Phe and other LNAAs at the BBB, it also

reduces plasma Phe concentrations24. In our study, plasma Phe concentrations in PKU mice

were 23% lower with LNAA supplementation including all LNAAs (either with or without

Thr) than they were in PKU mice receiving the AIN-93M diet. This finding is in accordance

with previous results obtained in PKU mice, showing that LNAA supplementation including

(nearly) all LNAAs could reduce plasma Phe concentrations to 47-67% of untreated

PKU controls21,22,25. Regarding the underlying mechanism, plasma Phe reduction has been

assumed to be the result of supplementation of Thr in particular. In contrast to the effect of

reduced plasma Phe concentrations on Thr supplementation (50 mg · kg-1 · d-1) in patients

with PKU23, we did not observe this effect in mice. In addition, both LNAA(-Thr) and

LNAA(+Thr) diets showed comparable effects on plasma Phe concentrations. The data

presented demonstrate that our previous hypothesis that plasma Phe reduction on LNAA

treatment is the result of increased net protein synthesis rather than competition at the

gut-blood barrier24,25 is unlikely. Body weight was comparable between dietary treatment

groups, and supplementation of Tyr (in the Tyr+Trp diet) –the most limiting plasma LNAA

in PKU– did not affect plasma Phe concentrations. Alternatively, it has been suggested that

plasma Phe reduction on LNAA supplementation is caused by competition of LNAAs with

Phe for transport across the gut-blood barrier11. The Leu+Ile diet, which showed a clear

competitive effect on Phe transport across the BBB, did not result in plasma Phe reduction in

this study. Thus, high-dose supplementation of all LNAAs (either with or without Thr) can


9

173

Chapter 9

effectively reduce plasma Phe concentrations in PKU, but our data do not allow for definite

conclusions regarding the underlying mechanism(s).

A second aim of LNAA supplementation in PKU is to reduce brain Phe concentrations by

increasing the competition with Phe for transport across the BBB. In our study, brain Phe

concentrations were reduced by 24-29% in all experimental diets but not in Tyr+Trp and

Thr. The findings on LNAA(-Thr) and LNAA(+Thr) are in accordance with previous studies

on LNAA supplementation that used similar regimens with equal amounts of all non-

Phe LNAAs except for Thr in PKU mice25 and patients with PKU8. The fact that selective

Leu+Ile supplementation was especially effective in reducing brain Phe concentrations in

PKU mice confirms our hypothesis based on the high affinities of Leu and Ile to the large

neutral amino acid transporter 1 (LAT1) in the rat5. Moreover, this result provides further

biochemical support for the findings on cerebrospinal fluid biochemistry as well as improved

neuropsychological functioning and electroencephalogram activity on Val, Ile, and Leu

supplementation in patient with PKU13,14,29. The fact that brain Phe reduction on Leu+Ile

was not accompanied by reduced Phe concentrations in plasma further supports the notion

that brain Phe reduction on LNAA is at least in part the result of a direct effect at the BBB

level8,25. Thus, our results indicate that supplementation of LNAAs with a strong affinity

to the LAT1 transporter, such as Leu and Ile, is especially effective in reducing brain Phe

concentrations rather than reducing plasma Phe.

A less well considered treatment objective for LNAA supplementation in PKU includes

restoring brain non-Phe LNAA concentrations. The present study confirms our previous data

that supplementation of (nearly) all LNAAs improves brain non-Phe LNAA concentrations25.

On the one hand, inclusion of any specific LNAA in the LNAA-supplemented diet almost

invariably led to increased brain concentrations of that particular LNAA compared with

concentrations in the AIN-93M diet. On the other hand, supplementation (selective) of

LNAAs with a high affinity for the LAT1 transporter further impaired brain concentrations

of unsupplemented LNAAs. Leu+Ile supplementation further reduced brain His and Met

concentrations, and brain Thr concentrations were even lower in LNAA(-Thr) than in PKU

mice receiving the AIN-93M diet. Selective supplementation of LNAAs with a lower affinity

for LAT1, such as Tyr+Trp or Thr, did not impair brain concentrations of unsupplemented

LNAAs. These findings stress the importance of well-balanced LNAA supplements and the

need to evaluate the effects on brain concentrations of all LNAAs, especially if supplements

include LNAAs that are known to have a strong affinity for LAT1.

Finally, LNAA supplementation aims to improve brain monoaminergic neurotransmitter

concentrations in PKU, which are thought to be impaired because of insufficient brain

availability of Tyr and Trp, or because of high brain Phe concentrations inhibiting the activity

of Tyr and Trp hydroxylases24. To our knowledge, our study is the first to directly compare


174

Chapter 9

the effects of 1) increased brain Tyr and Trp availability, 2) reduced brain Phe concentrations,

and 3) the combination of both on brain monoamine concentrations in PKU mice. Effects

were most prominent for brain norepinephrine and serotonin rather than dopamine

concentrations, which is consistent with several studies in PKU mice and measurements in

cerebrospinal fluid of patients with PKU25, 30-32. Selective Tyr+Trp supplementation, including

24.8 and 12.4 mg/kg diets of additional Tyr and Trp, ameliorated both brain norepinephrine

and serotonin concentrations, whereas no such effects were observed for Leu+Ile. Both

LNAA(-Thr)- and LNAA(+Thr)-supplemented diets were even more effective than Tyr+Trp

in improving brain serotonin concentrations, and were similarly effective as Tyr+Trp in

improving brain norepinephrine concentrations. On the one hand, these results imply that

both insufficient brain Tyr and Trp availability and increased brain Phe concentrations

contribute to the brain monoamine impairments in PKU, but on the other hand, again imply

that the relative contribution of both mechanisms is different for the dopaminergic and

serotoninergic pathways25. Clearly, increasing cerebral Leu did decrease cerebral Phe, but

did not increase serotonin, suggesting that a decrease of cerebral Phe was not important

enough or the increase of Leu counteracted this effect. In addition, the requirement for Tyr

supplementation seems higher than it is for Trp supplementation. Taken together, brain

monoamine concentrations could be improved by increasing precursor amino acids rather

than by selectively reducing brain Phe concentrations. The combination of both strategies

through supplementation of all LNAAs was the most effective approach, especially for the

serotonergic pathway.

In conclusion, the present study compared different LNAA supplements with respect to all

brain and blood biochemical treatment objectives of LNAA treatment in PKU to provide

more pathobiochemical insight and identify novel therapeutic options. Our results show

that targeted LNAA supplements can influence specific brain biochemical features in PKU

and thereby suggest a valuable new opportunity to further elucidate the relative importance

of the different brain biochemical disturbances in PKU brain dysfunction. Our results also

provide essential knowledge for the development of the optimal LNAA treatment of patients

with PKU.

ACKNOWLEDGEMENTS

The authors express their gratitude to Mrs. H.A. Kingma, Mrs. E.Z. Jonkers, Mrs. K. Boer,

and Mrs. H. Adema for their analytical support, and to Dr. E.H. Schölvinck for English

editing of the manuscript. Also, we are grateful to Nutricia Research for providing the

experimental diets.

DvV, EAvdZ, and FJvS designed the research; DvV, VMB, and PNM conducted the animal

experiment; DvV, HJRvF, PdB, IPK, and MRHF were responsible for biochemical analyses;


9

175

Chapter 9

TP and SPA provided essential material; DvV analyzed data; DvV, EAvdZ, and FJvS wrote

the paper; DvV had primary responsibility for the final content. All authors read and

approved the final manuscript.

COMPETING INTERESTS

EAvdZ has received advisory board fees from Arla Foods. FJvS has received research grants,

advisory board fees, and speaker’s honoraria from Merck Serono and Nutricia Research, has

received speaker’s honoraria from Vitaflo, and has received advisory board fees from Arla

Foods. All other authors have declared not to have conflicts of interest. All authors have read

the journal’s policy on disclosure of potential conflicts of interest.

This research was funded by a grant from the National PKU Alliance (USA). Experimental

diets were provided by Nutricia Research.


176

Chapter 9

5. REFERENCES

1. Blau N, van Spronsen FJ, Levy HL.

Phenylketonuria. Lancet 2010;376:1417-27.

2. Jahja R, Huijbregts SC, de Sonneville

LM, van der Meere JJ, van Spronsen

FJ. Neurocognitive evidence for

revision of treatment targets and

guidelines for phenylketonuria. J Pediatr

2014;164:895,899.e2.

3. Smith I, Knowles J. Behaviour in early

treated phenylketonuria: a systematic review.

Eur J Pediatr 2000;159 Suppl 2:S89-93.

4. Walter JH, White FJ, Hall SK, MacDonald

A, Rylance G, Boneh A, Francis DE,

Shortland GJ, Schmidt M, Vail A. How

practical are recommendations for dietary

control in phenylketonuria? Lancet

2002;360:55-7.

5. Smith QR. Transport of glutamate and

other amino acids at the blood-brain barrier.

J Nutr 2000;130:1016S-22S.

6. van Spronsen FJ, Hoeksma M, Reijngoud

DJ. Brain dysfunction in phenylketonuria:


cause? J Inherit Metab Dis 2009;32:46-51.

7. Hoeksma M, Reijngoud DJ, Pruim J, de

Valk HW, Paans AM, van Spronsen FJ.

Phenylketonuria: High plasma phenylalanine

decreases cerebral protein synthesis. Mol

Genet Metab 2009;96:177-82.

8. Pietz J, Kreis R, Rupp A, Mayatepek E,

Rating D, Boesch C, Bremer HJ. Large


transport into brain tissue in patients

with phenylketonuria. J Clin Invest

1999;103:1169-78.

9. Schindeler S, Ghosh-Jerath S, Thompson

S, Rocca A, Joy P, Kemp A, Rae C, Green

K, Wilcken B, Christodoulou J. The effects



study. Mol Genet Metab 2007;91:48-54.

10. Koch R, Moseley KD, Yano S, Nelson

M,Jr, Moats RA. Large neutral amino acid



2003;79:110-3.

11. Matalon R, Michals-Matalon K, Bhatia

G, Burlina AB, Burlina AP, Braga C, Fiori

L, Giovannini M, Grechanina E, Novikov

P, et al. Double blind placebo control trial

of large neutral amino acids in treatment

of PKU: effect on blood phenylalanine. J

Inherit Metab Dis 2007;30:153-8.

12. Moats RA, Moseley KD, Koch R, Nelson

M,Jr. Brain phenylalanine concentrations in

phenylketonuria: research and treatment of

adults. Pediatrics 2003;112:1575-9.

13. Berry HK, Brunner RL, Hunt MM, White

PP. Valine, isoleucine, and leucine. A new

treatment for phenylketonuria. Am J Dis

Child 1990;144:539-43.

14. Jordan MK, Brunner RL, Hunt MM,

Berry HK. Preliminary support for the oral

administration of valine, isoleucine and

leucine for phenylketonuria. Dev Med Child

Neurol 1985;27:33-9.

15. Batshaw ML, Valle D, Bessman SP.

Unsuccessful treatment of phenylketonuria

with tyrosine. J Pediatr 1981;99:159-60.

16. Lou H. Large doses of tryptophan and

tyrosine as potential therapeutic alternative

to dietary phenylalanine restriction in

phenylketonuria. Lancet 1985;2:150-1.

17. Lou HC, Lykkelund C, Gerdes AM,

Udesen H, Bruhn P. Increased vigilance

and dopamine synthesis by large doses

of tyrosine or phenylalanine restriction

in phenylketonuria. Acta Paediatr Scand

1987;76:560-5.


