what is a genetically modified organism (gmo)? would you ever eat a gmo?
DESCRIPTION
What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?. A Genetically Modified Organism is a living thing whose DNA has been altered by humans. Transgenic Organisms (Genetically Modified Organisms). Transgenic Zebra Fish Reading - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/1.jpg)
What is a Genetically
Modified Organism (GMO)? Would you ever eat a GMO?
![Page 2: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/2.jpg)
A Genetically Modified Organism
is a living thing whose DNA has been altered by
humans.
![Page 3: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/3.jpg)
Transgenic Organisms (Genetically Modified Organisms)
![Page 4: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/4.jpg)
Transgenic Zebra Fish Reading
1. Actively read through quick article: Glowing Fish – First Genetically Modified Organism Available as a Pet
2. Class Discussion
![Page 5: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/5.jpg)
How will the world be different when
you are your parent’s age?
![Page 6: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/6.jpg)
JQ: If you could create a transgenic
glowing human, what would you
choose to trigger the human to glow?
![Page 7: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/7.jpg)
Transgenic Zebra Fish Reading
1. Zebra Fish vs. GloFish?2. Transgenic?3. Promotor?4. Creating Transgenic?5. Estrogen vs. Stress
Induced Promotors?6. Ethical Issues?7. Avatar?
![Page 8: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/8.jpg)
Using Glofish to study water pollution
Promoter: TATAGCTAGCC
DNA code before geneturns gene on or off
Normal Zebrafish DNA:AGTTATGACCTCATTCAGCGTATCT
Glofish Glows!ATCCTAGTATA
ATCCTAGTATA
AGTTATGACCTCATTCAGCGTATCTGlofish doesn’t glowATCCTAGTATAX X
![Page 9: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/9.jpg)
How Did Scientists Engineer the Transgenic Glowfish? It is called DNA Microinjection
Glo Gene: ATCCTAGTATA
DNA code for glowing protein
ATCCTAGTATA Normal Zebrafish DNA:
AGTTATGACCTCATTCAGCGTATCTTransgenic Glofish!
![Page 10: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/10.jpg)
Think back to the video
![Page 11: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/11.jpg)
Journal Question : Should humans be altering the DNA of
organisms?
![Page 12: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/12.jpg)
Nova: Harvest of Fear
Part 1 Part 2 Part 3 Part 4
![Page 13: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/13.jpg)
If you could choose which traits your baby will have,
would you do it? Explain.
![Page 15: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/15.jpg)
JQ: What are enzymes, and why are they so important for living
organisms? You need your textbook today.
![Page 16: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/16.jpg)
H2O + CO2 H2CO3
ReactantsProduct
What is an enzyme?Specialized proteins that speed up the rate of a chemical reaction by
lower its activation energy.
![Page 17: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/17.jpg)
Structure of an Enzyme• Active Site – for
attaching onto reactants aka substrates
• The chemical(s) that enzyme attaches to is called the substrate.
• Highly specific with what they bind onto.
• Lock and Key analogy
![Page 18: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/18.jpg)
Analogies for Enzymes
• Mentos and Diet coke
Active site? _______ Substrate? _______
• Stapler analogy Active site? _______ Substrate? _______
link
![Page 19: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/19.jpg)
Essential Concept: Enzymes are involved in almost every
cellular process, including DNA replication
Read pages 300 - 303 in your text book, and answer
questions 1, 2, 5 on pages 303
![Page 21: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/21.jpg)
What is DNA replication?
Replication is the process where DNA makes an exact copy of
itself. Why does DNA
replicate?
![Page 22: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/22.jpg)
Original DNA
Building Blocks for new DNA
(Nucleotides)
DNA Helicase (Protein)
DNA Polymerase
(Protein)
2 identical pieces of DNA
![Page 23: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/23.jpg)
DNA Replication Steps1. DNA Helicase (enzyme) splits open
double strand right through hydrogen bonds in the middle.
3. DNA Polymerase (enzyme) attaches free floating nucleotides to the open strands, making sure to proofread along the way.4. End product is two identical strands of DNA.
2. Binding Proteins holds two strands apart, so they don’t reattach to one another.
![Page 24: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/24.jpg)
Where do the free-floating nucleotides come from?
Link
![Page 25: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/25.jpg)
DNA Replication Play - Brainstorm1. What roles, or characters, will we need
to perform a play about DNA replication?
2. How will we form, or represent our DNA using people?
![Page 26: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/26.jpg)
How do the enzymes make all this happen?
In order to break a bond within a molecule, a certain amount of energy must be used.
Reactants
ActivationEnergy
ProductsGlucose & Galactose
C12H22O11 C6H12O6 + C6H12O6
![Page 27: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/27.jpg)
If you wanted that bond to break more easily, you would have to lower the amount
of energy it would require to break the bond. An enzyme can lower the “Activation
Energy” of a reaction
Reactants
ActivationEnergy
Products
Lactose
Glucose & Galactose
C12H22O11 C6H12O6 + C6H12O6
![Page 28: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/28.jpg)
Reactants
Products
AE w/o Enzyme
AE w/ Enzyme
Reaction pathway with enzyme
Reaction pathway w/o enzyme
![Page 29: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/29.jpg)
JQ: Why does your body sweat
& shiver? Okay I know what you will say, “to regulate body temperature.”
