allelic sequence variations in the hypervariable region of a t-cell receptor β chain: correlation...

Allelic Sequence Variations in the Hypervariable Region of a T-Cell Receptor βChain:Correlation with Restriction Fragment Length Polymorphism in Human Families andPopulationsAuthor(s): M. A. RobinsonSource: Proceedings of the National Academy of Sciences of the United States of America,Vol. 86, No. 23 (Dec. 1, 1989), pp. 9422-9426Published by: National Academy of SciencesStable URL: http://www.jstor.org/stable/35094 .

Accessed: 01/05/2014 14:00

Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .http://www.jstor.org/page/info/about/policies/terms.jsp

.JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range ofcontent in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new formsof scholarship. For more information about JSTOR, please contact [email protected].

.

National Academy of Sciences is collaborating with JSTOR to digitize, preserve and extend access toProceedings of the National Academy of Sciences of the United States of America.

http://www.jstor.org

This content downloaded from 62.122.73.26 on Thu, 1 May 2014 14:00:07 PMAll use subject to JSTOR Terms and Conditions

http://www.jstor.org/action/showPublisher?publisherCode=nas

http://www.jstor.org/stable/35094?origin=JSTOR-pdf

http://www.jstor.org/page/info/about/policies/terms.jsp


Proc. Natl. Acad. Sci. USA Vol. 86, pp. 9422-9426, December 1989 Genetics

Allelic sequence variations in the hypervariable region of a T-cell receptor p3 chain: Correlation with restriction fragment length polymorphism in human families and populations

(T-cell antigen receptor/genetic variation/family studies)

M. A. ROBINSON

Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases, Building 4, Room 213, Bethesda, MD 20892

Communicated by D. Bernard Amos, August 25, 1989 (receivedfor review July 30, 1989)

ABSTRACT Direct sequence analysis of the human T-cell antigen receptor (TCR) V1l variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR f3 chain, a position predicted to be in the TCR antigen binding site. The V1l polymorphism was found by DNA sequence analysis of V1l genes from seven unrelated individuals; Vpl genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determine the inheritance patterns of the Vp1l substitution and to test correlation with Vp, restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the Vp, substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations.

Heritable variations in T-cell antigen receptor (TCR) genes may play a particularly important role in determining the TCR repertoire, because somatic mutation does not appear to be a mechanism for generating TCR diversity (1). A number of sequences are now available for TCR a- and ,-chain variable (V) regions, and comparison of these reported sequences reveals several levels of variation (2-4). Sequences with >50% identity are considered to be in the same subgroup (5) and groups of those with >75% identity are designated families (3, 4). Sequences have also been reported that differ by only a few residues. These may derive from different V gene loci within a family or, alternatively, may represent different alleles of the same locus.

The relationship between sequence variations in TCR V regions and T-cell function is under investigation. Structural models of TCR molecules have been proposed based upon sequence homology with immunoglobulins and the known crystal structure of immunoglobulin molecules (5-7). Resi- dues that form the antigen binding site localize to three areas: two are encoded within the V gene segment and the third is generated by combinatorial and junctional mechanisms dur- ing assembly of V, diversity (D; found in /3, chains only to date), and joining (J) gene segments (5-7).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. ?1734 solely to indicate this fact.

Genetic polymorphism in TCR V genes has been detected by restriction fragment length polymorphism (RFLP) (8-11). However, no correlations between RFLP and sequence variations in coding regions have been reported. In the present study, allelic variations in the human TCR V01 gene have been characterized by a method that allows direct sequence comparisons. A polymorphism consisting of a single base-pair change was observed and a method was developed to follow inheritance of this substitution.* The substitution showed a close, but not absolute, correlation with RFLP detected with a Vp1 probe.

MATERIALS AND METHODS Southern Blot Analysis. Southern blots were prepared (8)

using DNA samples prepared from B-lymphoblastoid cell lines or from peripheral blood lymphocytes. The probe was derived from a genomic clone of a rearranged human TCR V,p1 gene (12, 13) provided by T. Rabbitts (Medical Research Council, Cambridge, England). A 780-base-pair (bp) EcoRI- Sac I fragment containing V-region sequences in the absence of D- or J-region sequences was used as the Vp1 probe.

