a simple method for site-directed mutagenesis using the polymerase

volume 17 Number 16 1989 Nucleic Acids Research

A simple method for site-directed mutagenesis using the pdymerase chain reaction

Anne Hemsley + , Norman Arnheim, Michael Dennis Toney1, Gino Cortopassi and David J.Galas*

Department of Molecular Biology, University of Southern California, Los Angeles, CA 90089-1340 and'Department of Biochemistry, University of California, Berkeley, CA 94720, USA

Received June 5, 1989; Revised and Accepted July 12, 1989

ABSTRACTWe have developed a general and simple method for directing specific sequence changes in a plasmidusing primed amplification by the polymerase chain reaction (PCR). The method is based on theamplification of the entire plasmid using primers that include the desired changes. The method israpid, simple in its execution, and requires only minute amounts of plasmid template DNA. It issignificant that there are no special requirements for appropriately placed restriction sites in the sequenceto be manipulated. In our system the yield of transformants was high and the fraction of them harboringplasmids with only the desired change was consistently about 80%. The generality of the methodshould make it useful for the direct alteration of most cloned genes. The only limitation may bethe total length of the plasmid to be manipulated. During the study we found that the Taq DNApolymerase used for PCR adds on a single extra base (usually an A) at the end of a large fractionof the newly synthesized chains. These had to be removed by the Klenow fragment of DNA polymeraseto insure restoration of the gene sequence.

INTRODUCTIONSite-directed mutagenesis is a powerful method that is commonly used in several areasof molecular biology and biochemistry. Early methods for site-directed mutagenesis usingsingle-stranded plasmids (or segments of plasmids ) gave low efficiencies of obtaining thedesired mutant sequences (1). Improvements which employ selection against the wild-typesequence (2,3) are costly in time and effort taken to isolate mutants. The developmentof the polymerase chain reaction (PCR) (4,5,6) however, has led to new approaches tosite-directed mutagenesis (7,8,9). These methods use primers which contain one or severalbases which differ from the wild-type sequence, which, after PCR, are then incorporatedinto the PCR product. This altered sequence is then cleaved with restriction enzymes andinserted in place of the wild-type sequence. This is a relatively time-consuming approach,and relies on the presence of conveniently located restriction sites flanking the wild-typesequence being mutated.

We present here a rapid approach to PCR based site-directed mutagenesis, using anadaptation of inverse PCR (10,11), whereby an entire circular plasmid is amplified anda mutation inserted anywhere in the plasmid with no requirement for convenient restrictionenzyme sites. In this technique, the initial rounds of amplification are directed by two primerslocated 'back-to-back' on the opposing DNA strands (see Figure 1.). One primer containsone or a few mismatches which will generate the site-directed mutation. The first cycleof PCR generates linear plasmid molecules, from one or both circular template strands.Subsequent rounds of PCR further amplify the linear plasmid sequence generated by thefirst PCR cycle, which is then isolated, ligated and used for transformation. This method

© IRL Press 6545

Downloaded from https://academic.oup.com/nar/article-abstract/17/16/6545/1074679by gueston 13 April 2018

Nucleic Acids Research

primer 1 lacZ

CTT A AC ACTCOCCT ATTO TTA A ACT GTOTCC TTTOTCO AT ACTOOT ACTA ATR51COT A AOOAATTOTGAOCOOATAACAATTTCACACAGOAAACAOCTATOACCATOATTAICJOCATTC

primerMtt Thr hWt IW Thr

I first rounds of PCRproduce linear template

lad Ap lacZ

prlm»r I primtr 2

Figure l.Schematk of the inverse PCR procedure. The expanded sequence shows the 'back-to-back' positionsof the two primers with respect to each other and the site of the introduced mutation (deletion of the boxed basepair) in the coding sequence of the lacZ alpha peptide.

has the advantage of introducing mutations at any desired site, independent of whetherrestriction sites are present in the surrounding sequence. In addition, the concentrationof the initial wild-type template after generation of the mutant plasmid PCR product isnegligible so that very few wild-type clones would be expected. We used the plasmidpBluescript II SK+ as a model system, since it offers a convenient visual detection systemto monitor introduced changes in the alpha peptide sequence of lacZ. (Fig. 1.) Figure 2shows the method in schematic form. The mutation we chose to introduce into the alphapeptide gene resulted in a frameshift (single base-pair deletion).

