vibrios is

7/31/2019 Vibrios Is

1/35

Vibrionaceae

Australia and New Zealand Standard Diagnostic Procedure Jan 2009 1 of 35

Identification ofVibrionaceae from Australian aquatic animals

using phenotypic and PCR procedures

J Carson

MJ HigginsTK Wilson

Fish Health Unit

Department of Primary Industries & WaterPO Box 46, Kings Meadows

Launceston, Tasmania [email protected]

N Gudkovs AAHL Australian Fish Disease Laboratory

CSIRO Livestock Industries

Private Mail Bag 24

Geelong

Victoria 3220

TN Bryant Medical Statistics and Computing

University of SouthamptonSouthampton General Hospital

Tremona Rd, Southampton SO16 6YD

Hampshire, United Kingdom

5

SUMMARY

The Vibrionaceae is a large and complex group of marine bacteria that can have asignificant impact on the health of aquatic animals. A range of pathogenicity is seen among

the species but a consistent feature is the opportunistic basis of infection. Nearly all phases

of farm production are affected from larval rearing to competent adult animals. Disease10outbreaks may occur in disparate animal groups including marine mammals, fin fish,crustacea, molluscs and zooxanthellae of coral. Some strains, however, can act as probionts

and have proved effective as a means of controlling disease caused by other species of

Vibrionaceae.

Identification: Routine, high-volume identification is achieved by phenotyping using15standardised tests. To accommodate the large number of taxa and the phenotypic diversity

that exists intra-species, identification is only practicable using computer-assistedprobabilistic methods. The use of molecular tools for identification remains limited but PCR

for several species is useful as a means of rapid screening or confirmatory identification.

Status of Australia and New Zealand: The range ofVibrionaceae associated with aquatic20animals in Australia is relatively small despite the diversity of habitats, geographic range

and climatic variation. Major pathogens encountered are Photobacterium damselae ssp.

damselae, Vibrio anguillarum and Vibrio harveyi. More unusual species isolated are Vibrioscophthalmi (Atlantic salmon), Vibrio penaeicida (southern rock lobster) and

Photobacterium damselae ssp. piscicida (southern blue fin tuna). These species are rarely25encountered and appear to be incidental findings not associated with disease.

30


2/35


3/35

Vibrionaceae


Development of an exhaustive list of Australian host species serves little purpose. More80

importantly, cognisance of the range of host types is central to obtaining an understanding of

the pathogenic versatility of the Vibrionaceae. In nearly every group of marine species,

examples can be found of Vibrionaceae acting as pathogens. Major groups affected are:

marine mammals, teleost fish, crustacea, molluscs, both univalve and bivalve, and plants

represented by the zooxanthellae of coral.1785

Species Enzootic in Australia

Listing Vibrionaceae known to occur in Australia provides a guide to species that have beenfound associated with aquatic animals, Table 1. Not all the species listed were found as

pathogens.

90

Table 1. Vibrionaceae enzootic in Australia

Aliivibrio fischeriPhotobacterium damselae ssp. damselaePhotobacterium damselae ssp. piscicidaPhotobacterium iliopiscarium

Vibrio alginolyticusVibrio anguillarum

Vibrio chagasiiVibrio cholerae non-O1Vibrio cyclitrophicusVibrio diazotrophicusVibrio furnissiiVibrio fluvialisVibrio halioticoli

Vibrio harveyiVibrio ichthyoenteriVibrio lentus

Vibrio mediterraneiVibrio mimicusVibrio mytiliVibrio natriegens

Vibrio navarrensisVibrio nereis

Vibrio parahaemolyticusVibrio pelagiusVibrio penaeicidaVibrio proteolyticusVibrio scophthalmiVibrio splendidus biovar IVibrio tasmaniensis

Vibrio tubiashiiVibrio vulnificus biovar I

Species Exotic to AustraliaSeveral pathogens, as listed in Table 2, have not been detected in association with aquatic

animals and are considered exotic.

5

Table 2. Vibrionaceae exotic to Australia

Species Primary host

Aliivibrio salmonicida salmonidsAliivibrio wodanis salmonids

Moritella viscosa salmonids10Vibrio ordalii salmonids

Vibrio pectenicida scallopsVibrio tapetis clams

Vibrio vulnificus biovar II eels

15

Zoonotic Agents

Some species ofVibrionaceae are the cause of zoonoses18

, Table 3. Infection invariably isthe result of physical trauma arising from puncture wounds or the result of ingesting

uncooked seafood. Life-threatening conditions have been reported occasionally in theimmunocompromised.20


4/35

Vibrionaceae


Table 3. Zoonotic Vibrionaceae25

Photobacterium damselae ssp. damselaeVibrio alginolyticus

Vibrio cholerae non-O1Vibrio cincinnatiensisVibrio fluvialis30

Vibrio furnissiiVibrio harveyi

Vibrio mimicusVibrio parahaemolyticusVibrio vulnificus35

Characteristics of the Vibrionaceae

Sodium chloride is critical for the growth ofVibrionaceae. Many species have an obligate

requirement for sodium ions and growth of nearly all species is stimulated by NaCl, eventhose that have a low requirement for NaCl, such as V cholerae.19 Species of the

Vibrionaceae do not in general have fastidious growth requirements and can be readily40

grown on peptone-based media as long as NaCl requirements are met. Growth ofAliivibrio

salmonicida, A wodanis and M viscosa, is more reliable on media enriched with blood. In

defined media some Vibrionaceae require supplementation with vitamins20, while most

strains, even in complex media, respond well to the addition of low levels of yeast extract.21

As the natural habitat of the Vibrionaceae is the marine environment, better growth is45obtained at a slightly alkaline pH in the range of 7.5-7.8. Many species and strains will form

distinctive curved rods but this characteristic is not diagnostic of the Vibrionaceae. In tissue

smears, rods can appear preternaturally large or pleomorphic but on culture will assume

more typical form and proportions.Uniformly the Vibrionaceae are facultative anaerobes that ferment glucose. All species are50

oxidase positive with the exception ofV metschnikovii, which is oxidase negative. Species

are sensitive to the vibriostat 0/129, a pteridine derivative related to trimethoprim.22

Some

species however, such as V lentus, may appear resistant if inappropriate test media are used

or if strains have acquired resistance to trimethoprim from the drfA1 gene in plasmid class I

integrons.23 Most species of Vibrionaceae will grow at 25C except forA salmonicida,55A wodanis, M marina, M viscosa, Ph iliopiscarium and Ph phosphoreum, which grow at

15C. All zoonotic species will grow at 35-37C.


5/35

Vibrionaceae


Isolation Strategies

For osmoregulators, cultures from internal sites should be made on media enriched with

blood such as Blood Agar Base No. 2 (Oxoid) with 7% defibrinated sheep's blood as a non-60

selective medium, and thiosulphate citrate bile sucrose (TCBS; Oxoid24) agar as a selective

indicator medium forVibrionaceae. TCBS should be used only in conjunction with a non-

selective medium as not all species will grow on TCBS. For external sites on osmoregulators

or any site of an osmoconformer, samples should be plated on either ZoBell's 2216E25

orJohnson's marine agar26 (see Appendix 1) as non-selective media and TCBS as the selective65medium. For salmonids, particularly during periods of low water temperatures, samples

from external sites should be plated on blood agar supplemented with 1.5% NaCl.27 Plates

should be incubated at 25C for 2-3 days or at 15C for up to 7 days for psychrophiles.

Procedure for sampling should follow the ANZSDP guidelines for sample collection fromfinfish.2870

PreservationCultures of Vibrionaceae can be held frozen at -80C or in liquid nitrogen. A

cryopreservative (see Appendix 1) based on peptone and glycerol is suitable.29 Long-term

storage based on freeze-drying is effective but the menstruum must be based on meso-

inositol30 so as to regulate membrane phase transition temperature effects and protein75stabilisation31 during freeze-drying and rehydration. Some species, notably A salmonicida

and M marina have proved refractory to freeze-drying and are best preserved frozen.

Generally, cultures recover well from preservation. ZMA or JMA are suitable recovery

media but for more fastidious species particularly A salmonicida, M marina and M viscosablood agar supplemented with 2% NaCl should be used. A prudent strategy for recovery80

from freeze-drying is to use Vibrio Recovery Medium (Appendix 1), which contains sodiumpyruvate32,33, which has been found useful in repair of damaged cells.

Identification StrategiesPhenotyping: Typically the Vibrionaceae exhibit a wide diversity of phenotype both

between and within species. This heterogeneity in phenotype means that identification using85a small number of tests either with keys or tables is unreliable. A more dependable strategy

is to use a simultaneous polythetic approach34 combined with computer-assisted

probabilistic identification.35

An identification matrix, VibEx7 (Appendix 3), has been developed for species of

Vibrionaceae associated with a diversity of aquatic animals in Australia from both temperate90

and tropical regions8. The matrix can identify 61 species and biovars and a further 25 as yet

un-named protospecies ofVibrionaceae from aquatic animals. The panel of tests consists of

39 biochemical and 5 antibiotic sensitivity tests; details of the tests and formulations are

given in Appendix 2. The biochemical tests are in conventional tube or plate format.

Alternatively, the panel of tests is available commercially in miniaturised format as95MicroSys V36 (DPIW, Launceston, Tasmania).

Probabilistic identification is undertaken using an implementation of Bayes Theorem.35 An

identification is reached if the Willcox probability value P0.99 and the modal likelihood

score 0.001. The Willcox probability is a measure of the most likely identification, while

the modal likelihood is a measure of the goodness-of-fit of the unknown to the nominated100

species.36 Probabilistic identification is undertaken using PIBWin37, an intuitive software

package, available freely from the University of Southampton, UK at:http://www.som.soton.ac.uk/staff/tnb/pib.htm

Molecular: Identification of Vibrionaceae using molecular methods is controversial.