Amplification of Genomic DNA. The V,81 was amplified from genomic DNA samples by the polymerase chain reaction (PCR) procedure (14, 15) using oligodeoxynucleotide primers V,s1.5 (5'-CGCAAGCTTGTCTCCTGGGAGCAGG- 3') and V1.3 (5'-CGCAAGCCTTCTGGCACAGAAATAC- 3'). Reaction mixtures (100 ul) containing DNA (1 mg), oligonucleotide primers (1 mM), dNTPs (200 mM), 10 mM Tris HCl (pH 8.4), 50 mM KCI, 2.5 mM MgCl2, 200 mg of gelatin per ml, and 2 units of the DNA polymerase from Thermus aquaticus (Cetus) were subjected to 25 cycles of 94?C for 30 sec, 55?C for 1 min, and 72?C for 2 min.

Cloning and Sequencing of PCR-Amplified DNA Samples. PCR-amplified DNA samples were cloned into M13mpl8 for sequence analysis (16). Samples were extracted with chlo- roform and precipitated with ethanol. Resuspended DNA samples were digested with HindIII to cut restriction sites in the oligonucleotide primers, extracted with phenol and chlo- roform, and desalted using a Centricon 30 filter (Amicon). PCR-derived inserts were ligated into the HindIII site of M13mpl8 (17). Clones containing Vs1 inserts were identified by hybridization with the V,81 probe. Sequences were determined by the dideoxy chain-termination method (18) with Sequenase (United States Biochemical) and the M13 univer- sal primer or the M13 reverse primer (Synthecell). Sequence variations were confirmed by obtaining identical sequences from a minimum of two clones derived from DNA samples

Abbreviations: TCR, T-cell antigen receptor; V, variable; D, diversity; J, joining; RFLP, restriction fragment length polymorphism; PCR, polymerase chain reaction; ASO, allele-specific oligonucleotide. *The sequences reported in this paper have been deposited in the GenBank data base (accession nos. M27904, M27912).

9422



Genetics: Robinson Proc. Natl. Acad. Sci. USA 86 (1989) 9423

amplified on two separate occasions and were verified by hybridization with allele-specific oligonucleotide (ASO) probes or by restriction enzyme digestion.

DNA Dot Blots. Ten microliters of the reaction mixture containing amplified genomic DNA was dotted onto nitrocellulose, denatured for 5 min in 0.2 M NaOH/0.6 M NaCI, neutralized for 5 min in 0.5 M Tris HCI, pH 7.6/0.6 M NaCI, washed in 2 x SSC (1 x is 0.15 M NaCl/15 mM sodium citrate, pH 7), dried, and baked for 2 hr at 80?C under vacuum. Dot blots were prehybridized overnight at room temperature in 6x SSC containing 5 x Denhardt's solution (1 x is 0.02% Ficoll/0.02% polyvinylpyrrolidone/0.02% bovine serum albumin), 0.05% sodium pyrophosphate, 100 ,ug of salmon sperm DNA per ml, and 0.5% SDS (19).

Oligonucleotide Probes. ASOs 308A (5'-CATTATAATAT- TGAATGAGG-3'), 308C (5'-CATTATAATAGTGAAT- GAGG-3'), and 308G (5'-CATTATAATACTGAATGAGG- 3') were labeled using [^y-32PIATP and polynucleotide kinase, and unincorporated nucleotides were removed using a NACS Prepac column (Bethesda Research Laboratories). Hybrid- ization was performed overnight at room temperature in 6x SSC/lx Denhardt's solution/0.05% sodium pyrophosphate containing 100 ,ug of yeast tRNA per ml. Blots were washed in 6x SSC at room temperature twice for 20 min and at 53?C once for 10 min (19). The blots were exposed to Kodak X-Omat film for 20 hr at room temperature.

RESULTS V,l RFLPs. Southern blot analyses using the V1 probe

have revealed that the V,1 gene is present in a single copy (10); a single band is observed on blots of DNA samples digested with the majority of restriction enzymes. Additional bands are detected on blots under reduced stringency conditions (data not shown), suggesting the presence of other, closely related sequences. RFLPs associated with V,81 are revealed with the restriction enzymes Taq I and Pvu II (Fig. 1); two allelic forms of the V,61 gene are observed with Taq I [allele 1 (VO,Tql), -4.1 kb, and allele 2 (V31Tq2), =3.6 kb] and with Pvu II [allele 1 (V,01Pv1), -4.8 kb, and allele 2 (V,01- Pv2), 4.0 kbJ. One allelic form of each gene was observed to predominate in the population studied. Gene frequencies for the various alleles, determined by testing 70 unrelated individuals, are 17.9% for VB,Tql, 82.1% for VgTq2, 12.9% for V,81Pv1, and 87.1% for VO1Pv2.