9

177

Chapter 9

18. Mazzocco MM, Yannicelli S, Nord AM,

van Doorninck W, Davidson-Mundt

AJ, Greene CL. Cognition and tyrosine

supplementation among school-aged

children with phenylketonuria. Am J Dis

Child 1992;146:1261-4.

19. Pietz J, Landwehr R, Kutscha A, Schmidt

H, de Sonneville L, Trefz FK. Effect of high-

dose tyrosine supplementation on brain

function in adults with phenylketonuria. J

Pediatr 1995;127:936-43.

20. Lines D, Magarey A, Raymond J,

Robertson E. Tyrosine supplementation in

phenylketonuria. J Paediatr Child Health

1997;33:177.

21. Matalon R, Surendran S, Matalon KM,

Tyring S, Quast M, Jinga W, Ezell E, Szucs

S. Future role of large neutral amino acids

in transport of phenylalanine into the brain.

Pediatrics 2003;112:1570-4.

22. Matalon R, Michals-Matalon K, Bhatia


JD, Grady J, Tyring SK, Guttler F. Large

neutral amino acids in the treatment of

phenylketonuria (PKU). J Inherit Metab Dis

2006;29:732-8.

23. Sanjurjo P, Aldamiz L, Georgi G, Jelinek J,

Ruiz JI, Boehm G. Dietary threonine reduces

plasma phenylalanine levels in patients

with hyperphenylalaninemia. J Pediatr

Gastroenterol Nutr 2003;36:23-6.

24. van Spronsen FJ, de Groot MJ, Hoeksma

M, Reijngoud DJ, van Rijn M. Large neutral

amino acids in the treatment of PKU: from

theory to practice. J Inherit Metab Dis

2010;33:671-6.

25. van Vliet D, Bruinenberg VM, Mazzola

PN, van Faassen MH, de Blaauw P, Kema

IP, Heiner-Fokkema MR, van Anholt RD,

van der Zee EA, van Spronsen FJ. Large

Neutral Amino Acid Supplementation

Exerts Its Effect through Three Synergistic

Mechanisms: Proof of Principle in

Phenylketonuria Mice. PLoS One

2015;10:e0143833.

26. Martynyuk AE, van Spronsen FJ, Van

der Zee EA. Animal models of brain

dysfunction in phenylketonuria. Mol Genet

Metab 2010;99 Suppl 1:S100-5.

27. Reeves PG, Nielsen FH, Fahey GC,Jr. AIN-

93 purified diets for laboratory rodents:

final report of the American Institute of

Nutrition ad hoc writing committee on the

reformulation of the AIN-76A rodent diet. J

Nutr 1993;123:1939-51.

28. Hargreaves KM, Pardridge WM. Neutral

amino acid transport at the human blood-

brain barrier. J Biol Chem 1988;263:19392-7.

29. Berry HK, Bofinger MK, Hunt MM,

Phillips PJ, Guilfoile MB. Reduction of

cerebrospinal fluid phenylalanine after oral

administration of valine, isoleucine, and

leucine. Pediatr Res 1982;16:751-5.

30. Harding CO, Winn SR, Gibson KM, Arning

E, Bottiglieri T, Grompe M. Pharmacologic

inhibition of L-tyrosine degradation

ameliorates cerebral dopamine deficiency

in murine phenylketonuria (PKU). J Inherit

Metab Dis 2014;

31. Pascucci T, Giacovazzo G, Andolina D,

Accoto A, Fiori E, Ventura R, Orsini

C, Conversi D, Carducci C, Leuzzi V,

et al. Behavioral and neurochemical

characterization of new mouse model

of hyperphenylalaninemia. PLoS One

2013;8:e84697.

32. Burlina AB, Bonafe L, Ferrari V, Suppiej





Metab Dis 2000;23:313-6.


CHAPTER 10Summary and general conclusion


180

Chapter 10

1. SUMMARY AND INTEGRATION OF RESULTS

The main findings of the experimental chapters of this thesis are: Chapter 2: Distinct

differences are found between the genetic background of the PKU mouse model despite similar

biochemical phenotype. Chapter 3: In contrast to the findings of chapter 2, the PKU females

of both strains show similar behavioral outcome. Chapter 4: Sleep problems are present in

PKU mice and patients. Chapter 6: A specific nutrient combination (SNC) can improve a post-

synaptic marker in specific subregions of the hippocampus. Chapter 7: SNC supplementation

improves the outcome in novel object recognition (NOR) despite high Phe concentrations in

the food. Chapter 8: Equal amounts of non-Phe large neutral amino acids (LNAA’s) (except

for Threonine) can reduce brain Phe concentrations, improve the concentrations of some of

the non-Phe LNAA’s, and improve brain levels of serotonin and norepinephrine. Chapter

9: Tailoring the LNAA composition to reduced Phe, improve brain non-Phe LNAA’s and

neurotransmitter concentration, showed that improvements of these three biochemical aims

were not always accompanied with a reduction of Phe in plasma. Overall, these experimental

chapters emphasize that increased Phe concentrations in plasma, currently the gold standard

in the clinic, is not the sole predictor of the phenotypical outcome of PKU.

Below these results will be discussed in more depth by highlighting the importance to the

PKU research field and integrating these results with findings in current literature. This is

followed by future perspectives taking the studies of this dissertation as a starting point for

future research.

The translational value of the PKU mouse model

The translational value of a model in general implies a benefit for the modeled situation.

However, the true benefit is not always exact. A benefit could be a better understanding

of the disease or developing a new treatment strategy. Yet, in the end, the model is only

beneficial when results can be extrapolated or translated to the modeled condition. One of

the models used in preclinical phenylketonuria (PKU) research, is the PKU mouse model.

PKU mice have a mutation in both copies of the phenylalanine hydroxylase (PAH) gene

(homozygous) causing a functional deficit, comparable to PKU patients. The mutation is bred

in the black and tan, brachyury (BTBR) mouse and the C57Bl/6J (B6) mouse. In chapter 2,

we show distinct differences in the behavioral outcome between these strains, most striking

in learning and memory. These differences cannot be attributed to biochemical differences

in Phe concentrations or neurotransmitter concentrations of norepinephrine and serotonin

while these show a clear PKU phenotype in both genetic backgrounds. In chapter 3, we

illustrate that the phenotypical outcome of PKU mice is not only different between genetic

background but also between males and females. It is demonstrated that B6 female mice

show deficits in learning and memory in contrast to the male counterparts. This suggests that

the consequence of the PAH mutation is influenced by the sex and genetic background of


10

181

Chapter 10

mice. If the preclinical results can be extrapolated to the clinical situation, one would expect

difference in the manifestation of PKU in PKU patients.

Are there individual differences found in the manifestation of PKU in patients?

Even though reports are sparse, some studies describe PKU patients that escaped the severe

cognitive deficits despite high Phe concentrations (Table. 1). Although diagnosis and inclusion

criteria of these atypical PKU patients can differ slightly, Table 1 lists eight families that all

escaped severe cognitive deficits. This suggests a genetic influence. The predicted association

between genotype and atypical phenotype was investigated by Ramus and colleguas1,2.

They showed that PAH activity, based on genotype, could not fully explain the atypical

phenotype as untreated siblings with the same PAH genotype could show remarkable

differences in cognitive outcome2. This was also suggested by the reports described in Table

1, the third and the fourth subgroup. Here, studies where listed that showed differences

in PKU outcome among siblings. Ramus et al. further investigated other modifying genes

influencing phenotypical outcome. However, the examination of polymorphisms in tyrosine

hydroxylase or markers closely linked to the PAH gene yielded no possible candidates. As

the point mutation, and so the predicted PAH activity of the two genetic background, is

the same, the two genetic backgrounds of the PKU mouse model could help facilitate the

research in these modifying genes.

In the PKU mice studies we found that genetic background and sex of the mice could

influence the phenotypical outcome. In PKU research, studies concerning gender differences

are limited3–15. Despite these limited reports, indications of sex differences are reported.

First, in Table 1, 25 atypical female and 17 atypical male PKU are described. This skewed

distribution is in contrast to our findings in B6 PKU mice where females are thought to be

more affected in the cognitive domain than males. However, the larger number of reports

in females could be an artifact of the identification process of atypical PKU patients. The

atypical PKU patients are often identified when their siblings have typical PKU or when

children of atypical PKU patients show mental disabilities, typical PKU or PKU identified

with via newborn screening. Atypical PKU mothers will have a higher change to be

identified via this later route, as even non-PKU children can be affected in utero by the high

concentrations of Phe of the mother (maternal PKU). This differs from atypical PKU fathers,

where healthy children can be born when the child has a healthy mother. Second, in Table 1 a

separation was made between genders of the affected siblings of atypical PKU patients. Eight

reports discussed affected sisters, in the face of four brothers. However, this distribution is

not statistically different (c2(1,N=13)=1.17,p=0.281). The outcome could be influenced by

the selecting parameter, IQ, as other behavioral disturbances could be present in atypical

1All statistical analysis was performed in IBM SPSS Statistics for Windows, Version 22.0 (Armonk, NY:

IBM Corp.)


182

Chapter 10

PKU patients despite normal IQ (Hsia et al. 1970). Finally, indeed, in studies concerning

treated PKU patients, sex differences are observed in the pathophysiology of PKU such

as differences in the occurrence of psychiatric disorders, visual attention, dietary control,

quality of life, and personality10,11,13,15–17. Together, these studies highlight that genetic factors

and sex can influence the outcome of PKU.

1.1.2 Considerations of the PKU mouse model

The PKU mouse model has clear similarities with the modeled situation; 1) PKU mice have

a point mutation in the PAH gene, 2) the mutation causes Phe concentration to rise in blood

and brain, 3) biochemical consequences in amino acids and neurotransmitter concentration

are similar to PKU patients, 4) cognitive deficits are found in BTBR PKU mice, 5) B6 PKU

mice might resemble atypical PKU patients in the cognitive domain, and 6) problems in sleep

are found in PKU mice and patients (Chapter 4). Utilizing the model to its full potential is

not only identifying the strengths, but also considering the limitations. First, the original

PKU mouse model was described in the black and tan, brachyury (BTBR) strain18. This

strain of mice are commonly used in N-nitrosoN-ethylurea (ENU) genetic screens because

of the relative high forward mutation rates after a single dose of the mutagen in these mice

compared to, for example, the B6 mouse18,19. Yet, the BTBR wild-type (WT) mice show

abnormalities in brain morphology and behavior20–25. Therefore, the BTBR PKU mouse

model was crossed back on the B6 background. The question that arises is: Why are both

genetic backgrounds still used in preclinical PKU research as these abnormalities are known

in the BTRB background? Without underestimating the influence of these abnormalities on

the PKU phenotype in BTBR, only BTBR PKU mice consistently mimics the typical PKU

patients in behavioral outcome. Therefore, when behavioral outcome is included in the

outcome parameters, the BTBR background of the PKU mouse model is preferred. Secondly,

there are limitations in the behaviors mice can express and, therefore, model. For instance, in

early-treated PKU patients deficits are still found in working memory, executive functioning

and personality26,27. Although specific behavioral paradigms are designed to investigate

these cognitive functions, they are often dependent on the definition used and measure only

certain components of the behavior. Finally, newborn screening makes it possible to identify

PKU patients’ early-in-life and start Phe-restricted as soon as possible. One could question,

what “type” of PKU patient the PKU mouse model is a model for in the future. When this

is the early-treated PKU patient, practical problems could appear as intervening in the first

21-28 days of the pups is very difficult.