Amplified fragment length polymorphism (AFLP) and multilocus sequence typing38

have105proved important in establishing the taxonomic structure of the Vibrionaceae but theseprocedures are not as yet suitable for routine identification purposes. PCR amplification of


6/35

Vibrionaceae


sequence motifs characteristic of species is a practical means of molecular identification but

the scope of application is limited.39 The most widely described and conserved construct is

the 16S rRNA gene but for the Vibrionaceae40

sequence divergence is only 9% which110

greatly limits the possibilities of identifying motifs that are species unique. Sequences other

than 16S rRNA have been identified, typically virulence factors, but the constancy of these

targets across strains of a species is unknown and their suitability as constructs for

identification purposes is questionable.Recommended PCR primer sets relevant for Vibrionaceae of aquatic animals in Australia115are forPh damselae and V harveyi. Based on the 16S rRNA gene both primer sets are

suitable for species identification. The PCR forPh damselae is in multiplex format41 with

one primer pair specific forPh damselae sensu lato and a second primer pair for the urease

gene ureC that is specific forPh damselae ssp. damselae. Evidence ofPh damselae ssp

piscicida is inferred by the absence of a ureC amplicon. The primer pair forV harveyi42

is120

compromised to some extent by known cross-reaction with some, but not all, strains of V

alginolyticus. For the primers to be truly discriminating, positive PCR reactions must be

verified using at least one of the phenotypic tests listed in Table 4.

Table 4. Differential phenotypic tests forVibrio harveyi andVibrio alginolyticus for confirming a positive PCR125

reaction for 16S rRNA V harveyi primers.

Species PNPG* Aesculin

Putrescine

V alginolyticus 16% 10% 100%

V harveyi bv I 95% 95% 2%

V harveyi bv II 100% 100% 0%130*PNPG: 2-nitrophenyl -D-galactopyranoside;Aesculin hydrolysis;

Utilisation of putrescine

Identification by PCR should be limited to pure cultures and used as a means of confirming135the identity of strains with atypical phenotypes. Performance of the primers has not beenvalidated for the purpose of direct detection in tissues or environmental samples.

A range of primer sets for other constructs in the Vibrionaceae have been described, of

which some have been critically evaluated. Of these, primers for the cth

cytolysin/haemolysin gene of V vulnificus43

and the vah1 haemolysin gene of V140anguillarum44 appear robust. Use of these primers for identification in the absence of other

species defining characteristics is not recommended since the frequency at which the targetsoccur intra-species is not known. The primers may have value however for screening

purposes, particularly for strains where the target is known to occur or for establishing the

presence of virulence factors.145Quality Control

The most important factor determining success in identification is the use of standardised

tests. Tests of different format should not be used unless extensive testing has been

undertaken to verify test equivalence. It is important to recognise and identify sources of

error that, if not well controlled, can result in unreliable identification outcomes.34

Intrinsic150error is associated with some tests and some species that can result in variable test outcomes.

A second form of error arises from procedural deficiencies, particularly interpretation ofweak positive tests. Regular use of quality control organisms (Table 5) is recommended,

together with trend analysis to identify drift in performance. With practice, intra-laboratorytest error of 2% is achievable.8,45,46155

Table 5. Vibrio Quality Control Strains

Vibrio anguillarum ATCC 19264T


7/35

Vibrionaceae


Vibrio fluvialis NCTC 11327T

Vibrio mediterranei CIP 103203T

Vibrio parahaemolyticus ATCC 17802T

160

Vibrio tubiashii NCIMB 1340T

Limitations

The identification matrix VibEx7 reflects the diversity of Vibrionaceae associated withaquatic animals in Australia. It does not however include all the validly published species of165Vibrionaceae as listed in Table 6 and these species will not be identified using the matrix.

Data for new species as they occur can be readily added to the VibEx7 matrix. The ability todifferentiate the new species from those already in the matrix can be assessed using the

IDSC tool in the PIBWin software.

170

Table 6. Species not in the VibEx7 matrix

Species Host Species Host175

Enterovibrio coralii PlantEnterovibrio norvegicus Animal

Moritella abyssi Environment

Moritella japonica EnvironmentMoritella profunda Environment180Moritella yayanosii EnvironmentPhotobacterium aplysiae Animal

Photobacterium frigidiphilum EnvironmentPhotobacterium ganghwense Environment

Photobacterium halotolerans Environment185

Photobacterium indicum EnvironmentPhotobacterium lipolyticum Environment

Photobacterium profundum EnvironmentPhotobacterium rosenbergii Plant

Vibrio aerogenes Environment190Vibrio brasiliensis Animal

Vibrio coralliilyticus Plant

Vibrio crassostreae Animal

Vibrio diabolicus EnvironmentVibrio ezurae Animal195

Vibrio fortis Animal

Vibrio gallicus AnimalVibrio gigantis AnimalVibrio hepatarius AnimalVibrio hispanicus Animal200

Vibrio kanaloae AnimalVibrio neonatus Animal

Vibrio neptunius Animal

Vibrio pacinii EnvironmentVibrio pomeroyi Animal205

Vibrio ponticus AnimalVibrio rotiferianus Animal

Vibrio ruber EnvironmentVibrio superstes Animal

Vibrio xuii Animal210


8/35

Vibrionaceae


References

1. Urakawa H, Rivera ING. Aquatic Environment. In: Thompson FL, Austin B, Swings J, editors. TheBiology of the Vibrios. ASM Press, Washington, DC, 2006:175-189

2. Austin B, Stuckey LF, Robertson PAW, Effendi I, Griffith DRW. A probiotic strain of Vibrio215alginolyticus effective in reducing diseases caused by Aeromonas salmonicida, Vibrio anguillarum and

Vibrio ordalii. J Fish Dis 1995;18:93-96

3. Huys L, Dhert P, Robles Ret al. Search for beneficial bacterial strains for turbot (Scophthalmus maximusL) larviculture.Aquaculture 2001;193:25-37

4. Austin B, Austin DA, Blanch ARet al. A comparison of methods for the typing of fish-pathogenic Vibrio220spp. Syst Appl Microbiol1997;20:89-101

5. Thompson FL, Swings J. Taxonomy of the Vibrios. In: Thompson FL, Austin B, Swings J, editors. The

Biology of the Vibrios. ASM Press, Washington, DC, 2006:29-43

6. Thompson FL, Vandemeulebroecke K, Swings J. Genomic diversity amongst Vibrio isolates fromdifferent sources determined by fluorescent amplified fragment length polymorphism. Syst Appl Microbiol2252001;24:520-538

7. Bryant TN, Lee JV, West PA Colwell RR. Numerical classification of species of Vibrio and relatedgenera.J Appl Bacteriol1986;61:437-467

8. Carson J, Higgins MJ, Wilson T, Gudkovs N, Bryant TN. Vibrios of Aquatic Animals: Development of aNational Standard Diagnostic Technology. Fisheries Research and Development Corporation, Canberra,2302006:1-347

9. Thompson FL, Iida T, Swings J. Biodiversity of Vibrios.Microbiol Mol Biol Rev 2004;68:403-431

10. Vandenberghe J, Thompson FL, Gomez-Gil B, Swings J. Phenotypic diversity amongst Vibrio isolatesfrom marine aquaculture systems.Aquaculture 2003;219:9-20

11. Goudie ED, Gow JA. The taxonomic significance of the growth response to Na+

by strains ofVibrio. Can235J Microbiol1995;41:930-935

12. Baumann P, Baumann L, Bang SS, Woolkalis MJ. Reevaluation of the taxonomy ofVibrio, Beneckea, andPhotobacterium: abolition of the genusBeneckea. Curr Microbiol1980;4:127-132

13. Baumann P, Furniss A, Lee J. Genus I Vibrio Pacini 1854, 411AL

. In: Krieg NR, editor. Bergey's Manualof Systematic Bacteriology, Vol 1. Williams & Wilkins, Baltimore, 1984:518-538240

14. Allam B, Paillard C, Ford SE. Pathogenicity ofVibrio tapetis, the etiological agent of brown ring diseasein clams.Dis Aquat Organ 2002;48:221-231

15. Liu P-C, Lee K-K. Cysteine protease is a major exotoxin of pathogenic luminous Vibrio harveyi in thetiger prawn,Penaeus monodon. Lett Appl Microbiol1999;28:428-430

16. Zhang X-H, Austin B. Pathogenicity ofVibrio harveyi to salmonids.J Fish Dis 2000;23:93-102245

17. Ben-Haim Y, Zicherman-Keren M, Rosenberg E. Temperature-regulated bleaching and lysis of the coralPocillopora damicornis by the novel pathogen Vibrio coralliilyticus. Appl Environ Microbiol

2003;69:4236-4242

18. Daniels NA, Shafaie AS. A review of pathogenic Vibrio infections for clinicians.Infect Med2000;17:665-685250

19. Singleton FL, Attwell R, Jangi S, Colwell RR. Effects of temperature and salinity on Vibrio cholerae.

Appl Environ Microbiol1982;44:1047-1058

20. Baumann P, Baumann L, Mandel M. Taxonomy of marine bacteria: the genus Beneckea. J Bacteriol1971;107:268-294

21. Smith SK, Sutton DC, Fuerst JA, Reichelt JL. Evaluation of the genus Listonella and reassignment of255Listonella damsela (Love et al) MacDonell and Colwell to the genusPhotobacterium asPhotobacteriumdamsela comb. nov. with an emended description.Int J Syst Bacteriol1991; 41:529-534