When DNA samples from individuals heterozygous for the polymorphic markers Tql/Tq2 and/or Pvl/Pv2 are digested with both Taq I and Pvu II, a single fragment of 3.2 kb is detected (Fig. 1), indicating that invariant Taq I and Pvu II sites flank the V61 gene and that the polymorphic Taq I and Pvu II sites are located on opposite sides of the V,61 gene and are separated by ~4.4 kb. A map of the V1 gene deduced from these analyses is shown in Fig. 1. The precise location of the V01 gene within this fragment and its 5'--3' orientation are unknown.

Sequence Variations in Allelic VB1 Genes. In order to determine whether V61 RFLP correlated with sequence variations in the V,61 coding region, sequence analyses of the V'01 gene from different individuals were performed. DNA samples from seven individuals positive for different combinations of the Taq I and Pvu II allelic forms of the V,91 gene were amplified by PCR, amplified fragments were cloned, and DNA sequences were determined. The sequences of oligonucleotides to be used as primers were determined from published sequences (12, 13). The 5'-end primer derived from leader sequences and the 3'-end primer corresponded to the 3t end of the V-region gene segment. Thus, the fragment amplified by using these primers included a portion of the leader exon (16 bp), an intron (132 bp), and the complete exon

A B C

P P P T T P T T P T T P

~~~~~~~~~~~~~~~~~~~~~~~..... ..... ,

.. . .e. ..

T q .,j.,,,,.,.,, i1 .i i, . ........

ML "4 Pv1

Tq1 . I > v

Tq2 -... ....

V1~~~k

FIG. 1. Southern blot of DNA samples from three unrelated individuals (A-C). Samples were digested with Taq I, (T), Pvu 11 (P), or both and hybridized with the Va1 probe. Individual A is heterozygous for V31Tq1/Tq2 and VX31Pv1/Pv2, individual B is heterozy- gOulS for Vl1Tq1/Tq2 and homozygous for V13Pv2, and individual C is homozygous for Vp1lTq2 and heterozygous for Vp1Pvl/Pv2. Ar- rowheads at left mark fragments of A phage DNA digested with HindIII [23.5, 9.7, 6.6, 4.3, 2.2, and 2.1 kilobases (kb)]. Below the autoradiogram is a map of PvP It and Taq I restriction sites flanking the VF gene deduced from the Southern blotting analysis. Stars mark polymorphic restricton sites. The precise location and the 5PIP3' orientation of the Vy 1 gen re a unknown.

encoding the V gene segment (284 bp). Sequences flanking the intron conform to canonical splice signal sequences (20).

Sequence data were obtained on clones derived from seven unrelated individuals Clones derived from these individuals had sequences in the coding region that were identical to reported cDNA sequences (12, 13). In addition, a second coding-region sequence was obtained on clones from five individuals; a single base-pair substitution of a cytosine for a guanine (C/G) was observed at position 308 of the fragment amplified (Fig. 2). This change would result in substitution of a histidine (tAC) for the glutamine (GAG) at position 48 of the TCR on chain. Among the six sequences reported for the V-region gene segment of the V1 gene, one clone was fouend to contain a substitution of an adenine at the same position (308 of the amplified fragment) as the substitution observed here (13). No other sequence variations within the V gene segment of Vc s have been reported.

One additional sequence diffrence was observed in the PCR-amplified fragment. A single base substitution (A/G) was observed within the intron at position 41 of the PCR- amplified fragment (41A/41G) in clones derived from two individuals. In both cases there was a correlation between 41G and 308C substitutions. The 41G substitution creates a new AIu I restriction site (AGCT) within a 394-bp Alu I fragment, resulting in fragments of 35 bp and 359 bp. Am- plified DNA samples from the seven individuals for whom there was sequence data were digested with Aiu I and separated on an agarose gel DNA samples from all tndivid- uals had an AIa I fragment of 394 bp corresponding to a 41A Vp3i gene, and DNA from the two individuals with 41G also



9424 Genetics: Robinson Proc. Natl. Acad. Sci. USA 86 (1989)

CysLeuLeuGlyAlaG CGCAAGCTTGTCTCCTGGGAGCAGGTGAGTCCTGGGCACAACTTGAAAGTCTCCGATCTTCATTTCTTGTCCCTGAAATGCATGTGGGCCA