That is true, but why must you
do that?
![Page 30: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/30.jpg)
Enzymes Only Work in Specific Conditions
Enzymes need the right
conditions to work In extreme
conditions they Denature –
change shape and don’t work
![Page 31: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/31.jpg)
Toothpick Enzyme Activity
1. Read the Pre-Lab, and answer the pre-lab questions.
2. Read through the lab
3. Find a partner, and perform the lab
4. Clean up
5. Collect Class Data on Board
6. Answer Post-Lab Questions
![Page 32: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/32.jpg)
Class Data:Name Normal Cold
Average
Name Normal Denatured (taped)
Average
![Page 33: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/33.jpg)
Journal Question: What are three things that you are thankful for?
![Page 34: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/34.jpg)
H2 + O2 H2OReactants Products
Energy-Absorbing Reaction
Bonds are formed
Activation energy
Reactants
Products
Energy-Absorbing Reaction
![Page 35: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/35.jpg)
Potential Energy
•Energy at rest. Stored Energy.
![Page 36: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/36.jpg)
H2 + O2H2O
Reactants Products
Energy-Releasing Reaction
Bonds are broken
Decomposition
Energy-Releasing Reaction
Products
Activation energy
Reactants
![Page 37: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/37.jpg)
Kinetic Energy
•Energy in motion. Releasing energy.
![Page 38: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/38.jpg)
Lactase Post Lab Discussion
1. What happens when you alter the environment of an enzyme?
2. What happens when you alter the active site of an enzyme?
![Page 39: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/39.jpg)
HomeostasisNegative feedback systems &
positive feedback systems
![Page 40: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/40.jpg)
Welcome to the day you’ve been
preparing for all semester long.
You have 10 minutes to prepare for your
presentation.Please hand in the
presentation rubrics you were given.
Good Luck!-Romanoffski
![Page 41: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/41.jpg)
Why can’t scientists just
inject your arm today with glo-fish genes and
have you glow?
![Page 42: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/42.jpg)
Review DNA Model
1. Monomer & Polymer
2. Sides vs. Center3. Base pairing4. Hydrogen
Bonding5. # of DNA strands6. Antiparallel7. Helix8. Function9. Genes
![Page 43: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/43.jpg)
What does a typical day look like for a
cell?
When does a cell divide? Is it the same for every
cell?
![Page 44: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/44.jpg)
Cell Type Life Span Cell Division
Red Blood Cell Less than 120 days
NO
Skeletal Muscle Long-lived NOLining of
Esophagus2-3 days Yes
Stomach Cell 2 days YesNerve Cell Very Long
Lived??Most Do Not
Sperm Cell 2-4 days outside the
body
Yes
How long do certain cells live within your body?
![Page 45: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/45.jpg)
Let’s take a look at the
life cycle of a somatic cell!
![Page 46: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/46.jpg)
1.All body cells except sperm or egg cells
2. Somatic cells are Diploid Cell
What is a somatic cell?
![Page 47: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/47.jpg)
# of sets
# of DNA pieces in each set
What is a diploid cell?
![Page 48: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/48.jpg)
N = 23; 23 pieces from MOM & 23 from DAD
What would a human somatic cell look like?
![Page 49: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/49.jpg)
Dad’s & Mom’s Chromosomes are homologous – meaning they match up.
Dad’s Chromo.
Mom’s Chromo
Eye Color Gene
Blue EyesBrown
Eyes
What is unique about mom and dads chromosomes?
![Page 50: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/50.jpg)
JQ: Do you think humans will ever become immortal? Would you want to
live forever?
![Page 51: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/51.jpg)
Karyotype – shows an organism’s homologous chromosomes in order
How is this karyotype different from the first?
![Page 52: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/52.jpg)
JQ: No Journal Question today.
Hand in your Group’s Avatar Scientific Paper
![Page 53: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/53.jpg)
JQ: Why would our cells need to make more
of themselves? Give specific examples.
![Page 55: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/55.jpg)
What does the cell cycle look like?
Two Parts: 1. Interphase 2. m-phase
Cell Cycle Visual Non-Audio Version
M-phase
![Page 56: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/56.jpg)
Part 1: Interphase – Cell growth, DNA
replication and Preparation for
Division
![Page 57: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/57.jpg)
Part 2: M-phase – Division of Nucleus
& Cytoplasm
Mitosis is the division of the nucleus (DNA).
Cytokinesis is the division of the cytoplasm (cell).
![Page 58: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/58.jpg)
After Interphase? After
Mitosis?After
Cytokinesis?
M-phase
9246
46
4646
![Page 59: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/59.jpg)
•Animal cell – cell membrane pinches in forming a cleavage furrow = 2 new cells
How does cytokinesis work?