22. Matsushita S, Kudoh Y, Ohashi M. Transferable resistance to vibriostatic agent 2,4-diamino 6,7-diisopropylpteridine (0/129) in Vibrio cholerae. Microbiol Immunol1984;28:1159-1162


9/35

Vibrionaceae


23. Thungapathra M, Sinha KK, Chaudhuri SR et al. Occurrence of antibiotic resistance gene cassettes260aac(6')-Ib, dfrA5, dfraA12, and ereA2 in Class I integrons in non-O1, non-O139 Vibrio cholerae strains in

India.Antimicrob Agents Chemother2002;46:2948-2955

24. Nicholls KM, Lee JV, Donovan TJ. An evaluation of commercial thiosulphate citrate bile salt sucrose agar

(TCBS).J Appl Bacteriol1976;41:265-269

25. Oppenheimer CH, ZoBell CE. The growth and viability of sixty-three species of marine bacteria as265

influenced by hydrostatic pressure.J Mar Res 1952;9:10-1826. Johnson PT. A new medium for maintenance of marine bacteria.J Invertebr Pathol1968;11:144

27. Lunder T, Evensen , Holstad G, Hstein T. 'Winter ulcer' in the Atlantic salmon Salmo salarPathological and bacteriological investigations and transmission experiments. Dis Aquat Organ1995;23:39-49270

28. Handlinger J. Collection and submission of samples for investigation of diseases of fin fish.NationalAquatic Animal Health Technical Working Group Advisory Document. pp 39

29. Ward M, Watt P. The preservation of gonococci in liquid nitrogen.J Clin Pathol1971;24:122-123

30. Redway KF, Lapage SP. Effect of carbohydrates and related compounds on the long-term preservation of

freeze-dried bacteria. Cryobiology 1974;11:73-79275

31. Leslie SB, Israeli E, Lighthart B, Crowe JH, Crowe LM. Trehalose and sucrose protect both membranesand proteins in intact bacteria during drying.Appl Environ Microbiol1995;61:3592-3597

32. Brewer DG, Martin SE, Ordal ZJ. Beneficial effects of catalase or pyruvate in a most-probable-number

technique for the detection ofStaphylococcus aureus. Appl Environ Microbiol1977;34:797-800

33. Mizunoe Y, Wai SN, Ishikawa T, Takade A, Yoshida S-I. Resuscitation of viable but unculturable cells of280Vibrio parahaemolyticus induced at low temperature under starvation. FEMS Microbiol Lett2000;186:115-120

34. Sneath PHA. Test reproducibility in relation to identification.Int J Syst Bacteriol1974;24:508-523

35. Willcox WR, Lapage SP, Bascomb S, Curtis MA. Identification of bacteria by computer: theory andprogramming.J Gen Microbiol1973;77:317-330285

36. Gyllenberg HG, Nieml TK. New approaches to automatic identification of micro-organisms. In:Pankhurst RJ, editor.Biological Identification with Computers. Academic Press, London, 1975:121-136

37. Bryant TN. PIBWin software for probabilistic identification.J Appl Microbiol2004;97:1326-1327

38. Thompson FL, Gevers D, Thompson CC et al. Phylogeny and molecular identification of vibrios on the

basis of multilocus sequence analysis.Int J Syst Evol Micriobiol2005;71:5107-5115290

39. Nishibuchi M. Molecular Identification. In: Thompson FL, Austin B, Swings J, editors. The Biology of theVibrios. ASM Press, Washington, DC, 2006:44-64

40. Ruimy R, Breittmayer V, Elbaze P et al. Phylogenetic analysis and assessment of the genera Vibrio,Photobacterium, Aeromonas and Plesiomonas deduced from small sub-unit rRNA sequences.Int J SystBacteriol1994;44:416-426295

41. Osorio CR, Toranzo AE, Romalde JL, Barja JL. Multiplex PCR assay for ureC and 16S rRNA genes

clearly discriminates between both subspecies of Photobacterium damselae. Dis Aquat Organ2000;40:177-183

42. Oakey HJ, Levy N, Bourne DG, Cullen B, Thomas A. The use of PCR to aid in the rapid identification of

Vibrio harveyi isolates.J Appl Microbiol2003;95:1293-1303300

43. Brasher CW, DePaola A, Jones DD, Bej AK. Detection of microbial pathogens in shellfish with multiplex

PCR. Curr Microbiol1998;37:101-107

44. Hirono I, Masuda T, Aoki T. Cloning and detection of the hemolysin gene ofVibrio anguillarum. MicrobPathog1996;21:173-182

45. Lapage SP, Bascomb S, Willcox WR, Curtis MA. Identification of bacteria by computer: general aspects305and perspectives.J Gen Microbiol1973;77:273-290

46. Sneath PHA, Johnson R. The influence on numerical taxonomic similarities of errors in microbiologicaltests.J Gen Microbiol1972;72:377-392


10/35

Vibrionaceae


47. Bascombe S, Lapage SP, Curtis MA, Willcox WR. Identification of bacteria by computer: identification ofreference strains.J Gen Microbiol1973;77:291-315310

48. Taniguchi H, Hirano H, Kubomura S, Higashi K Mizuguchi Y. Comparison of the nucleotide sequencesof the genes for the thermostable direct hemolysin and the thermolabile hemolysin from Vibrioparahaemolyticus. Microb Pathog1986;1:425-432

49. Furniss AL, Lee JV, Donovan TJ. The Vibrios, Monograph Series 11, Public Health Laboratory Service.

HMSO, London, 1978:1-58315

50. Thornley MJ. The differentiation ofPseudomonas from other Gram-negative bacteria on the basis of

arginine metabolism.J Appl Bacteriol1960;23:37-52

51. West PA, Colwell RR. Identification and Classification ofVibrionaceae - An Overview. In: Colwell RR.editor. Vibrios in the Environment. John Wiley, New York, 1984:285-363

52. Atlas R, Parks L. Bromcresol Purple Broth. In:Handbook of Microbiological Media. CRC Press, Boca320Raton, 1993:158

53. Hansen GH, Srheim R. Improved method for phenotypical characterization of marine bacteria. JMicrobiol Methods 1991;13:231-241

54. Lowe GH. The rapid detection of lactose fermentation in Paracolon organisms by the demonstration of-D-galactosidase.J Med Lab Technol1962;19:21-25325

55. Cowan ST. In: Manual for the identification of medical bacteria. 2nd edn. Cambridge University Press,Cambridge, 1974:1-238

56. Mller V. Simplified tests for some amino acid decarboxylases and the arginine dihydrolase system.Acta

Pathol Microbiol Scand1955;36:158-172

57. Smibert RM, Krieg NR. Phenotypic characterization. In: Gerhardt P. editor. Methods for General and330Molecular Bacteriology. American Society for Microbiology, Washington, DC, 1994:607-654

58. Maslen LGC. Routine use of liquid urea medium for identifying Salmonella and Shigella organisms.BrMed J1952;2(4783):545-546

59. Pitt T, Dey D. A method for the detection of gelatinase production by bacteria. J Appl Bacteriol1970;33:687-691335

60. Lam J, Mutharia L. Antigen-antibody reactions. In: Gerhardt P. editor.Methods for General Bacteriology.

American Society for Microbiology, Washington, DC, 1994:104-132

61. MacFaddin JF. Biochemical tests for Identification of Medical Bacteria. 2nd edn. Williams & Wilkins,

Baltimore, 1980:1-912

62. Hendrickson D. Reagents and Stains. In: Lennette EH. editor.Manual of Clinical Microbiology. 4th edn.340

American Society for Microbiology, Washington DC, 1985:1093-1107

63. Barrow GI, Feltham RKA. Cowan and Steel's Manual for the Identification of Medical Bacteria. 3rd

edn.Cambridge University Press, Cambridge, 1993:1-331


11/35

Vibrionaceae


Part 2 Test Methods345

Identification by Phenotype

PrincipleIdentification ofVibrionaceae is made using the entire panel of tests listed in Table 7 using

the standardised test formulations given in Appendix 2. An identification is made by350

matching the phenotype of an unknown against the probability data matrix VibEx7 anddetermining the most likely identification using the computer software package PIBWin.

Table 7. Panel of tests for the identification ofVibrionaceae

Arginine dihydrolase

Lysine decarboxylase355

Ornithine decarboxylase

Acid (fermentation)

Arbutin

Mannitol

Salicin360

SucroseGentiobiose

Growth

7% NaCl10% NaCl365

Acetoin

Indole

Alkaline phosphatase, pH 8.0

Oxidase

Hydrolysis370

2-nitrophenyl -D-galactopyranoside

L-glutamic acid 5-(4-nitroanilide)

4-nitrophenyl sulfate

AesculinAgar375

GelatinStarch

Sole carbon utilisation:-ketoglutarate

Acetate380D-alanine

CitrateL-citrulline

D-galactose

D-gluconate385

D-glucosamine

D-glucose

D-glucuronate

Glycerol

L-histidine390DL-3-hydroxybutyrate

trans-4-hydroxy-L-proline

DL-lactateD-lactosePropionate395


12/35

Vibrionaceae


Table 7. Panel of tests for the identification ofVibrionaceae (cont.)

Putrescine

Succinate

Sucrose

Resistance:400

0/129 10 g

0/129 150 gAmpicillin 10 g

Carbenicillin 100 g

Novobiocin 5 g405

Sample Requirements

Pure cultures less than 48 hours old should be used for the inoculum. Cultures recoveredfrom preservation by freezing or drying must be subcultured at least twice before

commencing identification.410

Test Procedures

Perform an oxidase test by a preferred method. Observe agarolytic activity as pitting ofcolonies on maintenance agar such as JMA or ZMA.