lyProValAspSerGlyVal ThrGin ACGATGGCTTCAGCAGGAGGCTTTCTTCTGTGCCTTATGGTTAACTTTTGTCTTCTGACACACAGGCCCAGTGGATTCTGGAGTCACACAA

ThrProLysHi sLe uIl e ThrAla ThrGlyGlnArgVal ThrLe uArgCysSerProArgSerGlyAspLeuSerVal TyrTrpTyrGln G ACCCCAAAGCACCTGATCACAGCAACTGGACAGCGAGTGACGCTGAGATGCTCCCCTAGGTCTGGAGACCTCTCTGTGTACTGGTACCAAC

lnSerLeuAspGlnGlyLeuGlnPheLeulleG1nTyrTyrAsnGlyGl uGluArgAlaLysGlyAsnIleLeuGl uAArgPheSerAlaGI AGAGCCTGGACCAGGGCCTCCAGTTCCTCATTCAGTATTATAATGGAGAAGAGAGAGCAAAAGGAAACATTCTTGAACGATTCTCCGCACA

C His

nGlnPheProAspLeuHisSerGC uLeuAsnLeuSerSerLeuGluLeuGlyAspSerAlaLeuTyrPheCysAla ACAGTTCCCTGACTTGCACTCTGAACTAAACCTGAGCTCTCTGGAGCTGGGGGACTCAGCTTTGTATTTCTGTGCCAGAAGCTTGCG

FIG. 2. Nucleotide sequence and amino acid translation of the V1 gene, including 16 bp of the leader exon, 132 bp of intron, and 284 bp of the V gene segment of the Vg1 gene. The V,01 gene was amplified by PCR with the underlined oligonucleotide primers and then cloned into M13mp18. Each primer includes a HindIll site for cloning and three additional bases that do not correspond to V81 gene sequences. A single base substitution (C/G) was seen at position 308 of the amplified fragment, which would result in an amino acid substitution.

had Alu I fragments of 35 bp and 359 bp (data not shown). The functional significance of the 41A/41G substitution, which is located within an intron, is not apparent.

Clones containing a cytosine at position 308 were found only in DNA samples from individuals positive for alleles Tql and/or Pvl; thus, there appeared to be a correlation between Tql, Pvl, and a cytosine at position 308. To characterize a number of individuals for the Vl sequence variation at position 308, ASO probes were prepared to hybridize with the region spanning the substitutions; these were designated 308A, 308C, and 308G corresponding to the nucleotide at position 308. The probes were used to type V61 genes after amplification by PCR and transfer to nitrocellulose.

Family Studies. Segregation analyses of V,61 RFLPs and characterization of the nucleotide present at residue 308 by the use of ASO probes make it possible to search for correlations between V01 RFLPs and the sequence within the Vgl coding region at nucleotide 308. Six families in which polymorphic forms of the V131 gene were observed to segre- gate were tested with ASO probes, and the results obtained for two families are illustrated in Fig. 3. In family 2 the father is homozygous for Pv2 and Tq2 and the mother is heterozygous for Pv1/2 and Tq1/2. Inheritance of the maternal Pvl and Tql alleles by the children S2, S4, S5, and S6 indicates that both markers are encoded by the same maternal haplotype. DNA samples from all family members hybridize with the 308G probe, and DNA samples from the mother and children S4, S4, S5, and S6 hybridize with the 308C probe.

Therefore, in family 2 the maternal haplotype positive for both Pvl and Tql is also positive for 308C. The other maternal haplotype and the two paternal haplotypes are positive for Pv2, Tq2, and 308G.

In family 753 both parents are heterozygous for Tql/2, the mother is heterozygous for Pv1/2, and the father is homozygous for Pv2. DNA samples from both parents hybridize with ASO probes 308C and 308G, and hybridization patterns of DNA from the children make it possible to determine the combination of markers in each haplotype. Children S3 and S5 are homozygous for a Vl gene with 308C, children Si, S2, and S6 are homozygous for 308G; and child S4 is heterozygous for 308C and 308G. The maternal Pvl/Tql haplotype and the paternal Pv2/Tql haplotype are positive for 308C. In addition, both parents have a haplotype positive for Pv2, Tq2, and 308G.

Similar studies were performed on the remaining four families. Tql and/or Pvl markers were carried by one parent (three families) or both parents (one family) and segregated in the offspring. The 308C sequence was found to be carried on haplotypes that are Pvl/Tq2-positive, haplotypes that are Pv2/Tql-positive, or haplotypes that are both Pvl/Tql- positive. Thus, haplotypes that were positive for either Pvl or Tql were also positive for 308C in the families studied. Because Pvl and Tql markers were not always found together in the same haplotype, the correlation between 308C and Pvl and between 308C and Tql was not absolute.