To conclude, the PKU mouse models the PKU patients adequately. If the use of either one

is a conscious decision, the BTBR PKU and the B6 PKU mice have their translational value

for studying PKU.


10

183

Chapter 10

Table 1 Case reports of atypical PKU patients. Reports were included when the gender of the PKU

patients and PKU siblings were stated. First two columns show author and date. The third column

depict the males (M) and females (F) with normal or borderline intelligence (IQ>70). When more than 1

individual is depicted in this column, the patients were siblings. The categorization of the fourth column

is described at the bottom of the table. The dotted line distinguishes between four subgroups. The first

group consist of single cases atypical PKU patients without siblings (with PKU) or siblings are not

reported. The second subgroup, consists of atypical PKU patients related to each other without (more)

siblings or typical PKU siblings. The third subgroup, consist of atypical PKU patients with a typical PKU

brother. The final subgroup, consist of atypical PKU patients with a typical PKU sister.

Authors Date Siblings Other SiblingsAllen 1961 1M A

Coates 1957 1M A

Dyken and Culley (Case 4) 1969 1M A

Frankenburg (Case B) 1968 1F A

Hsia (Yannet) 1957 1M A

Perry 1966 1F A

Fisch 1966 1F A

Leonard 1959 1F B

Partington 1962 1F B

Woolf (Case 1-2) 1961 2F A

Colombo 1971 1M; 1F B

Dyken and Culley (Case 1-3) 1969 2M; 1F B

Frankenburg (Case C) 1968 2M; 1F B

Hsia 1968 2F B

Koch 2000 2M B

Perry 1973 1M;3F B

Zinger 1963 2F B

Blainey 1956 1F C

Kasim 2001 1F C

Perry (Case 1-2) 1970 1M C

Stevenson 1967 2F C

Brugger 1942 1M D

Coffelt 1964 1F D

Hsia 1957 1F D

Hsia (Yannet) 1957 1F D

Jervis 1954 1M D

Knox 1960 1M D

Mabry 1963 1F D

Tapia 1961 1M D

Total 17M;25F

A not certain or not reported

B no siblings (with PKU)

C typical PKU brother

D typical PKU sister


184

Chapter 10

New treatment strategies in PKU

1.2.1 Specific nutrient combination

A specific nutrient combination (SNC) comprised of uridine monophosphate (UMP),

docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), choline, phospholipids, folic

acid, vitamins B12, B6, C, and E, and selenium was investigated for the first time as new

(additional) treatment strategy for PKU. In the first proof-of-concept study, described in

chapter 6, male and female B6 WT and PKU mice were offered a diet supplemented with

SNC for post-natal day (PND) 31 up to PND 115. After this period, a positive effect of

SNC supplementation was found in the post-synaptic marker, postsynaptic density protein

95 (PSD-95), in specific sub-regions of the hippocampus. As this protein is associated with

growth and functioning of dendritic spines28,29, the SNC supplementation is hypothesized to

restore the affected synaptic function in PKU mice. The possible improvement in synaptic

functioning could implicate an improvement in functional outcome. Therefore, in chapter

7, we investigated the behavioral outcome of SNC supplementation in the BTBR WT and

PKU mice (male and female). In this long-term intervention study, we show that SNC

supplementation can improve novel object recognition memory in high Phe and low Phe

conditions. These two studies show that a nutrient combination that specifically targets

consequences of Phe in the brain can improve functional outcome despite the high Phe

concentrations in blood and brain and possibly other PKU-related biochemical disturbances.

This is a novel view on treatment in PKU. Current treatment and research into new

treatment strategies focusses on the biochemical outcome of the treatment, for example

reducing Phe concentrations. Therefore, these two chapters highlight that (new) treatment

strategies, perhaps, do not need to be exclusively confined to the original idea of reducing

Phe concentrations. Identifying the mode of action of the SNC could help pinpoint the

critical (biochemical) parameter(s) or brain networks involved in the functional outcome

of PKU. One treatment that also moves beyond the idea of reducing Phe concentrations, is

LNAA treatment.

1.2.2. LNAA

The concept of treating PKU with LNAA supplementation is not a new approach to PKU30–

38. However, despite this research, the optimal composition of the LNAA treatment is not

yet identified. In addition, the integration of mulptiple biochemical treatment objectives is

lacking (for example (1) reducing brain Phe concentrations, (2) improve protein synthesis

by restoring brain non-Phe LNAA concentrations, and (3) improve monoaminergic

neurotransmitter synthesis by increasing amino acid precursors)38. In chapter 8, LNAA

treatment of equal amounts of the LNAA’s tyrosine, tryptophan, valine, isoleucine, leucine,

methionine, and histidine (based on Pietz et al. 1999) was added to the diet of B6 WT

and PKU mice (both sexes). This study showed that such a regime can reduce brain Phe

concentrations, improve the concentrations of some of the non-Phe LNAA’s, and improve

brain levels of serotonin and norepinephrine. In chapter 9, the composition of the LNAA


10

185

Chapter 10

regime was refined and tailored to the three biochemical aims. This resulted in five specific

LNAA regimes that were offered to B6 PKU (both sexes) mice for six weeks and compared

to a normal diet in WT and PKU mice and a high-protein control diet in PKU mice. The

outcome for the three biochemical aims were: First, brain Phe concentrations could be

reduced by LNAA treatment with or without threonine and with supplementation of solely

leucine and isoleucine. Secondly, non-Phe LNAA concentrations could be restored if they

were added to the supplementation. When they were not added to the regime, they were

more impaired. Finally, monoaminergic neurotransmitter concentrations were improved

when the precursors (tyrosine+ tryptophan) were added and with both LNAA treatments

(with or without threonine). The improvements found for all three biochemical aims was

not always accompanied with reduced Phe concentrations in plasma. Again, these studies

highlight that the blood Phe concentrations alone, as currently used clinically, is not always

indicative of the detrimental effects in the brain. Therefore, it is of importance to evaluate

the consequence for all three biochemical aims, in future LNAA studies but also other PKU

research. Although we recognize that investigating all three biochemical aims in PKU patient

can be challenging. For example, non-invasive methods of measuring neurotransmitter

concentrations repeatedly in the brain are currently not at hand. Finally, for the LNAA

studies, we can conclude that the balance between all components of the LNAA’s is of great

importance.

2. FUTURE PERSPECTIVES

2.1. Future perspective I: the PKU mouse model

2.1.1. Can a physiological challenge influence the BTBR and B6 differently?

In Chapter 2, we show that male B6 mice are able to master the learning and memory

paradigms despite similar biochemical changes in blood and brain. Therefore, we hypothesize

in the discussion of that chapter that the biochemical changes could affect the B6 PKU

differently than BTBR PKU during the neurodevelopment and adult life. In the discussion of

this chapter, we make the assumption that the PKU-related biochemical differences are not

influenced by the physiological challenge of the forced swim test two hours before sacrifice.

However, it is possible that the physiological challenge (e.g. the massive release of stress

hormones) elicits or masks changes of the naïve state that, in the end, could mask possible

differences between the genetic strains. To explore this hypothesis, home-cage controls

(age-matched, sex-matched, and housed under the same conditions) were compared to the

tested BTBR WT, BTBR PKU, B6 WT, and B6 PKU of Chapter 2. Statistical analysis with

multivariate ANOVA (factors; genetic background (BTBR/B6), state (naïve/tested), and

genotype (WT/PKU)), was performed on amino acid concentrations in blood and brain and

neurotransmitter concentrations in brain (Figure 1-3).


186

Chapter 10

Figure 1 Amino acids in plasma of both genetic backgrounds. Except for Phenylalanine (Phe:

F(1,45)=1.038 p=0.315), in interaction effect between genotype was found for all LNAA’s (Tyrosine:

F(1,45)=4.542 p<0.05, Valine: F(1,45)=10.814 p<0.05, Leucine: F(1,45)=10.304 p<0.05, Histidine:

F(1,45)=4.360 p<0.05, Threonine: F(1,45)=11.369 p<0.05, and Isoleucine: F(1,45)=8.861 p<0.05).

Furthermore, an interaction effect of genetic background and genotype was observed for all LNAA’s

(Phe: F(1,45)=29.256 p<0.05, Tyrosine: F(1,45)=12.044 p<0.05,Valine: F(45,1)=10.221 p<0.05,

Leucine: F(1,45)=9.005 p<0.05, Histidine: F(1,45)=8.952 p<0.05, Threonine: F(1,45)=11.657 p<0.05,

Isoleucine: F(1,45)=7.059 p<0.05). WT= wild type, PKU= phenylketonuria, (N)= naïve mice, (T)= tested

mice (Chapter 2).


10

187

Chapter 10

For amino acids in the blood, a significant interaction effect was found between genotype

and state for all LNAA depicted in Figure 1, except for Phe. This indicates that the response

to a physiological challenge is different between WT’s and PKU’s but not between the genetic

backgrounds. Genetic background did interact with genotype for all LNAA depicted in

Figure 1. From the graphs it is evident that the WTs of each genetic background differ from

each other. The results found in blood amino acids could not be directly extrapolated to

brain amino acids (Figure 2). Only, Phe concentrations were affected by an interaction of

genotype and state and background and state. The tested B6 PKU mice showed lower Phe

concentrations than the naïve B6 PKU, a response to the challenge that is not observed in the

WT’s or the BTBR PKU. As in the plasma, genetic background and genotype did interact,

except for tryptophan and threonine. However, in the brain the concentration of these

amino acids were found to differ between the PKU’s of each strain. Overall, BTBR PKU and

B6 PKU seem to respond similar to physiological challenge in amino acid concentrations in

blood and brain. From the graphs, only the response of histidine in the brain stands out. The

BTBR PKU and B6 PKU seem to be affected in opposite direction, however, only a trend was

observed (p=0.058).

For the neurotransmitters, a clear PKU phenotype is found for dopamine, norepinephrine,

serotonin and the turn-over of serotonin (Figure 3A-C) independently of genetic background.

Overall, the genetic backgrounds differed in norepinephrine and the turn-over of serotonin.

Furthermore, only the turn-over of serotonin was affect by the physiological challenge wherein

a trend was observed in a difference between WTs and PKUs. These results suggest that

there are no major differences in neurotransmitter concentrations between BTBR PKU and

B6 PKU. Therefore, these results raise the hypothesis that neurotransmitter concentrations

alone are not likely to explain the difference found in behavioral outcome. Interestingly,

although it is a trend, it seems that PKU individuals of both genetic backgrounds cannot

increase the turn-over of serotonin after a physiological challenge, a response that is also

observed in WT littermates.

Together, this data suggest that the response in amino acids and neurotransmitters to a

physiological challenge is not different for the genetic backgrounds despite clear difference

between WT and PKU.