MATERIALS AND METHODSPrimer synthesisSynthetic oligonucleotide primers complementary to segments of the lacZ operator regionand alpha peptide coding sequence were prepared on an Applied Biosystems 381A DNA

6546



PCR

IKlenow Treatment end-flushing

Isolation of PCR product

5" end-phosphorylatlon\

Electrophoretic Isolation of mutant plasmid DNALlgatlon and transformation

Figure 2. Schematic summary of the steps involved in the construction of mutants.

synthesizer. Primers were constructed so as to lie 'back to back' on the duplex, with 5'ends apposing and 3' ends oriented for extension in opposite orientations around the plasmidcircle (see Fig. 1).

A pair of primers with sequences exactly complementary to the pBluescript II SK+

sequence were synthesized as a control to confirm that the amplification process was ableto faithfully regenerate the original sequence (designated wild-type primers, sequences5' TGAAATTGTTATCCGCTCAC 3' and 5'CACAGGAAACAGCTATGACCAT-GATTACGC 3'). In the experimental primer set, (designated mutant primers, sequences5' TGAAATTGTTATCCGCTCAC 3' and 5' CACAGGAAACAGCTATGACCA-TGATTAGC 3'), one primer has a deletion corresponding to the 14th nucleotide in thecoding region of the lacZ alpha peptide, designed to eliminate B-galactosidase activity.Template preparationThe DNA used as template for the PCR reaction was extracted from E.coli strain JM109transformed with pBluescript II SK+ (Stratagene stock preparation). Plasmid DNA wasisolated by a standard alkaline lysis mini-prep method (12).PCR conditionsTemplate DNA (10 fmol) and primer sets (1 /*M each) were incubated in a Perkin ElmerCetus Thermal Cycler in 100 /tl reaction volumes containing 100 mM Tris-HCl pH 8.3,500 mM KC1, 2.5 mM MgCl2, 100 /tg/ml gelatin, 0.2 mM of each dNTP and 2 unitsTaq polymerase (Perkin Elmer-Cetus)(6). The amplification proceeded through a cycleof denaturation at 94° C (1 min), annealing at 45° C (1 min) and primer extension at72° C (12 min) for a total of 25 cycles. Shorter extension times gave poor results forfull length amplification.Klenow treatment end-flushingTen microlher portions of the samples generated by PCR were analysed on a vertical agarosegel (1.2%) to determine the efficiency of the amplification. The remainder (90 /tl) from3 - 4 samples was pooled and the four dNTP'S were added to a final concentration of250 /tM each. Klenow fragment of E.coli polymerase I was added (20units) and the reactionmix was incubated at 37° C for 30 min. This step was necessary to avoid added basepairsat the ligation point (see results).DNA purification and 5' end-phosphorylationDouble stranded DNA was isolated from the PCR reaction mix using the standard protocolfor Geneclean DNA purification (Geneclean ™, BIO 101 Inc.) and phosphorylated at the

6547



kb

3.05

2.031 63

1.02

0.51

Figure 3. Agarose gel electrophoresis of PCR amplification products (lO^d of 100/J reaction mixes) using wild-type primers to regenerate unchanged pBluescript (lanes 3-5) and mutant primers to amplify plasmid DNAcontaining a frame-shift within the alpha-peptide of the lad gene (lanes 6-8) . Lane 2 shows an equivalent amountof a control product, where the same amount of template DNA was used to amplify a 1 kb fragment. PCR productsizes arc assessed against lkb DNA Ladder(BRL) (lane 1).

5' end by incubation with 15-20 units of T4 polynucleotide kinase (Amersham) in a 25/tl reaction volume containing 66 mM Tris-HCl, pH 7.6, 1 mM ATP, 1 mM spermidine-HC1, 10 mM MgCl2, 10 mM DTT, 0.2 mg/ml BSA (13).Isolation and ligation of the plasmid DNAThe phosphorylated DNA samples generated from the PCR reactions were then subjectedto electrophoresis in a low melting temperature agarose gel (1 % Seaplaque agarose). Theethidium bromide-stained bands of DNA corresponding to a size of 3kb were excised,heated to 65 CC, and 6 /tl samples were added to standard blunt-end ligation buffer andT4 DNA ligase (approximately 12 units, BRL) in a final volume of 10 /tl. The ligationmixes were incubated at 25°C for time periods ranging from 8 hours to overnight.TransformationThe ligation mix was reheated to 65 °C and 250 /tl of freshly prepared competent cells(strain NM522) were transformed by a standard procedure(14).