Inocula: Prepare two inocula in 3 mL volumes of 2% saline: one to a density equal to

McFarland 0.5, the other to McFarland 2.415

Inoculation of media: Inoculate the decarboxylase test media with 100 L of McFarland 2density cell suspension. Inoculate the remaining liquid media with 100 L of McFarland 0.5

density cell suspension. For the acetoin and arginine dihydrolase tests, inoculate the semi-solid media with a straight wire.

Sole carbon source media are spot inoculated with 2 L of McFarland 0.5 suspension or420with a multipoint inoculator. Maximum number of inocula on a plate should not exceed 30.

Gelatin and starch plates are spot inoculated with 2 L of McFarland 0.5 suspension or witha multipoint inoculator. Maximum number of inocula on a plate should not exceed 6, well

separated inoculum points.

Tests for arginine dihydrolase and decarboxylases are overlayed with 20-25 mm of sterile425

liquid paraffin.

Sensitivity tests are undertaken on Mueller-Hinton agar supplemented with 2% w/v NaCl.

The medium is inoculated with the McFarland 0.5 suspension.

Incubation: Tests are incubated at 25C for 48 hours. Observe tests daily and record

changes. Sensitivity tests are incubated for 24 hours and the diameter of the zone of430

inhibition measured. Psychrophilic species are tested at 15C for 8 days; sensitivity tests for3-4 days. Known psychrophiles are listed in Table 8.

Table 8. Species requiring incubation at 15C

Aliivibrio logei435

Aliivibrio wodanis

Aliivibrio salmonicida

Moritella marina

Moritella viscosa

Photobacterium iliopiscarium440Photobacterium phosphoreum


13/35

Vibrionaceae


Test Interpretation

Arginine dihydrolase: A positive reaction is a pink/red colour; yellow to orange is

negative. See Figure 1.445

Figure 1. Arginine dihydrolase. A: negative; B: positive

Decarboxylase tests: The negative control should be yellow for the test to be valid; a450positive test for ornithine or lysine decarboxylase is purple, See Figure 2.

Figure 2. Decarboxylase test. A: positive ornithine; B: positive lysine; C: negative control

455

Acid from carbohydrates: A dirty yellow to bright yellow colour is positive; pale purple to

deep purple is negative. See Figure 3. Protein deamination may occur with prolonged

incubation and may cause positive tests to appear negative due to alkaline pH shifts; ignore

reversions.

460

Figure 3. Fermentation test. A: positive; B: negative

A B

A B C

A B


14/35

Vibrionaceae


NaCl tolerance tests: Any signs of growth is a positive reaction.

465

Acetoin: Overlay semi-solid medium with 200L of -naphthol followed by 100L of

KOH/creatine. Leave at room temperature for up to 30 minutes. Pale pink to red layer is

positive; yellow to tan is negat ive. See Figure 4.

Figure 4. Acetoin (Voges-Proskauer) test. A: positive; B: negative470

Indole: In a microtitre tray well add 100 L of Kovcs' indole reagent to an equal volume of

culture. Mix the contents of the well by careful aspiration with a pipette. If a pink/red colour

is visible record as positive. See Figure 5. If in doubt, remove contents with a glass Pasteur

pipette and allow the phases to separate in the pipette body; record the reaction based on the

top phase only.475

Figure 5. Indole test. Wells 1-5 are a range of positive reactions; well 6 is negative.

Gelatin hydrolysis: Flood plate with saturated ammonium sulphate. Any zone of clearingaround inocula is positive.480

Starch hydrolysis: Flood plate with Gram's iodine. Zones of yellow to light tan colour

around inocula is positive; black to dark blue is negative.

Urease: A pink/red colour is positive; yellow is negative. See Figure 6.485

Figure 6. Urease test. A: positive; B: negative

A B

1 2 3 4 5 6

A B


15/35

Vibrionaceae


Chromogens:

Indoxyl alkaline phosphatase: Any blue/black colour is positive; no colour is negative. See490

Figure 7.

Figure 7. Indoxyl phosphate for alkaline phosphatase test, pH 8.0. A: negative; B: positive.

Nitrophenol & nitroaniline chromogens: Any yellow colour is positive; no colour is495negative. See Figure 8.

Figure 8. Nitrophenol and nitroanilide chromogen test. Substrate: 2-nitrophenyl -D-galactopyranoside (PNPG). A: positive; B: negative.

500

Aesculin: A brown to black colour is positive for hydrolysis; a very light tan to colourless is

negative. See Figure 9.

Figure 9. Aesculin test. A: negative; B: positive

505

Sole carbon source tests: Examine the negative control plate; some strains and some

species may show very slight growth even when using purified agar. See Figure 10.

A B

A B

A B


16/35

Vibrionaceae


Figure 10. Sole carbon source test. A: negative control; B: glucose. Test organism Vibrio fluvialis510

NCTC 11327T. Differentiation between positive and negative tests.

With reference to the control plate, examine growth on the remaining test plates. Growth inexcess of the negative control is read as positive. If there is no growth with glucose the

strain may be nutritionally fastidious. Retest with sole carbon source media containing5150.015g/L Casamino acids.

Antibiotic sensitivity test: The diameter of the zone of inhibition is interpreted using the

data in Table 9; disc size is 6mm.

Table 9. Zone size interpretation for diagnostic antibiotics

Test Resistant Sensitive520

0/129 10 g 15 mm 16 mm

0/129 150 g No zone Any zoneAmpicillin 10 g 13 mm 14 mm

Novobiocin 5 g 16 mm 17 mm

Carbenicillin 100 g 22 mm 23 mm525

Probabilistic identificationAn identification is obtained using the software PIBWin and the probability matrix VibEx7.

An identification is accepted if the Willcox probability score P is 0.99 and the modal

likelihood score (MLS) is 0.001.8

IfPis 0.99 but the MLS is


17/35

Vibrionaceae


Identification by PCR

IntroductionThe primer sets have been evaluated and optimised for the purpose of culture identification.

The protocols represent optimal conditions but minor refinements may be required to550account for variation in the characteristics of different thermal cyclers.

Extraction of DNAReference DNA: Extract and purify DNA from control strains using a QIAamp DNA mini-

kit (cat. no. 51304, QIAGEN). Purified control DNA is used at a concentration of 50pg L -1.

Sample DNA: To 100 L of PCR grade 18M water in a 1.5 mL microfuge tube, suspend555

sufficient cells to a density equivalent to McFarland 1. Hold the tube at 100C in a dry-heat

block for 10 minutes and then cool rapidly in a cool block for 5 minutes. Pellet the cells at

10,000 rcf for 5 minutes and collect the supernatant containing liberated DNA. The

extracted DNA is suitable for amplification without purification.

PCR reaction volume560

All PCR reactions are as 25 L volumes in 200 L thin-walled tubes.

Standard PCR reagents

Standard reagents for the PCR primer sets are listed in Table 10.

Table 10. Standard PCR reagents

PCR grade water, 18M565

50mM magnesium chloride

10x Invitrogen Platinum Taq buffer16mM dNTP stock (4mM each dNTP)

Invitrogen Platinum

Taq DNA polymerase

Primers (20M stock)570

Electrophoresis of amplicon

Amplicon is visualised by electrophoresis using 2% agarose gel containing 0.5 g mL-1

ethidium bromide and 1xTBE buffer, Table 11. Use a 100bp ladder as a comparative index

of amplicon size. Gels should be run at 7 volts cm-1 constant voltage.575

Table 11. 10x Tris-Boric-EDTA buffer

Tris (base) 108.0 g

Boric acid 55.0 gEDTA 8.3 gpH 8.0580

Photobacterium damselae

41

Targets16S rRNA gene for species identification and ureC gene for subspecies identification.

Primers

Primer Sequence 5' 3'

Car1 gcttgaagagattcgagtCar2 cacctcgcggtcttgctg

Ure-5' tccggaataggtaaagcgggUre-3' cttgaatatccatctcatctgc

DNA controls585

Ph damselae ssp damselae NCIMB 2184T

Ph damselae ssp piscicida NCIMB 2058T

Ph iliopiscarium ATCC 51760T


18/35

Vibrionaceae


Master mix

Component Volume

Water 11.15 L50mM MgCl2 1 L10x reaction buffer 2.5 L

16mM dNTPs 1.25 L20M Car1 2 L

20M Car2 2 L20M Ure-5' 2 L20M Ure-3' 2 L5U L

-1Taq polymerase 0.1 L

Template DNA 1 L

Volume 25 L

590

Cycle parametersCycle parameters

95C 4min.30 cycles

95C 1min.

60C 1min.

72C 40sec.

72C 5min final extension

Interpretation

Ph damselae ssp damselae. Species specific amplicon at 267bp for 16S rDNA with an

additional amplicon at 448bp for the ureC gene that is diagnostic for the subspecies595

damselae.

Ph damselae ssp piscicida. A single amplicon at 267bp for 16S rDNA. Absence of an

amplicon forureC is diagnostic for the subspeciespiscicida.

Limitations

A single band of 267bp is diagnostic ofPh. damselae sensu lato. An identification ofPh600damselae ssppiscicida is inferred if only this band is present but some caution needs to be

used where an identification is reached on the basis of absence. Corroborating phenotypicevidence and complete 16S rRNA gene sequence should be obtained if the identification

represents a new finding for a region or host not previously associated with Ph damselae ssp

piscicida.605

Vibrio harveyi42

Target

16S rRNA gene

Primers


VH-1 AACgAgTTATCTgAACCTTC

VH-2 gCAgCTATTAACTACACTACC

DNA controls610

V harveyi ATCC 14126T

V alginolyticus ATCC 17749T


19/35

Vibrionaceae


Master mix

Component Volume

Water 18.15 L50mM MgCl2 1.5 L10x reaction buffer 2.5 L

16mM dNTPs 1.25 L20M VH-1 0.25 L

20M VH-2 0.25 L5U L

-1Taq polymerase 0.1 L

Template DNA 1 LVolume 25 L

Cycle parameters

Cycle parameters

94C 2min.