188

Chapter 10

Figure 2 Amino acids in brain of both genetic backgrounds. Phe concentrations are affected by an

interaction of genotype and state (F(1,45)=4.461, p<0.05) and background and state (F(1,45)=4.694,

p<0.05). Genetic background and genotype interacted, except for Tryptophan and Threonine (Phe:

F(1,45)=7.573 p<0.05, Tyrosine: F(1,45)=5.281 p<0.05, Tryptophan: F(1,45)= 1.242 p= 0.272, Valine:

F(1,45)=8.357 p<0.05, Isoleucine: F(1,45)=5.460 p<0.05, Leucine: F(1,45)=6.349 p<0.05, Methionine;

F(1,45)=6.789 p<0.05, Histidine: F(1,45)=6.863 p<0.05, Threonine: F(1,45)=3.798 p=0.059). A main

effect of the physiological challenge was found for Histidine and Methionine (F(1,45)=4.934 p<0.05,

F(1,45)=4.387, p<0.05, respectively). In Histidine, a trend was observed in the interaction of genotype

and state (F(1,45)=3.831, p=0.058). WT= wild type, PKU= phenylketonuria, (N)= naïve mice, (T)=

tested mice (Chapter 2).

2.1.2. Identifying the difference between BTBR and B6

From Chapter 2 it is clear that genetic factors influence the PKU phenotype. To identify

candidate genes, different genetic screening tools can be used such as RNA-seq. This approach

would allow us to identify candidate genes that are upregulated, for example following a

learning event. Likewise, it would help elucidate gene clusters that are distinctively expressed

by the different genetic strains or sexes. Another possibility is to investigate m-RNA profiles

during neurodevelopment. The previous found similarities in PKU phenotype of both

genetics background in amino acids and neurotransmitters (paragraph 2.1.1) withholds

the hypothesis that the PKU mutation in different genetic backgrounds differently affects

these PKU induced changes, presumably during the neurodevelopment and adult life.


10

189

Chapter 10

Research showed that a seven-day treatment in BTBR PKU pups (post-natal day 14-21) with

5-hydroxytryptophan, a precursor of serotonin, can improve dendritic spine maturation and

performance in a short-term version of the NOR and SOR tests39. Investigating differences

between genetic backgrounds around this time window, could help identifying the processes

protecting the PKU mutant mice with a B6 background.

Figure 3 Neurotransmitters in blood of both genetic backgrounds. (A) PKU phenotype was observed

for dopamine (F(1,45)=5.698 p<0.05), norepinephrine (F(1,45)=111.428 p<0.05), Serotonin

(F(1,45)=136.201 p<0.05) and turn-over of serotonin (5-HIAA/Serotonin F(1,45)=58.272, p<0.05).

Independently of the physiological challenge, differences are found between BTBR and B6 in

norepinephrine (F(1,45)=45.142 p<0.05) and the turn-over of serotonin (F(1,45)=11.251 p<0.05).

The turn-over of serotonin seems to be affected by the physiological challenge (F(1,45) 6.302 p<0.05)

wherein a trend was observed in a difference between WT and PKU’s (F(1,45)=3.166, p=0.083). WT=

wild type, PKU= phenylketonuria, (N)= naïve mice, (T)= tested mice (Chapter 2)

2.2. Future perspective II: Sleep research in PKU

In Chapter 4, we show that PKU patients have more sleep disorders, reduced sleep quality,

increased latency to fall asleep, and experience more sleepiness during the day compared to

first degree relatives. In the PKU mice, we found an increase in fragmentation, more switches

between active and non-active behavior, and a shift in diurnality, shifting a part from their

resting behavior into the active phase. Both experiments strongly support the hypothesis that


190

Chapter 10

sleep is affected in PKU, a starting point for sleep research in PKU. An important new avenue

as sleep problems can negatively affect cognitive functioning, e.g. executive functioning40,41

and mood, e.g. feelings of depression, anxiety and stress42,43. These are disturbances similar

to the described disturbances in early-and continuous treated PKU patients (e.g. in executive

functioning, mood, social cognition, and in internalizing problems such as depression and

anxiety26,27).

2.2.1. Improving the electronic survey.

The proof-of-concept study in chapter 4 examined a small number of PKU patients and

first-degree relatives (FDR) controls. In retrospect, small adjustments could yield more

information in future cohorts. First, the distribution in age was different between PKU

patients and FDR controls. In the study, the recruitment of healthy sibling of PKU patients

was more difficult than expected at forehand. Besides investigating more time in this

recruitment, an age-matched control group from the general population could be included

to examine the differences between PKU patients and a healthy population. Second, the

recruitment of subjects was done via a specific call concerning a sleep questionnaire via

Dutch PKU society on a non-committal basis. This could have resulted in a responder bias

as people of the Dutch PKU society are probably a subclass of PKU patients. Dispersing

the questionnaire via health care professionals could possibly give a better representation

of the PKU community. Third, in the questionnaire one question was added concerning the

treatment of the PKU patients. However, it is not clear how well the patients were controlled.

Including a question about recent Phe concentrations or involving the treating health care

professionals, could possibly associate the Phe concentration or type of treatment with the

sleep disturbances. Finally, the leading treatment for PKU patients is a Phe restricted diet

supplemented with artificial amino acids, vitamins, and minerals. The timing of the artificial

mix could influence the timing of sleep. Evaluation of this timing should be included in the

future survey. Together, these adjustments would give more insights in the relation between

sleep and PKU.

2.2.2. Moving beyond the proof-of-concept study

The proof-of-concept study indicated that the timing of sleep and switching from active

to non-active behavior could be affected in PKU. Corroboration of these findings should

be done in future studies. Timing of sleep is influenced by sleep regulatory processes and

circadian rhythm44. The sleep regulatory processes could be influenced by neurotransmitter

disturbances in PKU. Improving these neurotransmitter concentrations by either Phe-

restriction or LNAA supplementation could identify if this processes are at hand. To

investigate if PKU influences the circadian rhythm, PKU mice could be exposed to continuous

lighting regimes (constant light or dark) to identify disruptions in the internal free-running

rhythm of the animal or phase-shift experiments to identify problems in shifting sleep/wake

patterns. The use of PKU mice could help identify the neurobiological substrates. In PKU


10

191

Chapter 10

patients, core body temperature and dim-light melatonin rhythm could be monitored to

investigate if PKU patients experience a blunted or delayed internal rhythm of physiological

markers. These experiments would give the first indications concerning the underlying

mechanism of sleep problems in PKU.

2.2.3. Possible treatment strategy: Exercise

A possible treatment strategy to improve the altered sleep/wake pattern is exercise. This

treatment strategy is, for instance, investigated in aged individuals where disturbed temporal

regulation of rest/wake cycle, as found in PKU mice, is part of the altered rest/wake pattern.

Voluntary exercise in these mice improved parameters associated with a strengthened rest/

wake pattern45. On the basis of these findings, the hypothesis is that providing a running

wheel to PKU mice would strengthen their rest/wake patterns. Although the study was

not designed to examine the effect of exercise on rest/wake patterns, the study of Mazzola

and colleagues (2015) did offer running wheels to female WT and PKU B6 mice (4 mo)6.

Reanalysis of the data showed reduced fragmentation and a shift in diurnality in PKU mice

(Figure 4A,B one-tailed t-test: fragmentation t(17)=1.951 p<0.05, diurnality t(17)=2.071

p<0.05). The affected rest/wake pattern in these PKU mice suggest that voluntary exercise

does not improve the circadian rhythm. However, as previously pointed out, this study was

not designed to examine rest/wake patterns. The type of running wheel (with bars) could

have affected the outcome as motor deficits could cause the PKU mice to have difficulties to

run for long consecutive periods. A closed running wheel and passive infrared registration

of all activity could reveal other results. Therefore, this data does not allow for definite

conclusions, but is nevertheless in support of the data presented in chapter 4.

Figure 4 Fragmentation and diurnality score of exercising PKU mice. WT mice (n=9) and PKU mice

(n=10) had excess to a running wheel for 53 days. Fragmentation score and diurnality was calculated

over data collected from this period. In both scores, the WT and PKU mice differed from each other

(one-tailed t-test: fragmentation t(17)=1.951 p<0.05, Diurnality t(17)=2.071 p<0.05).


192

Chapter 10

2.3. Future perspective III: New treatment strategies in PKU

2.3.1 SNC and LNAA

In chapter 6 and 7, specific improvements are found after SNC supplementation. However,

a definite mode of action of SNC was not clearly identified in these PKU studies, despite the

clear hypotheses we had (Chapter 5). One hypothesis was synaptic functioning. Although

chapter 6 have indicated improved synaptic functioning in the B6 PKU, the differences in

age, exposure to behavioral paradigms, housing conditions and genetic backgrounds of the

PKU mouse model yield caution when relating the improved synaptic functioning to the

improved functional outcome. To examine a direct effect of SNC on neurons, one could

investigate primary neuronal cell cultures with and without Phe. SNC supplementation under

these conditions could help identify a direct effect of SNC on post-and pre-synaptic markers

or specific changes in neuronal morphology. Another hypothesis was neurotransmitter

metabolism. Neurotransmitters concentrations were measured in the whole brain of the

BTBR mice of chapter 72. From figure 5 of the discussed neurotransmitter are affecting

the functional outcome the PKU mice in the NOR, it is clear that SNC supplementation

did not influence whole brain concentration of neurotransmitters or turnover of serotonin

within these groups under these circumstances. With the caution that regional differences

in the brain may occur, it is unlikely that the neurotransmitter metabolism R. To examine

the mode of action of SNC, future research should, therefore, elaborate on the effect of

SNC on the domains raised in chapter 5 (synaptic functioning, neurotransmitter metabolism

oxidative stress, and white matter integrity). Within these studies, attention must be applied

to regional differences of the brain as the SNC effect found in chapter 6 was very specific.

Furthermore, when restoring neurotransmitter deficits in PKU is one of the biochemical aims

of treatment, combining the strengths of SNC supplementation and LNAA treatment could

be of great interest.

2.3.2. Placing SNC and LNAA on the scale of new treatment strategies in PKU

The search of new treatment strategies for PKU is broad with diverse treatment objectives.

The different treatment strategies could be placed along a figurative scale, on one end

alternatives for amino acids mixture which could improve compliance and metabolic control

and, at the other end, targeting the cause of the disease (Figure 6). The treatments will

be discussed from the left side from this schematic representation to the right side (Figure

6). First, Glycomacropeptide (GMP) is a naturally occurring protein that is lacking Phe.

This protein can be a protein source for PKU patients that could improve compliance and

metabolic control. However, due to the process of getting GMP free from the whey protein,

some Phe will be in the product offered to patients46. Second, SNC, discussed in Chapter 5,

6, and 7, is designed to relieve the effects of high Phe on the brain. Although

2 Neurotransmitter measurements were performed according to the protocols described in chapter 8

and 9


10

193

Chapter 10

Figure 5 The effect of SNC supplementation on neurotransmitter concentrations in PKU mice. The

statistical analysis with a multivariate ANOVA (factors sex and group) showed no interaction effect

between sex and group. Therefore, the graphs include both male and female mice. For dopamine, no

differences were observed between the groups. For norepinephrine, the PKU mice on high Phe (C-HP

and SNC-HP) significantly differed from WTs (WT C-HP and WT SNC-HP) and PKUs on low Phe

diet (C-LP and SNC-LP). These differences were also observed in Serotonin. The turnover of serotonin

(5-HIAA/Serotonin) differed between WT C-HP and both high Phe PKU groups (C-HP p=0.013, SNC-

HP p=0.011) and between WT SNC-HP with all PKU groups (PKU C-HP p<0.001, PKU SNC-HP

p<0.001, PKU C-LP p=0.005, PKU SNC-LP p=0.041). * p<0.05, 5-HIAA= 5-Hydroxyindoleacetic acid

(metabolite of serotonin), n=12, mean±standard error of the mean.