RESULTSPlasmid amplificationTo test the method, we used a small (2964 bp) cloning vector carrying the alpha peptidegene segment of B-galactosidase, a colorimetric indicator gene. We modified the usualPCR protocol as shown in Materials and Methods. Successful PCR amplification of the

6548



Table 1. Phenotypic and sequence analysis of the results of the directed mutagenesis protocol using wild-typeor mutant primers. OK indicates that the sequence observed

Primers

Wild typeMutantSequenced:

Mutation site

Ligation site

White colonies

79 ( 7%)1326 (97%)

2929 mutant

24 OK4 del.,1 +A

was the correct pBluescript sequence.

Blue colonies

1070 (93%)42 ( 3%)

75 wt.2 +G6 OK1 del.,

entire pBluescript II SK+ plasmid is shown in Figure 3. The other bands in each lanewere not characterized further, and undoubtedly resulted from the low temperature of primerannealing during PCR. The second lane of the gel shows amplification of a lkb segment(using a different primer pair) from the same plasmid as a control, giving some indicationof the relative efficiency of amplification.

The protocol used for the experiments described here is outlined in the diagram in theintroduction with the details provided in the Materials and Methods. In all cases it isnecessary to begin with only minute amounts of plasmid DNA prepared by a frequentlyused rapid 'mini-prep' procedure.Colony formationThe re-circularized products of the amplified plasmids were transformed by a standardprotocol with good yield of colonies. The control experiment, using wild-type primersto regenerate the original pBluescript plasmid generated 1149 colonies, 1070 (93%) ofwhich were blue, suggesting an unaltered lacZ sequence. Mutant primer amplificationgenerated 1368 colonies, 1326 (97%) of which were white, the preliminary diagnosticcriterion for successful insertion of the frameshift mutation into the lacZ alpha peptide.(See Table 1 ).Sequence dataThe nucleotide sequence of the region shown in the inset of Figure 1 was examined for36 colonies generated by using the mutant primers. Both white (29 colonies) and blue (7colonies) colonies were checked to assess the spectrum of alterations in nucleotide sequencewhich led to each phenotype. It was expected that only alterations introduced in the primerwould lead to a phenotypic change in the colony, since the point of ligation of the plasmidwas designed to lie outside of the coding region of the alpha peptide of lacZ in order thatchanges in sequence at the ligation point could easily be distinguished from changes atthe intended position of mutation. Results of the sequence analysis are shown in Table1. Of the 36 plasmid sequences examined, 30 (83%) restored the wild-type sequence atthe ligation point. Five out of the other six plasmids had small ( 1 - 8 bp) deletions at thesite of the ligation and one had an additional adenine (A) inserted at the ligation point.One possible explanation of the small deletions is that they are the result of incorporationinto the PCR product of a primer which was not synthesized to full length, as the primersused were not purified after synthesis.

In experiments without the Klenow fragment end-flushing step, the insertion of an extranucleotide at the ligation position was seen to occur at a much higher frequency; 73%of the 24 sequences examined (data not shown). It is interesting that the extra base pair

6549



was an A:T in all cases but one. This added base-pair at the ligation point was most likelydue to the non-templated addition of a base to the ends of the synthesized DNA by theTaq polymerase (15). In preliminary experiments, using a different primer-template system,we found that a large fraction of the PCR products had a single extra base present thatwas removed when the double-stranded product was treated with Klenow fragment asdescribed in the present protocol (data not shown).

All 29 white colonies produced using the mutant primers had the intended mutant sequencecorrectly inserted into the early coding region of the lacZ alpha peptide. The blue colonieshad two sequence variations; five of the seven were wild-type sequence, of unknown origin,while the other two had an additional nucleotide inserted in the primer region, restoringthe reading-frame to that of wild-type. This suggests a mutation made by slipped mispairingby the E.coli DNA polymerase, since a run of two guanine nucleotides (G's) was expandedto three.