40 cycles

94C 1min.

65C 1min.

72C 2min.72C 5min. final extension

Interpretation615

A single band of 413bp is characteristic ofV harveyi.

Limitations

On the basis of testing undertaken, the primers are specific for strains of both V harveyibiovar I and II associated with blister disease in abalone. Some strains ofV alginolyticus are

known to cross-react because of sequence similarity with the primer regions. A positive620finding must be corroborated by phenotype using the tests given in Table 4.

Vibrio vulnificus43

Target

cth cytolysin/haemolysin gene.

Primers625


L-CTH ttccaacttcaaaccgaactatgac

R-CTH gctactttctagcattttctctgc

DNA controls

V vulnificus ATCC 27562T

V parahaemolyticus ATCC 17802T

Master mixComponent Volume

Water 16.375 L50mM MgCl2 1.25 L10x reaction buffer 2.5 L16mM dNTPs 1.25 L20M L-CTH 1.25 L

20M R-CTH 1.25 L5U L-1 Taq polymerase 0.125 L

Template DNA 1 LVolume 25 L


20/35

Vibrionaceae


Cycle parameters630

Cycle parameters

94C 3min.30 cycles

94C 1min.

57C 1min.

72C 3min.72C 5min. final extension

Interpretation

A single band of 205bp is characteristic of the cytolysin/haemolysin gene in V vulnificus.

Limitations

An identification ofV vulnificus is inferred by the presence of the cth gene which appears tobe specific forV vulnificus. It is noteworthy that the forward primer L-CTH is unique to V635

vulnificus while R-CTH is homologous with the thermolabile haemolysin gene of Vparahaemolyticus.48 Based on limited testing the primers appear specific for V vulnificus,

however the frequency with which the gene occurs within the species is not known and may

not be sufficiently reliable for the purpose of identification in the absence of a prioriinformation.640

Vibrio anguillarum44

Target

vah1 haemolysin gene.

Primers645


VaH1-P1 accgatgccatcgctcaaga

VaH1-P2 ggatattgaccgaagagtca

DNA controlsV anguillarum ATCC 19264T

V parahaemolyticus ATCC 17802T

Master mix

Component Volume

Water 14.4 L50mM MgCl2 0.75 L

10x reaction buffer 2.5 L16mM dNTPs 1.25 L20M VaH1-P1 2.5 L

20M VaH1-P2 2.5 L5U l-1 Taq polymerase 0.1 LTemplate DNA 1 LVolume 25 L

Cycle parameters650Cycle parameters

94C 4min.30 cycles

94C 30sec.

55C 30sec.

72C 60sec.

72C 5min. final extension


21/35

Vibrionaceae


Interpretation

A single band of 490bp is characteristic of the haemolysin gene ofV anguillarum.

Limitations

The vah1 gene appears to be specific to V anguillarum despite having a common ancestrywith haemolysins from other species of Vibrionaceae. From limited testing however it655

appears that not all strains ofV anguillarum possess the vah1 gene and its use as a primary

means of identification is limited. Primers for the vah1 gene should be limited todetermining the presence of the haemolysin gene in strains or as a supporting test.

APPENDICES660

Appendix 1

Maintenance Media

Johnson's Marine Agar26

Peptone (Oxoid LP0037) 5.0 g

Yeast extract 1.0 g665

Ferrous (II) sulphate (FeSO47H2O) 0.2 g

Sodium thiosulphate (Na2S2O35H2O) 0.3 g

Agar 12.0 gAged seawater 900 mL

Distilled water 100 mL670pH 7.5-7.6

Autoclave at 121C for 15 minutes

Sheep Blood Agar +2% NaCl

Blood agar base no.2 (Oxoid CM0271) 40.0 g675

NaCl 15.0 gDistilled water 1000 mL

pH 7.40.2

Autoclave at 121C for 15 minutes and cool to 50C; aseptically add 70 mL of sterile

defibrinated sheep's blood, mix gently and pour as plates.680

Vibrio Recovery Medium8


Yeast extract 1.0 g

Ferrous sulphate (FeSO47H2O) 0.2 g685

Sodium thiosulphate (Na2S2O35H2O) 0.3 g

Sodium pyruvate 1.0 gBacteriological charcoal 2.0 gAged seawater 900 mL

Distilled water 100 mL690pH 7.5-7.6

Autoclave at 121C for 15 minutes


22/35


23/35

Vibrionaceae


Fermentation Test Medium52


Yeast extract (Oxoid LP0021) 1.0 g

Lab Lemco (Oxoid LP0029) 3.0 g

NaCl 15.0 g740

Bromocresol purple 0.5%* 8 mL

Distilled water 900 mLpH 7.2

*0.5 g bromocresol purple in 100 mL 50:50 v/v ethanol/distilled water

Dissolve the ingredients, check and adjust pH and dispense as 90 mL volumes in745

screw cap bottles. Sterilise by autoclaving at 121C for 15 minutes.

Prepare filter sterilised stocks of the following sugars as 10% stocks in distilled water:

arbutin, mannitol, salicin, sucrose and -gentiobiose.

To 90 mL of sterile base add 10 mL of 10% sugar stock to give a final concentration

of 1%. Dispense medium as 3 mL volumes in 12 x 90 mm diameter sterile tubes.750

Tolerance to NaCl51

7% NaCl

Tryptone (Oxoid L0042) 1.0 gYeast extract (Oxoid LP0021) 0.1 g755

NaCl 7.0 gDistilled water 100 mL

pH 7.2

10% NaCl

Tryptone (Oxoid L0042) 1.0 g760

Yeast extract (Oxoid LP0021) 0.1 gNaCl 10.0 g

Distilled water 100 mL

pH 7.2

Autoclave at 121C for 15 min as 100 mL volumes in sealed bottles to prevent765

evaporation. Dispense as 3mL volumes in 12x90 mm sterile tubes.

Amylase51

Nutrient broth No. 2 (Oxoid CM0067) 2.5 g

NaCl 1.0 g770Soluble starch 0.1 g

Agar 1.5 gDistilled water 100 mL

pH 7.5

Dissolve all the ingredients except for the agar. Warm to assist solution of the starch if775

required. Add the agar. Autoclave at 121C for 10 minutes. Pour as plates.


24/35

Vibrionaceae


Acetoin (Voges-Proskauer) Test49

Tryptone (Oxoid LP0042) 0.7 g

Soya peptone (Oxoid LP0044) 0.5 g780


Glucose 1.0 g

NaCl 1.5 g

Agar 0.3 gDistilled water 100 mL785

pH 7.0

Dissolve all the ingredients including the agar. Dispense as 3 mL volumes in 12x90

mm tubes. Autoclave at 115C for 10 min. Cool as butts.

Gelatin51

790

Nutrient broth No. 2 (Oxoid CM0067) 2.5 g

NaCl 1.0 g

Gelatin 0.5 g

Agar 1.5 g

Distilled water 100 mL795pH 7.5

Dissolve all the ingredients except for the agar. Warm to assist solution of the gelatin.

Add the agar.

Autoclave at 115C for 20 min. Pour as plates.

800

Indole51,53



NaCl 1.5 g

L-tryptophan 0.04 g805Distilled water 100 mL

pH 7.5

Dissolve ingredients. Dispense as 3 ml volumes in 12x90 mm tubes. Autoclave at

121C for 15min.

810

Chromogen Tests8,54

Nutrient Base



NaCl 6.0 g815Distilled water 300 mL

pH 7.5

Dissolve ingredients and dispense as four volumes of 75 mL. Autoclave at 121C for

15 min.

Phosphate buffer: 0.01M, pH 7.5820

Stock 0.1M bufferNaH2PO42H2O 0.245 g

Na2HPO412H2O 3.022 gDistilled water, made up to 100 mL

pH 7.5825


25/35

Vibrionaceae


Prepare a stock of 0.01M buffer, pH 8.0

0.1M phosphate buffer 10 mL


Phosphate buffer: 0.01M, pH 8Prepare a x10 stock of 0.1M buffer830

NaH2PO42H2O 0.083 g

Na2HPO412H2O 3.395 gDistilled water, made up to 100 mL

pH 8.0

Prepare a stock of 0.01M buffer, pH 88350.1M phosphate buffer 10 mL


Chromogen stocks

IXP medium

3-indoxyl phosphate 0.08 g840

0.01M phosphate buffer, pH 8 25 mL

Filter to sterilise. Aseptically add to 75 mL of nutrient base. Aseptically dispense

as 2 mL volumes in 12x90 mm sterile tubes.

PNPG medium

4-nitrophenyl -D-galactopyranoside 0.06 g8450.01M phosphate buffer, pH 7.5 25 mL

Filter to sterilise. Aseptically add to 75 mL of nutrient base. Aseptically dispenseas 2 mL volumes in 12x90 mm sterile tubes.

LGN medium

L-Glutamic acid 5-(4-nitroanilide) 0.06 g850

0.01M phosphate buffer, pH 7.5 25 mL



NPS medium

4-nitrophenyl sulphate 0.04 g8550.01M phosphate buffer, pH 7.5 25 mL



Protect media from light.