194

Chapter 10

the first positive reports are included in this thesis, at this moment, SNC supplementation

is more likely to be added to the current treatment strategy or LNAA treatment than be

a treatment strategy on its own. Third, LNAA, discussed in Chapter 8 and 9, has been

found to lower Phe concentrations, improve other non-Phe LNAA’s concentrations in

brain and improve neurotransmitter concentrations. However, the optimal composition of

LNAA’s is yet to be determined. Fourth, Phe in high concentrations can self-assemble to

toxic fibrils with an amyloid-like structure47. Inhibiting this self-assemble by antibodies or

small molecules could yield new treatment strategies47–49. Targeting the amyloid structure

is not a novel approach in neuroscience, as this is also done in neurodegenerative diseases,

such Alzheimer’s disease. Fifth, tetrahydrobiopterin (BH4) is the essential in the conversion

of Phe to tyrosine. Depending on the genotype in the PAH gene, some PKU patients benefit

from supplementation of the synthetic form of BH4. Furthermore, a recent study showed

that high doses of BH4 can also be beneficial in PKU conditions normally not responding

to BH4, namely in PKU mice50. Besides the role in Phe metabolism, BH4 is an important

cofactor of tyrosine hydroxylase and tryptophan hydroxylase, key enzymes in the synthesis

of dopamine and serotonin. High doses of BH4 can be beneficial for the turnover of these

neurotransmitters in the brain50. Fifth, Phenylalanine Ammonia Lyase (PAL) is an enzyme

derived from yeast and fungi that can degrade Phe to small amounts of ammonia and to

trans-cinnamic acid, a harmless metabolite. Several clinical trials have been performed with

an injectable form of this enzyme, rAvPAL–PEG51. This treatment is successful in lowering

Phe concentrations, but the multiple injections could cause irritation to the injection side

and immune reactions51. Research had been investing in oral administration of PAL, but, at

this moment, this is not as successful as rAvPAL–PEG52–57. Finally, gene therapy is a form

of treatment in which, for PKU, the PAH gene is carried into body by a stable virus, for

example an adeno associated virus. This virus can be directed towards the liver, however,

the corrected PAH activity is not permanent and reintroduction of the virus is difficult as

immune reaction towards the virus can occur54–56. Another possibility is muscle-directed

gene therapy. Normally, the muscle has no PAH enzyme and the cofactor to convert Phe to

tyrosine. Therefore, successful muscle-directed gene therapy doesn’t solely contain the PAH

gene but also contain the BH4-biosynthetic enzymes GTP cyclohydrolase I (GTPCH) and

6-pyruvoyl-tetrahydropterin synthase (PTPS)61.

To conclude, several new treatment strategies are explored in the PKU research field. When

depicting these along a scale they can be ranked on the target of the treatment. However, to

some extent, the scale can be replaced by non-invasive (left) to invasive (right) or even short-

term solutions (left) to long-term solutions (right). If the development indeed will follow this

last subdivision is not clear. However, when it advances are made on the right hand of the

scale, treatment strategies on the left hand of the scale become less relevant.


10

195

Chapter 10

Figure 6 Schematic representation of PKU treatment strategies. Abbreviations and symbols: GMP=

Glycomacropeptide, SNC= Specific nutrient combination, LNAA= large neutral amino acid, # Phe=

Interfering in the assemble of toxic Phe fibils, BH4=tetrahydrobiopterin, PAL= Phenylalanine ammonia

lyase.

3. FINAL CONCLUSION

Taken all results and consideration together the following implications can be identified.

First, all experimental chapters (except for chapter 4) show that Phe concentrations in

plasma are not always a good predictor of the pathophysiological outcome. Future research

should focus on identifying predictors (e.g. genetic background) and markers that can help

monitor biochemical changes in the brain. Second, chapter 4 recognizes for the first time

sleep problems in PKU. Being aware of sleep problems in PKU, and, in the end, treating sleep

problems in PKU can, hopefully, improve treatment. Finally, this thesis contained studies

that showed new aspects of the disease (PKU strain differences and sleep problems) and a

treatment strategy not investigated before (SNC supplementation). Hopefully, this will be

the basis of follow-up studies in PKU that could, in the end, improve the treatment of PKU

and release the burden of the strict dietary treatment PKU patients have to adhere to.


196

Chapter 10

4. REFERENCES

1 Ramus SJ, Forrest SM, Pitt DB, Saleeba JA,

Cotton RG. Comparison of genotype and

intellectual phenotype in untreated PKU

patients. J Med Genet 1993; 30: 401–5.

2 Ramus SJ, Forrest SM, Pitt DD, Cotton

RGH. Genotype and Intellectual Phenotype

in Untreated Phenylketonuria Patients.

Pediatr Res 1999; 45: 474–481.

3 Mochizuki S, Mizukami H, Ogura T, Kure

S, Ichinohe A, Kojima K et al. Long-term

correction of hyperphenylalaninemia

by AAV-mediated gene transfer leads to

behavioral recovery in phenylketonuria

mice. Gene Ther 2004; 11: 1081–6.





2014; 111: 452–461.

5 Zagreda L, Goodman J, Druin DP,

McDonald D, Diamond A. Cognitive

deficits in a genetic mouse model of the

most common biochemical cause of human

mental retardation. J Neurosci 1999; 19:

6175–82.






doi:10.1007/8904_2015_498.







One 2015; 10: e0143833.







Nutr 2016; 104: 1292–1300.





Metab 2016; 118: 3–8.

10 Fisch RO, Sines LK, Chang P. Personality

characteristics of nonretarded

phenylketonurics and their family members.

J Clin Psychiatry 1981; 42: 106–13.

11 Cazzorla C, Cegolon L, Burlina AP, Celato

A, Massa P, Giordano L et al. Quality

of Life (QoL) assessment in a cohort of

patients with phenylketonuria. BMC Public

Health 2014; 14: 1243.





1997; 99: 345–50.

13 Craft S, Gourovitch ML, Dowton SB,

Swanson JM, Bonforte S. Lateralized

deficits in visual attention in males with

developmental dopamine depletion.

Neuropsychologia 1992; 30: 341–51.







15 Smith I, Beasley MG, Wolff OH, Ades AE.

Behavior disturbance in 8-year-old children

with early treated phenylketonuria. Report

from the MRC/DHSS Phenylketonuria

Register. J Pediatr 1988; 112: 403–8.


10

197

Chapter 10





1997; 99: 345–50.










1205–10.

19 Justice MJ, Carpenter DA, Favor J,

Neuhauser-Klaus A, Hrabé De Angelis M,

Soewarto D et al. Effects of ENU dosage on

mouse strains. Mamm Genome 2000; 11:

484–8.






971: 47–54.






One 2013; 8: e61829.





Res 2008; 1210: 179–88.








587–593.

24 Molenhuis RT, de Visser L, Bruining H,

Kas MJ. Enhancing the value of psychiatric

mouse models; differential expression of

developmental behavioral and cognitive

profiles in four inbred strains of mice. Eur


25 Stephenson DT, O’Neill SM, Narayan

S, Tiwari A, Arnold E, Samaroo HD et

al. Histopathologic characterization of

the BTBR mouse model of autistic-like

behavior reveals selective changes in

neurodevelopmental proteins and adult

hippocampal neurogenesis. Mol Autism

2011; 2: 7.












2007; 92: 63–70.

28 El-Husseini AE, Craven SE, Chetkovich

DM, Firestein BL, Schnell E, Aoki C et al.

Dual palmitoylation of PSD-95 mediates

its vesiculotubular sorting, postsynaptic

targeting, and ion channel clustering. J Cell

Biol 2000; 148: 159–72.


198

Chapter 10

29 Nagura H, Ishikawa Y, Kobayashi K, Takao

K, Tanaka T, Nishikawa K et al. Impaired

synaptic clustering of postsynaptic density

proteins and altered signal transmission

in hippocampal neurons, and disrupted

learning behavior in PDZ1 and PDZ2 ligand

binding-deficient PSD-95 knockin mice. Mol

Brain 2012; 5: 43.


E, Rating D, Boesch C et al. Large


transport into brain tissue in patients with

phenylketonuria. J Clin Invest 1999; 103:

1169–78.


Rocca A, Joy P, Kemp A et al. The effects



study. Mol Genet Metab 2007; 91: 48–54.


M, Moats RA. Large neutral amino acid



2003; 79: 110–3.



melatonin synthesis in phenylketonuria: a

new biomarker. J Pediatr 2013; 162: 999–

1003.

34 Kalkanoğlu HS, Ahring KK, Sertkaya D,

Møller LB, Romstad A, Mikkelsen I et

al. Behavioural effects of phenylalanine-

free amino acid tablet supplementation in

intellectually disabled adults with untreated

phenylketonuria. Acta Paediatr 2005; 94:

1218–22.


G, Burlina AB, Burlina AP, Braga C et al.

Double blind placebo control trial of large

neutral amino acids in treatment of PKU:

Effect on blood phenylalanine. J Inherit

Metab Dis 2007; 30: 153–158.



JD et al. Large neutral amino acids in the

treatment of phenylketonuria (PKU). J


37 Moats RA, Moseley KD, Koch R, Nelson

M. Brain phenylalanine concentrations in

phenylketonuria: research and treatment of

adults. Pediatrics 2003; 112: 1575–9.

38 van Spronsen FJ, de Groot MJ, Hoeksma

M, Reijngoud D-J, van Rijn M. Large

neutral amino acids in the treatment of

PKU: from theory to practice. J Inherit

Metab Dis 2010; 33: 671–676.









40 Banks S, Dinges DF. Behavioral and

physiological consequences of sleep

restriction. J Clin Sleep Med 2007; 3: 519–

28.

41 Couyoumdjian A, Sdoia S, Tempesta D,

Curcio G, Rastellini E, DE Gennaro L et al.

The effects of sleep and sleep deprivation

on task-switching performance. J Sleep Res

2010; 19: 64–70.

42 Short MA, Louca M. Sleep deprivation leads

to mood deficits in healthy adolescents.

Sleep Med 2015; 16: 987–93.

43 Meerlo P, Havekes R, Steiger A. Chronically

restricted or disrupted sleep as a causal

factor in the development of depression.

Curr Top Behav Neurosci 2015; 25: 459–

81.

44 Daan S, Beersma DG, Borbély AA. Timing

of human sleep: recovery process gated by

a circadian pacemaker. Am J Physiol 1984;

246: R161-83.


10

199

Chapter 10

45 Leise TL, Harrington ME, Molyneux PC,

Song I, Queenan H, Zimmerman E et

al. Voluntary exercise can strengthen the

circadian system in aged mice. Age (Dordr)

2013; 35: 2137–52.

46 Ney DM, Gleason ST, van Calcar SC,

MacLeod EL, Nelson KL, Etzel MR et

al. Nutritional management of PKU with

glycomacropeptide from cheese whey. J







701–6.

48 De Luigi A, Mariani A, De Paola M, Re

Depaolini A, Colombo L, Russo L et al.

Doxycycline hinders phenylalanine fibril

assemblies revealing a potential novel

therapeutic approach in phenylketonuria.

Sci Rep 2015; 5: 15902.

49 Banik D, Dutta R, Banerjee P, Kundu S

SN. Inhibition of Fibrillar Assemblies

of l-Phenylalanine by Crown Ethers:

A Potential Approach toward

Phenylketonuria. J Phys Chem B 2016; 120:

7662–70.