•Plant cell – cell plate (membrane & wall) forms between two cells = 2 new cells
![Page 60: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/60.jpg)
How long does it take to make a new cell?
![Page 61: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/61.jpg)
If Dr. Evil and mini me’s
cells are the same size, what make
them different?
![Page 62: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/62.jpg)
Large cells require too
many proteins to be made at
the same time. DNA
cannot keep up.
1. DNA Overload
![Page 63: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/63.jpg)
Big cells demand more nutrients
and produce more waste, but do not
have enough roadways to get the nutrients in and waste out
efficiently.
2. Supply and Demand Issues
![Page 64: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/64.jpg)
What could she grow up
to be? Explain.
![Page 65: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/65.jpg)
Stem Cells:Cells that haven’t turned into a specific cell type yet (they’re undifferentiated)
Once a stem cell becomes particular cell type (heart cell, liver cell, lung cell) it is called Differentiated
![Page 66: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/66.jpg)
All of the somatic cells in your body have the same DNA in them, and the same genes in them
Not all 20,000 genes are turned on at the same time maybe 5,000 at a time
Example: heart cell has different genes turned on than liver, muscle, or brain cell.
How does a stem cell turn into a specialized cell?
![Page 67: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/67.jpg)
Stem Cell Video
Stem Cells
![Page 68: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/68.jpg)
Please read the article and answer the questions to
follow
Cancer and Cell Phones
![Page 69: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/69.jpg)
JQ: What is Interphase? Recap what
occurs during interphase.(Take out
your homework)
![Page 70: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/70.jpg)
How does a cell know when to
divide? Every cell
contains proteins called cyclins
which monitors external and
internal activity, and communicate to cells when it is
time to make a new one.
![Page 71: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/71.jpg)
Cell Cycle! Making new
cells.
![Page 73: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/73.jpg)
P53
Cyclin & CDK the protein
supervisors of the cell cycle!
![Page 74: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/74.jpg)
JQ: Propose a way that we
can stop cancer. (Think outside the box. There are no silly
ideas)
![Page 75: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/75.jpg)
![Page 76: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/76.jpg)
Retinal Cancer
![Page 77: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/77.jpg)
Cancer is the uncontrolled cell
growth of abnormal cells in
the body.
What is cancer?
![Page 78: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/78.jpg)
How do cells become
abnormal?•Cyclin is a protein that turns the cell cycle on and off.
• If the gene for cyclin is mutated, or cell’s ability to respond to cyclin fails, cancer can occur
![Page 79: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/79.jpg)
How do cells become
abnormal?• DNA miscopying• Exposure to mutagens – agents that can mutate DNA
Examples: Food, UV Rays, Tobacco products, viruses, non-stick pans, chemical carcinogens, cell phones?
![Page 80: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/80.jpg)
mutation causes cell to lose its ability to start and
stop cell replication.Cyclin is Sleeping
![Page 81: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/81.jpg)
continual cell growth will lead to a
mass of cells called a tumor.
![Page 82: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/82.jpg)
What types of tumors exist?
![Page 83: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/83.jpg)
Fast growing and are likely to
spread to other parts of the body
and cause problems
(metastasize – when a tumor spreads)
Malignant Tumors
![Page 84: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/84.jpg)
Slow growing and do not
metastasize. ISOLATED
Benign Tumors
![Page 86: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/86.jpg)
![Page 87: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/87.jpg)
![Page 88: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/88.jpg)
![Page 89: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/89.jpg)
![Page 90: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/90.jpg)
![Page 91: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/91.jpg)
![Page 92: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/92.jpg)
![Page 93: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/93.jpg)
![Page 94: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/94.jpg)
![Page 95: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/95.jpg)
![Page 96: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/96.jpg)
![Page 97: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/97.jpg)
![Page 98: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/98.jpg)
![Page 99: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/99.jpg)
Cancer Treatment Activity:Cancer treatment has come a long way, but we still have
much more work to do as a species. Cancer is the leading cause of death worldwide
I will assign you and a partner one of the following treatments: Radiation, Chemotherapy, Targeted therapy, transplants, gene therapy
Using your smartphone/electronic device, access this website: http://www.cancer.gov/cancertopics/treatment/types-of-treatment
Write answers the following questions, and be prepared to explain them to the class next time. A few sentences for each.
1. What is your treatment?2. What does it do?3. How does it work?4. What are the side effects?5. Other important / interesting information?
![Page 100: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/100.jpg)
Please read the article and answer the questions to
follow
Cancer and Cell Phones
![Page 101: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/101.jpg)
If all of your diploid cells
have the same DNA in it, then what makes a
skin, heart, lung, and brain
cell so different?
Journal Question:
![Page 102: What is a Genetically Modified Organism (GMO)? Would you ever eat a GMO?](https://reader033.vdocuments.net/reader033/viewer/2022061505/56816452550346895dd61bff/html5/thumbnails/102.jpg)
JQ: If humans make 2.5x10^7 cells per minute, how many will they make in 1
hour? Place answer in scientific notation.