860

Aesculin Hydrolysis55



NaCl 1.5 g

Aesculin 0.1 g865Ferric citrate 0.05 g


pH 7.5

Dissolve ingredients and dispense as 3 mL volumes in 12x90 mm tubes. Autoclave at

115C for 10min. Protect medium from light.870


26/35

Vibrionaceae


Carbon Source Utilisation Tests13

Inorganic nitrogenous base

Buffer base

TRIS (basic) 6.1 g875Distilled water 500 mL

pH 7.5

Adjust pH with concentrated HCl

Salts solution

NH4Cl 1.0 g880

K2HPO43H2O 0.075 g

FeSO47H2O 0.028 g

NaCl 11.7 g

MgSO47H2O 12.3 g

KCl 0.75 g885Yeast extract (Oxoid LP0021) 0.015 g

CaCl2H2O 1.45 g


Weight out all the salts and combine except for the calcium chloride. Add

the distilled water; once the salts are fully dissolved add the calcium890

chloride.

Combine the buffer base and salts solution.

Divide the medium into 10 x 90 mL volumes. To each volume add 1.2 g of

purifiedagar (Oxoid LP0028) and autoclave at 121C for 15 min; cool to 55C.

Carbon sources895Prepare 2% w/v or v/v concentrations in distilled water, of the carbon substrates

listed; filter to sterilise.

-ketoglutarate L-histidine

Acetate DL-3-hydroxybutyrateD-alanine trans-4-hydroxy-L-proline

Citrate DL-lactateL-citrulline D-lactose

D-galactose PropionateD-gluconate Putrescine

D-glucosamine Succinate

D-glucose Sucrose

D-glucuronate Water (control)Glycerol

Complete mediumTo a 90 mL volume of cooled molten inorganic nitrogenous base, add 10 mL of carbon

source. Mix well and pour as plates.900

Supplement for nutritionally fastidious strains

To the nitrogenous base add 0.015 g/L Casamino Acids (Difco, 0230-15).

Decarboxylase Test51,56,57

Difco Decarboxylase broth base (Mller) 300 mL905

Yeast extract (Oxoid LP0021) 0.3 gNaCl 4.5 g

pH 6.5


27/35

Vibrionaceae


Divide the base into three volumes of 100 mL each. To one volume add 1.0 g of L-

lysine and to the second volume 1.0 g of L-ornithine; the third volume is a control.910Check and adjust the pH to 6.5 if required. Autoclave at 121C for 10 min. Check the

pH of the media and, if required, adjust aseptically with 1N NaOH or HCl. Aseptically

dispense the media as 3 mL volumes into 12x90 mm sterile tubes.

Urease58

Broth base915Peptone (Oxoid LP0037) 0.1 gGlucose 0.1 g

Sodium chloride 1.5 g

Na2HPO4 (anhydrous) 0.12 g

KH2PO4 (anhydrous) 0.08 g920Phenol red (0.01%) 4 mL


pH 6.8

Dissolve the ingredients and autoclave as a single volume at 115C for 20 min.

Urea stock (40% w/v)925

Urea 8 g


Dissolve the urea and filter to sterilise.

Complete medium

To the cool sterile base add 5 mL of sterile urea stock; mix. Dispense aseptically930as 2 mL volumes in 12x90 mm sterile tubes.

Shelf Life of Media

Agar plates have a shelf life of 4 weeks and liquid media have a shelf life of 8 weekswhen stored at 2-8C.935

Saturated Ammonium Sulphate (Gelatin test)59,60

Ammonium sulphate 10 gDistilled water 10 mL

Store at room temperature.940

Coblentz Reagents (Acetoin test)61

Reagent 1

-naphthol 0.5 g

Ethanol 10 mL945Store refrigerated in a dark bottle.

Reagent 2

Creatine 0.03 g

KOH 4.0 g

Distilled water 10 mL950Store refrigerated.

Iodine (Starch test)62

Grams Iodine

Iodine 1.0 g955Potassium iodide 2.0 gDistilled water 300 mL


28/35

Vibrionaceae


Dissolve the potassium iodide in 20 mL of water and then add the iodine. Once

dissolved, make up to 300 mL with water.

Store at room temperature in a dark bottle.960

Kovcs' Reagent (Indole test)63

p-dimethylaminobenzaldehyde 2 g

pentan-1-ol (n amyl alcohol) 30 mLConcentrated HCl 10 mL965

Dissolve the aldehyde in the alcohol by gently warming at 50-55C. Cool and slowly

add the acid. Protect from light and store at 4C.

Note: iso amyl alcohol is not the same as n amyl alcohol. The iso- form of pentanol

cannot be used for Kovcs' reagent.

970


29/35

Vibrionaceae


Appendix 3: VibEx7 probability matrix for the identification ofVibrionaceae

Data as % strains positive Aeromonas.sobriaHG7

G.hollisae

M.marina

M.viscosa

A.fischeribiovarI

A.fischeribiovarII

A.logei

A.salmonicida

A.wodanis

Ph.angustum

Ph.damselaessp.damselaebiovarI

Ph.damselaessp.damselaebiovarII

Ph.damselaessp.piscicid

a

Ph.iliopiscarium

Ph.leiognathi

Ph.phosphoreum

Test No. strains 7 4 1 8 5 10 2 1 1 1 29 7 5 3 4 1

Arginine dihydrolase 86 1 1 57 1 1 1 1 1 1 99 99 99 99 75 99

Acid: Arbutin 14 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Mannitol 99 1 1 1 40 87 99 99 1 99 1 1 1 33 1 1

Salicin 14 1 1 1 40 40 1 1 1 1 1 1 1 1 1 1

Sucrose 57 1 1 1 20 1 1 1 99 1 1 1 1 33 50 1

Gentiobiose 14 1 1 1 60 90 1 1 1 99 1 1 1 1 1 1

Growth: 7% NaCl 1 99 99 1 1 70 1 99 1 99 86 99 1 99 50 99

10% NaCl 1 25 99 1 1 1 1 1 1 1 1 1 1 1 1 1

Amylase 99 1 1 99 40 55 1 1 99 1 27 14 20 99 1 1

Voges Proskauer (Acetoin) 86 1 1 1 1 1 1 1 1 1 99 99 99 99 99 99

Gelatinase 71 1 1 99 20 1 1 1 1 1 24 33 20 1 25 1

Indole 86 75 1 1 20 1 1 1 99 1 3 1 1 1 1 1

IXP alkaline phosphatase 86 50 1 13 80 99 99 1 1 99 99 85 20 33 25 99

PNPG -D-galactosidase 29 1 99 1 1 20 1 1 1 1 3 1 20 1 1 99LGN -glutamyl transpeptidase 71 1 99 99 1 50 99 1 1 1 48 14 20 1 75 1

NPS sulphatase 14 1 99 1 60 99 99 1 1 99 1 1 1 1 25 1

Aesculin hydrolysis 71 1 1 20 80 99 99 1 1 50 31 1 1 1 25 1

Utilisation: -ketoglutarate 14 50 99 1 1 1 99 1 1 99 3 1 20 1 1 99

Acetate 29 99 99 88 80 1 50 99 99 99 93 1 60 99 50 1

Alanine 1 99 99 25 20 1 1 1 1 1 10 1 99 1 1 1

Citrate 43 99 1 1 1 60 99 99 99 99 1 1 1 99 1 1

Citrulline 1 1 1 38 1 1 1 1 1 1 1 1 1 1 1 1

Galactose 57 99 1 1 40 99 99 99 1 99 93 28 60 99 25 99

Gluconate 99 75 99 1 1 20 99 99 1 1 3 14 20 99 99 1

Glucosamine 99 25 1 50 20 99 99 1 1 99 99 42 60 99 99 99

Glucuronate 1 1 1 1 1 1 1 1 1 1 1 1 1 33 1 1Glycerol 99 75 99 99 40 90 99 99 99 99 99 42 60 99 75 99

Histidine 29 50 1 88 1 1 1 1 1 1 1 1 1 1 1 1

DL-3-hydroxybutyrate 1 1 1 1 40 1 1 99 1 1 1 1 1 1 25 1

Hydroxyproline 1 1 1 1 1 1 1 1 1 99 1 1 1 1 1 1

DL-lactate 14 99 99 99 1 1 1 1 1 1 79 1 1 1 99 99

Lactose 1 1 1 1 1 1 1 1 1 1 1 1 20 1 1 99

Propionate 14 99 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Putrescine 14 1 1 1 1 1 1 99 1 1 1 1 1 99 1 1

Succinate 86 75 99 99 40 90 99 99 99 99 89 42 40 99 75 99

Sucrose 57 1 1 1 60 1 1 99 99 1 1 1 1 33 50 1

Oxidase 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 1

Agarolysis 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Resistance: 0/129 10 g 99 1 99 38 1 1 1 1 1 1 1 14 1 1 1 1