50 Winn SR, Scherer T, Thöny B, Harding

CO. High dose sapropterin dihydrochloride

therapy improves monoamine

neurotransmitter turnover in murine

phenylketonuria (PKU). Mol Genet Metab

2016; 117: 5–11.

51 Blau N, Longo N. Alternative therapies

to address the unmet medical needs of

patients with phenylketonuria. Expert Opin

Pharmacother 2015; 16: 791–800.

52 Hoskins JA, Jack G, Wade HE, Peiris RJ,

Wright EC, Starr DJ et al. Enzymatic control

of phenylalanine intake in phenylketonuria.

Lancet (London, England) 1980; 1: 392–4.

53 Sarkissian CN, Gamez A, Wang L,

Charbonneau M, Fitzpatrick P, Lemontt

JF et al. Preclinical evaluation of multiple

species of PEGylated recombinant

phenylalanine ammonia lyase for the

treatment of phenylketonuria. Proc Natl

Acad Sci 2008; 105: 20894–20899.

54 Kang TS, Wang L, Sarkissian CN, Gámez

A, Scriver CR, Stevens RC. Converting an

injectable protein therapeutic into an oral

form: phenylalanine ammonia lyase for


99: 4–9.

55 Babaoğlu Aydaş S, Şirin S, Aslim B.

Biochemical analysis of Centaurea

depressa phenylalanine ammonia lyase

(PAL) for biotechnological applications in

phenylketonuria (PKU). Pharm Biol 2016;

54: 2838–2844.

56 López-Villalobos A, Lücker J, López-Quiróz

AA, Yeung EC, Palma K, Kermode AR.

Preservation of high phenylalanine ammonia

lyase activities in roots of Japanese Striped

corn: a potential oral therapeutic to treat

phenylketonuria. Cryobiology 2014; 68:

436–45.

57 Safos S, Chang TM. Enzyme replacement

therapy in ENU2 phenylketonuric mice

using oral microencapsulated phenylalanine

ammonia-lyase: a preliminary report. Artif

Cells Blood Substit Immobil Biotechnol

1995; 23: 681–92.

58 Rebuffat A, Harding CO, Ding Z, Thöny

B. Comparison of adeno-associated virus

pseudotype 1, 2, and 8 vectors administered

by intramuscular injection in the treatment

of murine phenylketonuria. Hum Gene Ther

2010; 21: 463–77.

59 Strisciuglio P, Concolino D. New Strategies

for the Treatment of Phenylketonuria (PKU).

Metabolites 2014; 4: 1007–1017.


200

Chapter 10

60 Thöny B. Long-term correction of murine

phenylketonuria by viral gene transfer: liver

versus muscle. J Inherit Metab Dis 2010;

33: 677–680.

61 Ding Z, Harding CO, Rebuffat A, Elzaouk

L, Wolff JA, Thöny B. Correction of

Murine PKU Following AAV-mediated

Intramuscular Expression of a Complete

Phenylalanine Hydroxylating System. Mol

Ther 2008; 16: 673–681.


10

201

Chapter 10


APPENDIX INederlandse samenvatting


204

Appendix I

FENYLKETONURIE: STUDIES IN MUIZEN EN MENSEN

Fenylketonurie (PKU) is een erfelijke stofwisselingsziekte in het metabolisme van één van de

essentiële aminozuren, fenylalanine (Phe). Een aangeboren genetische fout veroorzaakt een

dysfunctie in het leverenzym fenylalanine hydroxylase (PAH) dat de omzetting van Phe naar

tyrosine verstoort. Dit resulteert in zeer hoge Phe concentraties in het bloed en het brein.

De stapeling van Phe is desastreus voor de ontwikkeling van het brein en in onbehandelde

patiënten uit zich dit in zwaar verminderde cognitieve capaciteit, bewegingsstoornissen en

epilepsie1. In de jaren ’50 werd het duidelijk dat verminderde Phe inname een mogelijke

behandeling kon zijn voor PKU, een beginsel waar de huidige behandeling nog steeds op

gebaseerd is2. Een verminderde Phe inname wordt bereikt door een eiwitarm dieet, aangevuld

met artificiële aminozuren, vitaminen en mineralen. Vroege introductie en het levenslang

volgen van het dieet doen de ernstige cognitieve problemen voorkomen maar blijken niet

geheel toereikend te zijn. De behandelde PKU-patiënten scoren vaak lager op kwaliteit van

leven en hersenfuncties bijvoorbeeld op het gebied van werkgeheugen, de snelheid waarin

informatie wordt verwerkt en de aanwezigheid van depressie en angststoornissen3–5. Daarom

is de ontwikkeling van nieuwe en/of aanvullende behandelingsmethoden in PKU van groot

belang.

In dit proefschrift wordt er gekeken naar twee nieuwe behandelingsmethoden. De eerste

is een suppletie van een combinatie van specifieke nutrienten (SNC) (Deel 2). De tweede

behandelingsmethode richt zich op het supplementeren van andere grote neutrale aminozuren

(large neutral amino acids (LNAA)) die de instroom van Phe in het brein hinderen (Deel

3). In deze preklinische studies wordt er gebruik gemaakt van het PKU muismodel. Er

zijn twee verschillende genetische achtergronden die worden gebruikt in het preklinische

PKU onderzoek. In het eerste deel van dit proefschrift wordt er enerzijds gekeken of er

verschillen zijn tussen deze twee genetische achtergronden en anderzijds tussen mannen en

vrouwen. Tevens wordt er gekeken naar additionele dysfuncties in zowel de PKU muis als

PKU patiënten. In deze samenvatting wordt per onderdeel de algemene conclusie besproken.

Tenslotte zal er een overkoepelende conclusie inzicht geven in de richting van toekomstig

onderzoek.

Deel I: De karakterisatie en de translationele waarde van het PKU muismodel

In preklinische studies naar PKU wordt vaak gebruik gemaakt van het PKU muismodel. Dit

model draagt een mutatie in het gen voor PAH, zoals beschreven in de PKU patiënt6. Door deze

mutatie is er nagenoeg geen enzymatische activiteit, en stijgt Phe in het bloed en in het brein

van deze muizen. Er worden in PKU onderzoek twee verschillende genetische achtergronden/

muizenlijnen gebruikt. Deze muizenlijnen zijn onstaan door vele generaties nakomelingen

van dezelfde familie te fokken. Hierdoor ontstaat er een muizenlijn waarbij de individuen

genetisch gezien erg op elkaar lijken. Dit wordt gedaan om de variaties tussen dieren te


A

205

Appendix I

verminderen zodat er uiteindelijk minder muizen gebruikt hoeven te worden. De mutatie in

het PAH enzym, die het tot een PKU muis maakt, is gemaakt binnen een specifieke muizenlijn.

De eerste muizenlijn waarin de mutatie is gemaakt was de BTBR (black-and tan, brachyury)

muis. Echter deze muizenlijn wordt niet vaak meer gebruikt in andere onderzoeksgebieden

omdat er afwijkende gedragingen en hersenstructuren gevonden zijn7–10. Daardoor werd door

terugkruisen de mutatie in de bekende B6 (C57Bl/6J) muizenlijn gezet. Beide muizenlijnen

hebben dezelfde puntmutatie in het PAH gen en laten verhoogde concentraties van Phe in

bloed en brein zien. Op dit moment worden beide muizenlijnen van het muizenmodel als

gelijken gezien ondanks het feit dat er uit andere onderzoeksgebieden duidelijke indicaties

zijn dat de genetische achtergrond het fenotypisch gedrag kan beïnvloeden11. Om deze reden

hebben wij in hoofdstuk 2 de volwassen mannen van beide muizenlijnen direct met elkaar

vergeleken. Wij hebben hierbij gekeken hebben naar verschillende gedragstesten en naar

de biochemische gevolgen van de mutatie zoals Phe en neurotransmitter concentraties. In

hoofdstuk 2 hebben we aangetoond dat er duidelijke verschillen zijn in gedrag tussen deze

muislijnen. Het meest opvallende verschil werd gevonden in de leer- en geheugentaken. De

PKU BTBR muis kon de leertaken niet succesvol volbrengen maar de PKU B6 kon dit wel.

Deze verschillen kunnen niet worden toegeschreven aan biochemische verschillen in Phe

concentraties of neurotransmitter concentraties van dopamine, serotonine en norepinefrine.

In hoofdstuk 2 hebben we enkel mannelijke muizen onderzocht omdat preklinisch onderzoek

zich meestal richt op mannen. Het wordt echter in de literatuur steeds duidelijker dat mannen

anders kunnen reageren dan vrouwen12–14. Daarom hebben we in hoofdstuk 3 dezelfde

gedragstesten uitgevoerd met volwassen vrouwelijke muizen van beide muizenlijnen. In deze

studie kwam naar voren dat de uitkomst in de gedragstesten niet alleen afhankelijk was van

de mutatie en de genetische achtergrond, maar ook van het geslacht. Zowel de PKU BTBR

vrouwen als de PKU B6 vrouwen lieten problemen zien in leren en geheugen in tegenstelling

tot de eerder gevonden resultaten in de PKU B6 mannen. Dit doet vermoeden dat de gevolgen

van de PAH mutatie op hersenfuncties anders kunnen zijn in een verschillende genetische

context en tussen mannen en vrouwen.

De gedragstesten gedaan in hoofdstuk 2 en 3 waren gebaseerd op PKU-gerelateerde

verstoringen beschreven in PKU onderzoek. Een verstoring die nooit direct was onderzocht

in PKU zijn slaap-gerelateerde verstoringen, ondanks gerapporteerde problemen in de

signaalmoleculen. In hoofdstuk 4 hebben wij gekeken naar de slaapkarakteristieken van

PKU patiënten en slaap/waak ritmen van PKU muizen (beide muizenlijnen, in mannen en

vrouwen). Wanneer wij PKU patiënten vergelijken met eerstegraads familie (ouders, broers,

zussen) dan zien wij meer slaapstoornissen en verminderde slaapkwaliteit. Tevens duurde

het bij de PKU patiënten langer om in slaap te vallen en waren zij overdag slaperiger. In

de PKU-muizen zagen we dat ze minder goed aaneengesloten actief en niet-actief gedrag


206

Appendix I

konden laten zien en dat ze een deel van hun rustgedrag naar de actieve fase verschoven.

Beide experimenten ondersteunen de hypothese dat slaapgedrag in PKU is veranderd.

Deel II: Het effect van een specifieke nutrienten combinatie in PKU

De huidige behandelingsmethode is vaak moeilijk vol te houden voor PKU patiënten. Dit

kan leiden tot een verminderde naleving van het dieet waardoor Phe concentraties kunnen

stijgen en fluctueren15,16. Een nieuwe behandelingsstratergie zou zich kunnen richten op het

tegengaan van de negatieve effecten van Phe op de hersenen. In het brein zijn verschillende

domeinen beschreven die aangedaan zijn door hoge Phe concentraties, zoals neurotransmitter

metabolisme17, oxidatieve stress18, integriteit van de witte stof19 en het functioneren van

synapsen20. In hoofdstuk 5 wordt er gekeken in de literatuur of er specifieke nutriënten zijn

die deze domeinen positief kunnen beïnvloeden. Uit deze literatuurstudie komt naar voren

dat een combinatie van specifieke voedingsstoffen, zoals eerder beschreven in Alzheimer’s

onderzoek21, wellicht een positief effect zou kunnen hebben in PKU. Deze specifieke

nutriëntencombinatie (SNC) bestaat uit uridine monofosfaat (UMP), docosahexaeenzuur

(DHA), eicosapentaeenzuur (EPA), choline, fosfolipiden, foliumzuur, vitaminen B12,

B6, C en E en selenium. Deze combinatie was oorspronkelijk ontworpen om de synthese

van fosfolipiden, een belangrijk onderdeel van (synaptische) membranen, te verbeteren.

