using phylogenetic analysis to identify hiv transmission channels among persons newly diagnosed with...
TRANSCRIPT
Using Phylogenetic Analysis to Identify HIV Transmission
Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010
Kwa Sey, PhD, MPHYingbo Ma, MS
Nannie Song, MPH
• Los Angeles County ranks second in nation only to New York City for highest number of living AIDS cases
• Between 1982-2010, cumulative total of 75,114 persons with HIV/AIDS reported in LAC
• Major transmission channels indicated by self-report: – male to male sex (79%)– heterosexual sex (12%)– injection drug use (9%)
*2010 Annual HIV Surveillance Report, January 2011:1-32, HIV Epidemiology Program., LAC-DPH
BACKGROUND
BACKGROUND
• New techniques, such as phylogenetic analysis of HIV sequence data, can provide biological evidence for HIV transmission channels and signal emerging trends
What is Phylogenetic analysis?
• The means of inferring evolutionary relationships through molecular sequencing data. The evolutionary history is usually depicted as a branching, treelike diagram
4
What is Phylogenetic analysis?
• Phylogenetic relationships used to infer epidemiological links among individuals, such as persons infected with HIV
• Phylogenetic analysis used to understand patterns of HIV transmission among young black MSM in Mississippi.
• (CDC, 2011)5
HIV Sequencing/Genotyping
Schematic of HIV-1 particle (in cross-section) Viral genome
Fragment of the pol region
for VARHS genotyping:
1020 nucleotides
ACTCTTTGGCAACGACCCCTTGTCACAATAAAGATAGGGGGGCAACAAAAGGAAGCTCTATTAG…
HIV GENOTYPING RESULT
Guidelines for genotyping
7
• Genotyping now recommended for all newly diagnosed HIV infected individuals, presenting us with increasingly comprehensive HIV sequence data and opportunity to investigate population level HIV transmission patterns
OBJECTIVES
• Objective of this analysis to use phylogenetic analyses to characterize HIV transmission channels in Los Angeles County
• Obtained HIV genomic sequences from VARHS (Variant Atypical and Resistant HIV Surveillance System)
• VARHS – extension of the existing national
population-based HIV/AIDS case surveillance system
– coordinated and funded by CDC• Since 2006, as part of VARHS, the LAC DHSP
HIV Epidemiology has obtained HIV pol region genetic sequences from county residents newly diagnosed with HIV
METHODS
For inclusion in this analysis, cases had to be: • LAC residents• Newly diagnosed with HIV• Reported to eHARS following a confidential
HIV test• Antiretroviral naïve• Have available genomic sequence (pol region)
data from specimen collected within 3 months of diagnosis
• .
METHODS
• Obtained genetic sequencing data for 1,407 (29%) out of 4933 LAC HIV cases diagnosed between 2009 and 2010
• HIV sequence data merged with demographic and risk behavior data from the Enhanced HIV/AIDS Reporting System (eHARS)
METHODS
• Neighbor joining phylogenetic analysis performed on pol sequence spanning protease and reverse transcriptase
• Nucleotide distances calculated using Kimura's two-parameter method in MEGA5, with 1000 bootstrap replications
• Transmission clusters defined as sequences that had: – common node of bootstrap values greater
than 95% and – average genetic distance lower than 0.015
nucleotide substitutions per site
METHODS
Age at HIV diagnosis
51%
26%12% 10%
0%
10%
20%
30%
40%
50%
60%
<30 30-39 40-49 >49
Average age: 33 years.
Identified 16 clusters, representing 49 cases. Each cluster comprised of 3-4 cases. Clusters categorized into 4 cluster types. All subtype B.
MSM Cluster- 56%
MSM/HET Cluster- 6%IDU/HET Cluster- 6%
MSM/IDU Cluster- 6%
“MSM” Transmission Channel
• This cluster of 4 represents the “MSM” Transmission Channel.
MSM,19yrs, White, USA-born
MSM, 21yrs, White, USA-born
MSM, 25yrs, Latino/Hispanic, USA-born
MSM, 20yrs, Black/African American, USA-born
100
99
98
0.005
Characteristics of MSM clusters
Race/Ethnicity No. of clusters (%)
Cluster with the same race 5 (38%)
Cluster with mixed race 8 (62%)
Age at HIV/AIDS diagnosis
Cluster of <= 25 only 1 (8%)
Cluster of mixed age group 5 (38%)
Cluster of > 25 only 7 (54%)
Country origin
Cluster of US-born only 6 (46%)
Cluster of Foreign-born only 0
Cluster of mixed group 7 (54%)
“MSM/IDU” Transmission Channel
• This cluster of 3 represents “MSM/IDU” Transmission Channel.
MSM, 48yrs, White, Unknown origin, K103N
MSM, 41yrs, White, USA-born, K103N
Male IDU, 31yrs,Black/African American, USA-born
99
100
0.005
“IDU/HET Female” Transmission Channel
• This cluster of 3 represents IDU/HET female transmission channel.
Male Child, 2, Latino/Hispanic, USA-born
Female IDU,18, Latino/Hispanic, USA-born
Female HET, 39, Latino/Hispanic, USA-born99
100
0.005
“MSM/HET” Transmission Channel
• This cluster of 3 represents MSM/HET transmission channel.
Female HET,19, Latino/Hispanic, Mexico-born
Female HET , 35, Latino/Hispanic, USA-born
MSM, 56, Latino/Hispanic, Mexico-born
100
99
0.005
• The results provide biological evidence for the major HIV transmission channels that have previously been established by traditional epidemiological data.
• Small sample size limits the inferences that may be made based on this data.
DISCUSSION
• Phylogenetic analysis has potential to serve as additional source of information to validate descriptions of local HIV epidemics inferred from self-reported behavioral data and case studies
CONCLUSIONS
CONTACT INFORMATION
Kwa Sey PhD, MPH 600 S. Commonwealth Ave. Suite 1920
Los Angeles,CA90005
85% Boot strap Value Cutoff: 32 clusters, representing 110 cases, were identified. Each of these clusters comprised of 3-6 cases. The clusters were categorized into 5 cluster types. All were subtype B.
MSM Only Cluster- 75%
MSM/HET Cluster- 6%
IDU/HET Cluster- 3%
MSM/IDU Cluster- 13%
Other/Unknown Cluster- 3%