0/129 150 g 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1


30/35

Vibrionaceae


Data as % strains positive Aeromonas.sobria

HG7

G.hollisae

M.marina

M.viscosa

A.fischeribiovarI

A.fischeribiovarII

A.logei

A.salmonicida

A.wodanis

Ph.angustum

Ph.damselaessp.d

amselaebiovarI

Ph.damselaessp.d

amselaebiovarII

Ph.damselaessp.p

iscicida

Ph.iliopiscarium

Ph.leiognathi

Ph.phosphoreum

Test No. strains 7 4 1 8 5 10 2 1 1 1 29 7 5 3 4 1

Ampicillin 10 g 57 1 1 1 60 80 99 99 1 99 65 14 20 1 75 1

Novobiocin 5 g 86 25 1 1 1 10 1 1 1 50 27 14 20 33 50 1

Carbenicillin 100 g 17 1 1 1 99 80 99 99 1 99 89 42 20 33 75 1

Lysine decarboxylase 99 1 1 38 20 55 99 1 1 99 62 57 1 99 1 1

Ornithine decarboxylase 29 1 1 1 20 33 99 1 1 1 1 1 1 1 1 1

Urease 14 1 1 1 99 99 1 1 1 99 99 99 1 1 25 1

Data as % strains positive V.aestuarianus

V.agar

ivorans

V.algin

olyticus

V.angu

illarum

V.calviensis

V.campbellii

V.chag

asii

V.cholerae

V.cincinnatiensis

V.cyclitrophicus

V.diazotrophicus

V.fluvialis

V.furnissii

V.gazo

genes

V.halioticoli

V.harv

eyibiovarI

Test No. strains 3 7 30 60 4 4 21 12 3 7 4 9 10 3 3 62


Acid: Arbutin 1 14 3 1 67 1 1 1 66 1 99 99 1 99 1 29

Mannitol 99 99 99 98 50 50 99 99 99 85 99 99 99 33 99 94

Salicin 1 57 20 1 75 75 5 1 66 1 99 99 1 99 1 79

Sucrose 99 1 99 98 75 1 43 99 66 99 99 99 99 99 67 65

Gentiobiose 1 99 1 1 75 50 1 1 33 14 1 11 1 1 1 95

Growth: 7% NaCl 67 29 99 93 25 99 95 58 99 99 99 99 99 99 67 99

10% NaCl 1 1 99 3 1 1 10 1 66 1 50 56 90 66 33 5

Amylase 99 43 99 96 99 75 99 75 66 99 25 99 70 99 1 99


Gelatinase 67 1 99 77 50 99 99 67 33 99 25 44 30 99 33 97

Indole 99 1 99 93 99 99 95 99 1 85 99 99 99 1 33 97


PNPG -D-galactosidase 99 99 16 53 99 1 76 75 99 99 99 33 44 99 99 95

LGN -glutamyl transpeptidase 1 29 96 15 50 99 86 99 1 71 99 99 99 1 1 94

NPS sulphatase 1 14 40 1 1 1 99 8 1 71 25 11 1 1 1 60



Acetate 67 43 96 51 99 25 99 99 33 99 99 99 90 99 33 89

Alanine 99 14 99 76 99 50 99 67 1 99 99 99 99 33 1 99Citrate 99 1 96 95 99 99 95 92 99 99 99 99 99 66 1 95

Citrulline 1 1 20 16 99 25 62 1 1 85 1 56 10 1 1 6


31/35

Vibrionaceae


Data as % strains positiveV.aestuarianus

V.agarivorans

V.algino

lyticus

V.anguillarum

V.calviensis

V.campbellii

V.chaga

sii

V.cholerae

V.cincin

natiensis

V.cyclitr

ophicus

V.diazotrophicus

V.fluvialis

V.furnis

sii

V.gazogenes

V.halioticoli

V.harveyibiovarI

Test No. strains 3 7 30 60 4 4 21 12 3 7 4 9 10 3 3 62

Galactose 99 71 13 71 99 1 99 83 66 85 99 99 99 1 99 73

Gluconate 99 14 99 96 75 1 67 99 66 99 99 99 99 33 1 99

Glucosamine 99 86 99 95 99 1 99 99 99 99 75 99 99 33 99 84

Glucuronate 1 1 1 1 1 1 14 25 1 1 25 78 10 99 1 61

Glycerol 99 1 99 95 99 99 99 99 99 99 1 99 99 99 1 85

Histidine 1 1 99 93 50 1 10 67 1 71 99 89 99 1 1 8


Hydroxyproline 1 1 99 1 75 1 10 1 1 71 1 11 1 1 1 50DL-lactate 99 29 99 91 99 75 99 99 66 99 99 99 99 66 99 99

Lactose 1 1 1 1 1 1 1 1 1 28 50 1 1 1 1 1

Propionate 67 1 99 6 99 1 95 58 1 99 75 99 99 66 1 94

Putrescine 1 1 99 1 50 1 5 1 1 1 99 33 90 1 1 2

Succinate 99 29 99 93 75 99 99 75 99 99 75 99 90 99 1 97

Sucrose 99 1 99 96 75 1 43 99 66 99 99 89 99 99 67 65

Oxidase 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99

Agarolysis 1 99 1 1 1 1 1 1 33 1 1 1 1 1 1 1

Resistance: 0/129 10 g 1 1 70 3 1 25 19 8 66 28 25 44 60 99 1 82

0/129 150 g 1 1 1 1 1 1 1 1 1 1 1 1 10 1 1 1

Ampicillin 10 g 1 1 99 91 1 99 99 25 1 1 1 33 80 1 33 97

Novobiocin 5 g 67 14 90 11 1 99 19 17 50 71 75 99 99 99 33 94

Carbenicillin 100 g 33 1 99 90 1 99 99 33 1 1 1 11 80 1 33 95



Urease 1 1 1 1 1 1 10 1 1 1 1 1 1 1 1 63

Data as % strains positive V.harveyibiovarII

V.ichthyoenteribiovarI

V.ichthyoenteribiovar

V.lentus

V.mediterran

ei

V.metschnikovii

V.mimicus

V.mytili

V.natriegens

V.navarrensis

V.nereis

V.nigripulchritudo

V.ordalii

V.orientalis

V.parahaemolyticus

V.pectenicida

Test No. strains 23 6 3 9 19 5 7 5 12 4 6 3 6 6 18 2


Acid: Arbutin 1 1 1 1 1 1 1 25 83 75 1 1 1 1 1 1

Mannitol 83 60 99 75 99 99 86 99 99 99 67 1 1 99 99 1

Salicin 4 1 1 1 80 1 1 99 92 50 1 99 1 17 18 1

Sucrose 1 66 99 13 95 99 1 99 99 99 99 1 99 99 11 1

Gentiobiose 9 1 1 1 21 1 1 99 99 25 1 50 1 1 1 1

Growth: 7% NaCl 99 33 67 38 74 80 86 99 99 99 99 1 1 67 99 1

10% NaCl 4 16 1 1 5 40 14 99 75 1 67 1 1 1 89 1

Amylase 99 1 1 38 84 99 1 99 92 99 67 67 50 99 99 99


32/35

Vibrionaceae


Data as % strains positiveV.harveyibiovarII

V.ich

thyoenteribiovarI

V.ich

thyoenteribiovar

V.len

tus

V.mediterranei

V.metschnikovii

V.mimicus

V.mytili

V.natriegens

V.navarrensis

V.nereis

V.nig

ripulchritudo

V.ord

alii

V.orientalis

V.parahaemolyticus

V.pec

tenicida

Test No. strains 23 6 3 9 19 5 7 5 12 4 6 3 6 6 18 2


Gelatinase 83 16 1 63 32 60 71 1 42 75 17 99 99 67 99 1

Indole 99 1 1 63 95 60 99 1 27 99 83 67 1 99 99 1




NPS sulphatase 61 16 33 25 79 1 33 1 58 1 1 1 1 1 56 1


Utilisation: -ketoglutarate 1 1 1 50 37 1 99 20 67 99 99 99 17 1 89 1Acetate 99 83 99 88 99 60 99 99 92 75 99 67 1 67 99 1

Alanine 99 33 1 75 99 60 99 99 99 75 99 99 67 99 99 99

Citrate 99 16 1 13 99 40 99 99 92 99 99 99 99 99 94 1

Citrulline 1 1 1 1 11 1 1 20 83 1 83 1 1 1 17 1

Galactose 74 1 1 25 99 40 86 80 83 1 33 99 1 67 89 1

Gluconate 99 99 1 25 5 99 99 99 92 99 99 33 1 99 99 1

Glucosamine 96 99 99 13 99 20 99 99 99 99 99 99 50 83 99 50

Glucuronate 13 99 1 1 58 1 86 1 33 25 1 33 1 1 17 1

Glycerol 83 1 1 38 99 99 99 99 92 99 99 99 33 83 99 99

Histidine 1 1 1 1 89 1 99 99 99 99 99 99 33 17 99 1


Hydroxyproline 1 1 1 1 1 1 1 1 25 1 1 1 1 83 83 1

DL-lactate 99 66 99 63 99 40 99 99 99 99 99 99 17 99 99 99

Lactose 1 1 1 1 99 40 1 20 8 1 1 99 1 1 1 1

Propionate 78 16 1 13 99 1 50 99 92 99 99 67 1 67 89 1

Putrescine 1 1 1 13 99 1 1 1 83 1 83 1 1 83 89 1

Succinate 99 1 99 50 95 60 99 80 99 99 83 99 1 99 89 50

Sucrose 4 66 99 1 99 99 1 99 99 99 99 1 83 99 11 1

Oxidase 99 99 99 99 99 1 99 80 99 99 99 99 99 99 99 99

Agarolysis 1 1 1 1 5 1 1 1 8 1 1 1 1 1 1 1

Resistance: 0/129 10 g 91 16 67 99 1 1 1 99 99 25 33 1 1 1 61 1

0/129 150 g 1 1 1 1 1 1 1 1 1 1 1 1 1 1 6 1

Ampicillin 10 g 1 33 1 13 1 40 14 1 8 50 1 1 50 1 94 50Novobiocin 5 g 74 66 1 1 11 40 57 60 99 75 80 1 1 17 94 1