Tevens impliceerde de literatuurstudie ook positieve effecten op de andere drie domeinen.

In hoofdstuk 6 hebben we voor het eerst SNC-supplementatie toegepast bij B6 wildtype

(WT; broers en zussen zonder mutatie) en PKU-muizen. Uit deze studie kwam naar voren

dat drie maanden supplementeren van SNC een positief effect heeft op de post-synaptische

marker PSD-95 (postsynaptic marker-95), in specifieke subregio’s van de hippocampus; een

hersengebied belangrijk in leren en geheugen. Op basis hiervan werd de hypothese gesteld

dat de mogelijke verbetering in het synaptische functioneren in dit gebied zou kunnen zorgen

voor een verbetering in leren en geheugen. Dit hebben we onderzocht in hoofdstuk 7 waarbij

we hebben gekeken of SNC supplementatie een positief effect kan hebben op het gedrag

van BTBR WT en PKU muizen (mannen en vrouwen). In deze langdurige interventiestudie

tonen we aan dat het supplementeren van SNC een positief effect heeft op een bepaald soort

geheugen, onafhankelijk van de Phe concentraties in het voer. Of dit komt door een positief

effect op één van de vier domeinen is niet duidelijk. In deze studie hebben we slechts gekeken

naar het neurotransmitter metabolisme en binnen de PKU muizen zagen we geen effect

van SNC supplementatie op de neurotransmitters serotonine, norepinefrine of dopamine.

Toekomstig onderzoek zou zich moeten richten op het vaststellen van de onderliggende

mechanismen van de effecten van SNC-supplementatie in PKU.

Deel III: Grote neutrale aminozuren supplementatie in PKU

Phe wordt getransporteerd over de bloed-hersenbarrière door middel van een “large

neutral amino acid transporter 1” (LAT1)22. Deze transporter deelt Phe met andere grote

neutrale aminozuren (LNAA’s), waarbij de onderlinge verhoudingen tussen de aminozuren


A

207

Appendix I

van belang zijn. De binding van Phe aan deze transporter is erg hoog waardoor de hoge

concentraties Phe, zoals gezien in PKU, de overdracht van andere LNAA’s hinderen. Dit zorgt

ervoor dat naast de verhoogde Phe concentraties in het brein, verlaagde concentraties van

andere LNAA’s (non-Phe LNAA’s) in het brein gevonden worden23,24. Non-Phe LNAA’s zijn

belangrijk voor eiwitsynthese en twee van deze non-Phe LNAA’s, tyrosine en tryptofaan, zijn

belangrijke voorlopers van neurotransmitters. Het herstellen van de onderlinge verhoudingen

zou ervoor kunnen zorgen dat er verbeteringen optreden op drie verschillende vlakken; 1) er

wordt minder Phe het brein in getransporteerd, 2) non-Phe LNAA concentraties herstellen,

3) neurotransmitter concentraties verbeteren.

In hoofdstuk 8 hebben we eerst alle non-Phe LNAA’s (in gelijke delen, behalve threonine)

gegeven aan B6 WT- en PKU muizen (mannen en vrouwen), zoals eerder beschreven bij Pietz

et al. 1999 in PKU patiënten. We vonden verbeteringen op alle drie verschillende vlakken;

1) Phe concentraties waren verminderd in het brein, 2) de concentratie van sommige

non-Phe LNAA’s waren verbeterd 3) de neurotransmitters, serotonine en norepinefrine,

lieten verbeteringen zien. De resultaten gevonden in hoofdstuk 8 werden gebruikt om

de verhoudingen tussen de LNAA’s te verbeteren. Deze werden getest in hoofdstuk 9. Er

werden verschillende samenstellingen van non-Phe LNAA’s gebruikt. Elk dieet was gericht

op een bepaalde doelstelling, bijvoorbeeld door in het dieet slechts tyrosine en tryptofaan te

supplementeren zodat doel 3 (neurotransmitters concentraties verbeteren) gehaald wordt.

Vijf verschillende diëten voor PKU muizen werden vergeleken met een controle dieet gegeven

aan PKU en WT muizen en een hoog eiwit dieet voor PKU muizen. Per doel leverde dit de

volgende resultaten op: 1) Phe concentraties in het brein konden verlaagd worden door

LNAA behandeling met en zonder threonine en door suppletie van leucine en isoleucine, 2)

een verbetering in de concentratie van de non-Phe LNAA’s werd gevonden als die specifieke

LNAA was gesupplementeerd in het dieet, en 3) neurotransmitter concentraties verbeterde

wanneer het dieet enkel tyrosine en tryptofaan bevatte in beide LNAA diëten (met en zonder

threonine). Deze verbeteringen in het brein waren overigens niet altijd te zien in het bloed

van de muizen.

ALGEMENE CONCLUSIE

In dit proefschrift heb ik van verschillende kanten gekeken naar de PKU problematiek. Door

me niet te beperken tot één gedachte, heb ik op verschillende vlakken kunnen bijdragen aan

de huidige kennis over PKU. In de basis heb ik laten zien dat zowel de twee muizenlijnen

als mannen en vrouwen verschillen van elkaar. En dat toekomstig onderzoek, en de

voortvloeiende conclusies, hier rekening mee moeten houden. Tevens heb ik laten zien dat

er nog steeds onbekende aspecten van de ziekte zijn, zoals slaap-gerelateerde problemen.

Tenslotte heb ik twee nieuwe behandelingsstrategieën bekeken die hopelijk in de toekomst

de behandeling van PKU kunnen verbeteren. Overkoepelend heb ik laten zien dat Phe


208

Appendix I

concentraties in het bloed, de parameter die nu als leidraad wordt gebruikt in PKU patiënten

om de ziekte te monitoren, niet geheel voorspellend is voor de functionele uitkomst van

de ziekte. Voor de toekomst hoop ik dat dit fundamentele onderzoek zal bijdragen aan de

verbetering van de huidige behandelingsmethoden van PKU.


A

209

Appendix I

REFERENTIES



27.







8587(16)30320-5.





2007; 17: 91–101.





Metab; 101: 99–109.










1205–10.






971: 47–54.








587–593.





Res 2008; 1210: 179–88.






One 2013; 8: e61829.





Neuron 2016; 91: 1253–1259.














2015; 29: 1646–52.


210

Appendix I

15 Walter JH. Vitamin B12 deficiency and


104 Suppl: S52-4.





33: 665–70.






Metab Dis 2000; 23: 313–6.




653–62.



Metab 2010; 99 Suppl 1: S3-9.





ddu515.






Dis 2014; 38: 459–79.

22 Kanai Y, Segawa H, Miyamoto K i, Uchino

H, Takeda E, Endou H. Expression cloning

and characterization of a transporter for

large neutral amino acids activated by the

heavy chain of 4F2 antigen (CD98). J Biol

Chem 1998; 273: 23629–32.










Metab 2015; 35: 200–5.


A

211

Appendix I


APPENDIX IIDankwoord


214

Appendix II

Nu ik hier aan het einde van mijn promotieonderzoek sta, overheerst het gevoel dat ik hier

niet alleen sta. Ik zou graag in dit gedeelte van mij proefschrift uitspreken hoe dankbaar ik

jullie ben voor jullie bijdrage aan dit proefschrift, op welke manier dan ook. In dit dankwoord

zou ik graag zoveel mogelijk specifiek mensen bedanken, maar mocht je jezelf hieronder niet

terug vinden dan wil ik je toch graag bedanken, ten eerste, voor het lezen van (dit deel) van

mij proefschrift en, ten tweede, voor jouw aandeel aan dit proefschrift. Oprecht geloof ik dat

alle kleine beetjes het grotere geheel maken.

Ik zou graag beginnen met het bedanken van mijn promotoren prof.dr. Eddy van der Zee en

prof. dr. Francjan van Spronsen.

Beste Eddy, ik mocht mijn eerste onderzoeksstage van mijn master bij jou lopen. Ik genoot

meteen van de vrijheid die ik kreeg en als ik het mij goed herinner heb ik je slechts 3 keer

face-to-face gesproken. Het verbaasde mij dan ook wel een beetje (en misschien jou ook),

dat je meteen positief reageerde toen ik 1,5 jaar later je kamer instapte om te vragen of

ik misschien de PhD positie mocht hebben waar je die ochtend geld voor had gekregen.

Omdat ik eigenlijk niet eens wist waar het geld precies voor was, had ik eerst een introductie

gesprek nodig. Je wist me al snel te enthousiast te krijgen voor PKU én er waren vast ook

wel slaapproblemen. Dit was het begin van een traject waarbij ik altijd het gevoel had dat

je achter me stond. Je liet me altijd vrij om mijn eigen beslissingen te maken, wist me te

remmen wanneer het nodig was en te stimuleren om positief te kijken naar mijn data als ik

de limitaties zag. Ik heb bewondering voor jouw inzicht in mensen en ik kijk met veel plezier

terug aan de gesprekken die we hadden over perfecte (maar onmogelijke) experimenten en

de nu gedeelde hobby: paarden.

Beste Francjan, ik kan me nog goed herrineren hoe ik als “bioloog” opgenomen werd in

de UMCG groep. Het onthaal was ontzettend hartelijk, maar mijn liefde voor het werken

met muizen werd niet volledig begrepen. Hoezo moest ik bijvoorbeeld muizen helpen met

de bevalling? Ondanks dat, heb ik mij door jou altijd thuis gevoeld in de UMCG groep.

De mogelijkheden die ik kreeg om elk jaar naar de PKU congressen te gaan, heeft mij heel

wat van de wereld laten zien. Samen met Eddy, zorgden jullie voor de perfecte balans. Jij

gaf mij meer sturing op zoek naar een gerichte boodschap/conclusie/deadline en stelde je

gerichte vragen over wat de implicaties waren voor de kliniek. Bedankt voor het zijn van het

tegengewicht.

Hoewel de promoters natuurlijk aan de basis stonden van mij Phd zou ik graag ook de

mensen willen bedanken waardoor het werk ook daadwerkelijk mogelijk was. Bedankt,

team van Nutricia: Amos, Mirjam, Maryam, Danielle, Martin en Egbert.

http://prof.dr/


A

215

Appendix II

Tevens wou ik graag mijn leescommissie bedanken voor het lezen van mijn thesis. Thank

you, prof. dr. C.O. Harding, prof. dr. S. Spijker, and prof. dr. G.J. van Dijk.

Vervolgens zou ik graag de mensen willen bedanken die een substantiele bijdrage hebben

geleverd aan mijn PhD maar waarbij dit helaas niet heeft geresulteerd in een hoofdstuk. Dear

Tiziana Pascucci and Elena Fiori, thank you for the BTBR PKU mice and the opportunity to

work with you on your comprehensive study. Dear Gjalt, Christine and Nick, thank you for

given me the feeling that our PKU research could have been in Nature/Science. Despite our

efforts we were not able to succeed with our PKU mice but I still believe a great deal in your

work. I hope that someday your PKU article will turn up in one of those journals.