DISCUSSIONIn this paper, we demonstrate that it is possible to generate linear fragments of at least3 kb in length, constituting an entire plasmid, using intact circular plasmid DNA as atemplate. We have further demonstrated that it is a simple matter then to site-direct changesin the sequence. The level of efficiency of amplification is less than that observed whensmaller fragments are amplified, however sufficient DNA is synthesized for subsequentligation and transformation procedures. Based on the data obtained from analysis of 29candidate colonies, insertion of the desired mutation and exact reconstitution of the plasmid,occurs at a frequency of 82%. The desired mutation is inserted at a frequency of about95 %, so that improvements in procedures to reconstitute the ligation site might enhancethe overall efficiency.

This procedure is consistently efficient, rapid (mutant colonies can be generated in twoto three days) and generates substantial numbers of transformants. An additional advantageis that it does not require highly purified DNA as die template for the PCR reaction andthere are no special requirements for the plasmid preparation. It should also be possibleto use plasmids liberated from small numbers of bacterial cells taken directly from plates,which would further shorten the procedure. We suspect that open circular plasmid providesthe best template for inverse PCR, since it was observed that template derived fromminipreps was actually a better substrate for PCR amplification than was highly purified,supercoiled plasmid (data not shown).

The relatively long PCR extension times we used for efficient elongation of the 3 kbDNA fragment (12 min.) could have affected the frequency of non-template-directednucleotide addition at the 3' ends of the molecules. Removal of these nucleotides can beeffected by a brief treatment with Klenow treatment of the PCR reaction under the conditionsdescribed in the Materials and Methods section.

The mutations generated in this study were localized to the lacZ gene to permit a simplevisual assay of successful mutagenesis. The independence of this method on the proximityof unique restriction sites makes it a convenient and rapid method whereby mutations maybe introduced at any site wimin any circular DNA molecule at an extremely high mutantto wild-type ratio. At the present time, it is conceivable that plasmids up to 10kb in lengthcould be used in our system (16).

6550



ACKNOWLEDGEMENTS.This work was supported by NIH grants AI19036 to D.J.G. and GM36745 to N.A.

•To whom correspondence should be addressed

+Presenl address: Department of Biological Sciences, University of California, Santa Barbara, CA 93106,USA

REFERENCES1. Derbyshire, K.M., Salvo, J J., Grindley, N.D.F. (1986) Gene 46, 145-152.2. Kramer, W., Drutsa, V., Jansen, H.W., Kramer, B., Pflugfelder, M., Fritz,H-J. (1984) Nuc. Acids Res.

12, 9441-9456.3. Taylor, J.W., Ott, J., Eckstein, F. (1985) Nuc. Acids Res. 13, 8765-8785.4. Saiki, R.K., Gelfland.D.H., Stoffel, S., Scharf.S.J., Higuchi, R., Hom.G.T., Erlich, (1988) Science 239,

487-489.5. Saiki, R.K., Scharf, S., Faloona, F., MuUis, K.B., Horn, G., Erlich, H.A., Amheim, (1985) Science 230,

1350-1354.6. Mullis, K.B. and Fakoona, F.A. (1987) Methods in Enzymology 155, 335-350.7. Higuchi,R., Krummel, B., Saiki, R.K. (1988) Nuc. Acids Res. 16, 7351-7367.8. Kadowaki, H., Kadowaki, T., Wondisford, F.E., Taylor, S.I. (1989) Gene 76, 161-166.9. Valette, F., Mege, E., Reiss, A., Adesink, M. (1989) Nuc. Acids Res. 17, 723-733.

10. Triglia, T., Gregory Peterson, M., Kemp, D.J. (1988) Nuc. Acids Res.16, 8186.11. Ochman, H., Gerber, A.S., Haiti, D.L.(1988) Genetics 120, p621-623.12. Birnboim, H.C. and Doly, J. (1979) Nuc. Acids Res. 7, 1513-1518.13. Wu, W.R., Wu, T., Anurhada, R. (1987) Methods in Enzymology 152, 343-350.14. Maniatis, T., Fritsch, E.F., Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring

Harbor Laboratory, Cold Spring Harbor, New York.15. Clark, J.M. (1988) Nuc. Acids Res. 16, 9677-9686.16. Jeffreys, A.J. Wilson, V. Neumann.R. and Keyte, J. (1988) Nuc. Acids Res. 16, 10953-10971.

This article, submitted on disc, has been automaticallyconverted into this typeset format by the publisher.

6551


a simple method for site-directed mutagenesis using the polymerase

Documents