Carbenicillin 100 g 1 33 1 25 42 40 43 1 8 75 1 1 17 1 94 99



Urease 1 1 1 1 1 1 1 1 1 1 1 1 1 1 17 1


33/35

Vibrionaceae


Data as % strains positiveV.pe

lagiusbiovarI

V.pe

lagiusbiovarII

V.pe

naeicida

V.pr

oteolyticus

V.ru

moiensis

V.scophthalmi

V.sp

lendidusbiovarI

V.sp

lendidusbiovarII

V.tapetis

V.tasmaniensis

V.tubiashii

V.vu

lnificusbiovarI

V.vu

lnificusbiovarII

Phenon

6

Phenon

8

Phen

on

10

Test No. strains 10 5 4 12 3 11 37 3 1 8 7 7 5 7 7 6


Acid: Arbutin 1 1 1 1 1 1 1 1 1 1 1 71 99 99 1 1

Mannitol 99 99 1 99 33 10 97 99 1 71 99 71 1 99 99 99

Salicin 1 1 1 1 1 1 8 1 1 25 99 57 99 99 1 33

Sucrose 99 80 1 1 99 99 8 1 1 25 99 1 1 86 99 83

Gentiobiose 1 40 1 1 1 1 1 1 1 1 99 28 40 40 1 1

Growth: 7% NaCl 80 80 1 99 67 36 71 33 1 75 57 85 20 99 99 99

10% NaCl 1 1 1 99 33 1 11 1 1 1 1 1 1 99 99 83

Amylase20 80

33 99 67 1 84 99 99 13 99 99 99 99 7183


Gelatinase 20 80 1 99 67 1 89 99 1 13 99 99 80 14 99 99

Indole 1 99 1 75 1 1 95 66 1 63 99 99 1 99 86 83




NPS sulphatase 70 60 1 1 1 1 79 1 1 99 1 1 1 86 86 50



Acetate 90 80 99 99 67 45 76 99 1 99 86 85 99 99 99 99

Alanine 99 99 99 99 99 1 97 99 1 99 99 99 99 99 99 99

Citrate 80 99 99 99 99 91 97 99 99 99 99 99 99 99 99 99Citrulline 60 99 1 25 1 1 24 1 1 1 99 1 1 71 14 17

Galactose 99 99 99 1 99 36 92 1 1 1 99 99 99 1 43 67

Gluconate 99 99 99 99 67 82 84 1 1 99 99 99 99 99 99 99

Glucosamine 70 99 99 99 99 99 89 66 99 99 99 99 80 99 86 99

Glucuronate 1 1 25 1 1 64 21 1 1 1 86 85 80 1 1 17

Glycerol 99 99 99 99 99 1 99 99 99 99 99 85 99 99 99 99

Histidine 80 1 99 99 33 1 3 1 1 1 99 28 1 86 99 83


Hydroxyproline 1 1 1 99 1 1 1 1 1 1 86 1 1 1 1 99

DL-lactate 99 99 99 99 67 99 97 66 99 99 99 99 99 99 99 99

Lactose 10 20 99 1 33 1 21 1 1 1 99 1 1 1 1 1

Propionate 60 80 75 99 33 18 39 33 1 13 86 99 80 99 86 99

Putrescine 99 99 1 99 1 1 5 1 1 1 29 1 1 99 14 17

Succinate 99 99 99 99 99 91 99 99 99 99 86 99 99 99 86 99

Sucrose 99 80 1 8 99 99 3 33 1 25 99 1 1 86 99 83

Oxidase 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99

Agarolysis 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Resistance: 0/129 10g 60 1 25 67 1 9 29 99 1 63 14 1 1 1 57 99

0/129 150g 1 1 1 1 1 1 3 1 1 1 1 1 1 1 1 1

Ampicillin 10g 10 1 1 58 1 1 3 99 1 1 1 1 1 1 57 99

Novobiocin 5g 70 80 1 99 1 27 3 33 1 1 57 57 20 99 57 99

Carbenicillin 100g 20 1 1 1 33 1 18 99 1 1 1 1 1 1 71 99

Lysine decarboxylase 1 1 1 8 33 1 1 1 1 1 1 99 60 29 1 83Ornithine decarboxylase 1 1 1 1 1 1 1 1 1 1 1 99 1 29 1 99

Urease 1 1 1 1 33 1 1 1 1 1 1 1 1 14 1 1


34/35

Vibrionaceae


Data as % strains positive

Phenon

52

Phenon

15

Phenon

19

Phenon

20

Phenon

21

Phenon

24

Phenon

25

Phenon

26

Phenon

27

Phenon

29

Phenon

36

Phenon

41

Phenon

42

Phenon

43

Phenon

45

Phenon

46

Test No. strains 3 8 4 6 8 4 14 16 17 17 6 6 4 11 4 6


Acid: Arbutin 1 99 1 83 99 1 21 1 1 1 1 1 1 9 1 1

Mannitol 1 99 99 67 99 99 77 99 99 88 50 1 50 91 25 99

Salicin 1 1 1 99 99 1 57 1 1 99 1 1 1 27 1 1

Sucrose 1 99 99 99 99 99 99 99 99 12 1 99 99 82 25 1

Gentiobiose 1 86 1 83 99 25 57 1 1 1 1 1 1 9 1 1

Growth: 7% NaCl 99 63 25 83 99 99 43 99 88 88 50 83 75 91 25 99

10% NaCl 67 1 1 1 1 1 1 31 1 1 17 1 1 55 1 1

Amylase 67 63 99 99 99 99 99 93 94 99 67 99 99 73 50 99


Gelatinase 99 13 1 99 99 75 99 99 99 94 1 67 50 55 25 99Indole 1 99 99 99 88 1 93 99 99 99 50 33 1 91 25 99




NPS sulphatase 1 88 1 17 88 99 93 99 99 99 1 1 1 55 50 50



Acetate 67 38 75 99 88 99 57 99 88 99 99 99 50 73 99 99

Alanine 33 13 99 83 99 50 99 99 94 99 83 99 99 99 99 1

Citrate 33 88 99 83 99 50 99 99 99 94 99 67 75 91 99 1

Citrulline 1 1 25 40 88 1 1 99 1 99 50 67 25 55 1 1

Galactose 1 99 99 83 99 99 99 99 88 99 99 99 1 9 50 99

Gluconate 33 50 1 83 99 99 79 99 94 99 33 83 25 99 75 99

Glucosamine 67 99 99 99 99 99 99 99 94 99 99 1 99 99 99 99

Glucuronate 1 13 1 1 1 99 1 6 53 99 17 1 1 1 1 1

Glycerol 67 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99

Histidine 99 1 1 33 13 1 1 18 12 1 67 17 1 9 1 1


Hydroxyproline 33 1 1 99 1 1 1 1 1 1 1 83 1 18 1 1

DL-lactate 33 99 99 99 99 25 99 99 94 99 99 99 99 99 75 99

Lactose 1 1 25 1 1 1 1 1 6 6 1 1 1 1 1 1

Propionate 67 1 99 67 99 1 7 68 88 94 83 99 99 91 75 1

Putrescine 1 99 1 17 1 1 1 6 1 1 33 1 1 9 1 1Succinate 1 99 99 83 99 99 93 99 99 99 99 99 99 91 99 99

Sucrose 99 99 99 99 99 99 99 99 99 18 17 99 99 82 25 1

Oxidase 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99

Agarolysis 1 13 1 1 1 1 1 1 1 6 1 1 1 9 1 1

Resistance: 0/129 10 g 67 1 1 1 1 1 14 1 12 1 1 1 1 1 1 33

0/129 150 g 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

Ampicillin 10 g 33 1 1 1 1 1 1 1 1 1 1 99 75 9 25 1

Novobiocin 5 g 99 1 50 17 1 1 1 18 1 1 1 67 99 18 1 1

Carbenicillin 100 g 1 1 1 1 13 1 21 6 1 65 1 99 99 9 25 1



Urease 1 1 1 50 1 1 1 6 1 1 1 1 1 1 1 1


35/35

Vibrionaceae

Data as % strains positive Phenon

53

Phenon

57

Phenon

58

Phenon

59

Phenon

69

Phenon

83

Test No. strains 9 4 4 14 5 6

Arginine dihydrolase 11 99 25 1 80 99

Acid: Arbutin 1 1 1 1 1 1

Mannitol 99 99 99 1 99 1

Salicin 13 1 1 7 20 1

Sucrose 99 1 1 14 99 1

Gentiobiose 1 25 1 93 1 1

Growth: 7% NaCl 89 75 25 21 20 1

10% NaCl 11 1 1 1 1 1

Amylase 1 99 1 1 80 99

Voges Proskauer (Acetoin) 1 1 1 1 99 1

Gelatinase 11 75 1 21 1 99

Indole 99 75 1 7 99 1

IXP alkaline phosphatase 99 99 99 93 1 33PNPG -D-galactosidase 1 99 99 99 80 99

LGN -glutamyl transpeptidase 33 1 1 1 1 66

NPS sulphatase 44 99 50 99 20 16

Aesculin hydrolysis 56 50 1 93 1 1

Utilisation: -ketoglutarate 1 25 1 1 80 33

Acetate 99 50 50 7 99 99

Alanine 1 99 1 1 80 1

Citrate 89 75 99 99 99 50

Citrulline 1 1 1 1 1 1

Galactose 1 99 99 99 60 83

Gluconate 1 75 25 7 99 1

Glucosamine 99 99 99 99 20 99Glucuronate 44 75 1 1 1 1

Glycerol 44 99 99 99 99 99

Histidine 1 1 1 1 60 50

DL-3-hydroxybutyrate 89 1 1 1 60 1

Hydroxyproline 11 1 1 1 1 1

DL-lactate 99 75 1 1 60 99

Lactose 1 75 99 99 20 1

Propionate 99 1 1 1 40 1

Putrescine 1 1 1 1 99 1

Succinate 78 99 99 93 99 99

Sucrose 99 1 1 7 80 1

Oxidase 99 99 99 99 99 99

Agarolysis 1 1 1 1 1 1

Resistance: 0/129 10 g 89 1 1 1 40 1

0/129 150 g 1 1 1 1 1 1

Ampicillin 10 g 11 75 50 14 1 1

Novobiocin 5 g 89 1 1 1 50 1

Carbenicillin 100 g 11 99 99 71 1 1

Lysine decarboxylase 1 99 99 93 1 1

Ornithine decarboxylase 1 1 1 1 1 1

Urease 1 75 99 99 80 1

vibrios is

Documents