Het werk beschreven in deze thesis was ook niet mogelijk geweest door alle hulp van

ondersteunende krachten. Beginnend met de ruggengraat van de afdeling, de analisten;

Kunja, Jan, Wanda, Folkert en Roel. Heel erg bedankt voor de vele adviezen en hulp bij tig

kleuringen, perfusies en macro’s voor de microscoop. Ik heb het altijd super gewaardeerd

dat jullie letterlijk elk moment van de dag klaar staan voor mij en alle studenten. En Wanda,

ik moet bekennen dat ik nu nog ergens opgesloten zou zitten als jij mij niet elke keer in

het weekend bevrijdde. Verder, vooral aan het einde van mijn Phd, met de groeiende fok,

was het niet meer te doen om alleen zorg te dragen voor alle PKU dieren. Ik zou graag

alle dierverzorgers; Sinterklaas, Roelie, Martijn, Saskia, Linda, Bo, Wendy, Sjoerd, Brendan

en Diane, bedanken voor jullie ondersteuning en de goede zorg voor de dieren. Tenslotte,

heb ik tijdens mijn PhD veel ondersteuning gehad van HBO/bachelor/master studenten. Els,

Lisette, Minke, Roosmarijn, Wim, Kirsten, Julia, Rafaella, Stefan, Corrine, Mariecke, Anne,

Nienke, Jelmer, Iris, Delan, Cas en Birgit. Super bedankt voor jullie inzet, harde werken en

gezelligheid.

En dan als laatste, zou ik graag de mensen bedanken waardoor het werk zo leuk was om te

doen.

Kees en Robbert jullie waren mijn begeleiders van mijn stages tijdens mijn master project.

Bedankt, voor jullie goede begeleiding van mijn projecten. Door jullie sturing maar ook

vooral het vertrouwen in mijn zelfstandigheid, heb ik een goede basis gekregen voor mijn

Phd. Ik was vereerd om tijdens mijn PhD een collega te worden van jullie en ben erg blij dat

dit uiteindelijk is uitgegroeid tot een vriendschap.

Lieve “UMCG- mensen” (Martijn, Danique, Rianne, Annemieke, Esther, Karen, Priscila,

Wiggert) wat hebben we samen wat mooie tijden beleefd op congres. De tripjes naar

Barcelona, Berlijn, Antwerpen, Rome etc. zullen mij altijd bij blijven. Jullie inzichten in de

PKU-patiënt gaven mij vooral in het begin van mijn PhD context en ik heb daarom veel van

jullie kunnen leren, bedankt.


216

Appendix II

Het was een komen en gaan van PhD-ers tijdens mijn tijd op het Zernicke. En hoewel ik

nu aansluit in de rij van Phd-ers die gaan, heb ik het gevoel dat er vriendschappen zijn

onstaan die blijven. Kees, Martijn, Iris, Erin, Leonie, Kata, Yun, Doortje, Priscila, Els,

Frank, Peter, Marelle, Ewelina, Vincent, mijn mede-Henk’s kanjers; Henriëtte, Paulien,

Jan S., Fiona en Simon bedankt voor jullie gezelligheid. Het wordt een beetje een pick

and match maar bedankt voor de Phd-dinners, stapavonden, sinterklaastaferelen, etentjes,

lunches, kopjes thee, eierballen, hardloop-rondjes om het Zernicke, en albert hein to-

go tripjes. De weekenden, de feestdagen, en de morning-afters zijn absoluut dragelijker

geworden door jullie.

Lieve Daniëlle (Daan) en Jorien (Jo), mijn partners in crime. Wat hebben we veel samen

meegemaakt en wat ben ik ontzettend trots dat jullie mijn vriendinnen zijn. Jullie humor,

enthousiasme, en dommigheid maakt alles gewoon net wat leuker. Ik durf het bijna niet op

zo’n officiële plek vast te leggen, maar “echte liefde onverwoestbaar”.

Lieve Pappa en Mamma, jullie steun is mij ontzettend waardevol geweest. Jullie geven mij

balans. Pappa, wanneer ik een steuntje in mijn rug nodig had om nog even door te gaan,

stond jij daar om me aan te moedigen om dat gas nog even wat harder in te trappen. Mamma,

als het allemaal even teveel werd, kon ik bij jou terecht om te horen dat ik in mijzelf moest

geloven en vooral op mijzelf moest passen. Vooral jullie steun en vertrouwen heeft er voor

gezorgd dat dit boekje heb kunnen afronden. Hoe dankbaar ik ben dat ik deze dag met jullie

beide aan mij zij kan vieren, is niet uit de drukken in woorden. Lieve JP, mijn grote broer,

wat ben ik trots dat ik je kleine zusje mag zijn. Ik kan me nog goed herinneren dat je me

belde tijdens het voeren van de muizen dat jullie (samen met Marloes) in verwachting waren

van jullie dochter, mijn nichtje, Niva. Wat zijn jullie een mooi gezin en wat ben ik trots dat

ik tante ben geworden.

En tot slot, lieve Daan, halverwege in het proces kwam jij om de hoek kijken. Ik was bang

dat mijn onmogelijke uren je misschien op afstand zouden houden maar niets was minder

waar. Ik kan me nog goed herinneren dat je ’s avonds voor het eerst mee bent gegaan naar

mijn werk zodat ik een ziek muisje kon controleren én dat je me hielp met het vieste klusje

bij het offeren van dieren (Els is je denk ik nog steeds dankbaar). Ik wil je graag ontzettend

bedanken voor het feit dat je altijd voor mij klaar staat. Ik kijk ontzettend uit naar de

avonturen die we nog gaan beleven.


A

217

Appendix II


APPENDIX IIICurriculum Vitae


220

Appendix III


A

221

Appendix III

Vibeke Marijn Bruinenberg was born on 19 June 1988 in Groningen, The Netherlands. After

completing her pre-university education (VWO: two profiles Natuur &Techniek, Natuur &

Gezondheid + economics) in 2006, she started her bachelor’s in Life science & Technology.

Within this bachelor, she specialized in behavior and neuroscience. After graduating in 2009,

she got accepted for the research master Behavioral and Cognitive neuroscience. In this

master, she completed two internships, one at the lab of prof. E.A. van der Zee, University

of Groningen (the Netherlands) and the other in the lab of prof. dr. T. Abel, University of

Pennsylvania (United States of America). In the first internship, she investigated the effect

of a passive form of exercise, whole body stimulation, on the circadian rhythm of aging

mice under the supervision of C Mulder. In her second internship, she investigated together

with dr. R. Havekes the molecular mechanisms of hippocampal memory formation and the

consequences of insufficient sleep. In these studies, she worked with adeno associated viruses

to specifically alter mechanism to improve learning and memory after sleep deprivation. In

2011, she graduated the research master with honors. Hereafter, she completed the courses

of the master Science Business and Policy. Before starting her internship, she started to work

as research assistant at the department of molecular neurobiology, University of Groningen,

in 2012. In 2014, this resulted in a Phd candidacy funded by Nutricia research (Utrecht,

the Netherlands) at the Department of Molecular Neurobiology (University of Groningen,

the Netherlands) and Beatrix Children’s Hospital (University Medical Center Groningen,

the Netherlands) under the supervision of prof. dr. E.A. van der Zee and prof. dr. FJ van

Spronsen. The results of her PhD are summarized in this dissertation.


APPENDIX IVPublications


224

Appendix IV

Bruinenberg VM, Gordijn MCM, MacDonald A, van Spronsen FJ, Van der Zee EA. Sleep

Disturbances in Phenylketonuria: An Explorative Study in Men and Mice. Front Neurol.

2017 Apr 26;8:167. doi: 10.3389/fneur.2017.00167. eCollection 2017.

Bruinenberg VM, van der Goot E, van Vliet D, de Groot MJ, Mazzola PN, Heiner-Fokkema

MR, van Faassen M, van Spronsen FJ, van der Zee EA. The Behavioral Consequence of

Phenylketonuria in Mice Depends on the Genetic Background. Front Behav Neurosci. 2016

Dec 20;10:233. doi: 10.3389/fnbeh.2016.00233. eCollection 2016.

van Vliet D, Bruinenberg VM, Mazzola PN, van Faassen MH, de Blaauw P, Pascucci T,

Puglisi-Allegra S, Kema IP, Heiner-Fokkema MR, van der Zee EA, van Spronsen FJ.

Therapeutic brain modulation with targeted large neutral amino acid supplements in the

Pah-enu2 phenylketonuria mouse model. Am J Clin Nutr. 2016 Nov;104(5):1292-1300.

Epub 2016 Sep 21.

Havekes R, Park AJ, Tolentino RE, Bruinenberg VM, Tudor JC, Lee Y, Hansen RT, Guercio

LA, Linton E, Neves-Zaph SR, Meerlo P, Baillie GS, Houslay MD, Abel T. Compartmentalized

PDE4A5 Signaling Impairs Hippocampal Synaptic Plasticity and Long-Term Memory.J

Neurosci. 2016 Aug 24;36(34):8936-46. doi: 10.1523/JNEUROSCI.0248-16.2016.

Havekes R, Park AJ, Tudor JC, Luczak VG, Hansen RT, Ferri SL, Bruinenberg VM,

Poplawski SG, Day JP, Aton SJ, Radwańska K, Meerlo P, Houslay MD, Baillie GS, Abel T.

Sleep deprivation causes memory deficits by negatively impacting neuronal connectivity in

hippocampal area CA1. Elife. 2016 Aug 23;5. pii: e13424. doi: 10.7554/eLife.13424.

Bruinenberg VM, van Vliet D, Attali A, de Wilde MC, Kuhn M, van Spronsen FJ, van

der Zee EA. A Specific Nutrient Combination Attenuates the Reduced Expression of PSD-

95 in the Proximal Dendrites of Hippocampal Cell Body Layers in a Mouse Model of

Phenylketonuria. Nutrients. 2016 Mar 26;8(4):185. doi: 10.3390/nu8040185.

van Vliet D, Bruinenberg VM, Mazzola PN, van Faassen MH, de Blaauw P, Kema IP, Heiner-

Fokkema MR, van Anholt RD, van der Zee EA, van Spronsen FJ. Large Neutral Amino Acid

Supplementation Exerts Its Effect through Three Synergistic Mechanisms: Proof of Principle

in Phenylketonuria Mice. PLoS One. 2015 Dec 1;10(12):e0143833. doi: 10.1371/journal.

pone.0143833. eCollection 2015.

Mazzola PN, Bruinenberg V, Anjema K, van Vliet D, Dutra-Filho CS, van Spronsen FJ, van

der Zee EA. Voluntary Exercise Prevents Oxidative Stress in the Brain of Phenylketonuria

Mice. JIMD Rep. 2016;27:69-77. doi: 10.1007/8904_2015_498. Epub 2015 Oct 7.


A

225

Appendix IV

Havekes R, Bruinenberg VM, Tudor JC, Ferri SL, Baumann A, Meerlo P, Abel T. Transiently

increasing cAMP levels selectively in hippocampal excitatory neurons during sleep deprivation

prevents memory deficits caused by sleep loss. J Neurosci. 2014 Nov 19;34(47):15715-21.

doi: 10.1523/JNEUROSCI.2403-14.2014.

university of groningen phenylketonuria in mice and men ... · phenylketonuria in mice and men...

Documents