Family 2 Family 753

FA MO Si S2 S3 S4 S5 S6 S7 FA MO Si S2 S3 S4 S5 S6 Enzyme Probe

Pvu 11 V _

...* . ....,.... -...

Taq I - 4W . 0 . ' V[i1

*Mr .. . 308C ! . * 0

308G 4 W#1 , *

FIG. 3. Southern blots hybridized with the Vg31 probe and dot blots of amplified DNA samples hybridized with ASO probes as designated. DNA samples were from the members of family 2 and family 753. DNA donors are identified above lanes: father (FA), mother (MO), and siblings (S1-S7). The enzyme used to digest DNA samples is indicated at left. Arrowheads mark the 4.3-kb fragment of A DNA digested with Hindlll.



Genetics: Robinson Proc. Natl. Acad. Sci. USA 86 (1989) 9425

Taqi digested DNA

DNA Donor D E F FIG. 4. (Left) Southern blot of DNA from an

Allele Gel fragment Gel fragment 1 2 1 2 1 2 individual heterozygous fr Vp1Tql/Tq2. DNA n Probe 308C : ^ : was digested with Taq I and hybridized with the V6

Tql Prb J 1 probe. Allele designations are indicated beside the Tq2- ] 2 bands. Brackets indicate the approximate regions

308G * ,t'. * ''" *' excised from the gel for elution. Arrowheads mark 6.6-, 4.3-, 2.2-, and 2.1-kb HindIII fragments of A DNA. (Right) Dot blots of DNA samples from donors D, E, and F, who are heterozygous for V?1Tql/Tq2, that were excised from gels (regions 1 and 2) and amplified by the PCR. Blots were hybridized with ASO probe 308C or 308G as indicated.

Size Selection of Pvu II or Taq I-Digested DNA Samples. To determine the sequence of the V,61 gene carried on different polymorphic restriction fragments, DNA samples from individuals heterozygous for Pv1/2 or Tql/2 were digested with Pvu II or Taq I and fragments were separated in preparative agarose gels. Sections of the agarose gel corresponding to the size of the polymorphic restriction fragments were excised and the DNA was eluted, amplified by PCR, and characterized using the oligonucleotide probes. As shown in Fig. 4, for three different individuals, DNA extracted from the gel section that corresponds to the Tql allele (fragment 1) carries only a cytosine at position 308, and that corresponding to the Tq2 allele (fragment 2) carries a guanine at position 308.

Similar studies of Pvu TI-digested DNA samples produced comparable results. DNA extracted from the gel in the size range of the Pvl allele hybridized with the probe 308C and DNA approximately the size of the fragment corresponding to the Pv2 allele hybridized with the probe 308G. These studies further support the correlation between alleles Tql and Pvl with a cytosine at position 308.

Population Studies. DNA samples from 70 unrelated individuals were characterized for V01 Taq I and Pvu II RFLPs and were typed for the nucleotide at position 308 (Fig. 5). Forty-five of the individuals tested were homozygous for Pv2, 308G, and Tq2 (2-G-2). Among the group of individuals heterozygous for Pv1/2, Tq1/2, and 308G/C, complete Vp1 haplotypes could be assigned to 5 of 14 individuals. All 5 individuals had haplotypes of 2-G-2 and 1-C-i. The 1-C-i haplotype was observed in 2 additional individuals, one homozygote and one heterozygote, making 1-C-i the second most frequently observed haplotype (n = 7). There is an absolute correlation among three markers [Pvl/308C/Tql (1-C-I) and Pv2/308G/Tq2 (2-G-2)] in these most prevalent haplotypes. There are, however, exceptions to the correlation in 10 individuals. The exceptions include haplotypes where Pv2 and 308C are found together (2-C-1 and 2-C-2), where Tql and 308G are found together (2-G-1), and where

Pvl Pvl Pv1 Pv1/2 Pv1/2 Pv1/2 Pv2 Pv2 Pv2 Tql Tql/2 Tq2 Tql Tq112 Tq2 Tql Tql/2 Tq2

GIG 45 . . j | U 4

GlC , - 1 4 t 1 5 2

C/C 1 j _ 1 _ 1 1

FIG. 5. Combinations of three V,01 markers in 70 unrelated individuals RFLP markers are shown at the top, and the nucleotide at position 308, 308C/308G is shown at left. Numbers of individuals with particular phenotypes are indicated in boxes. A dash indicates that no individuals of that phenotype were observed.

Tq2 and 308C are found together (1-C-2 and 2-C-2). Haplo- types that included both the Pvl allele and a guanine a position 308 (1-G-1 and 1-G-2) were the only exceptions not observed in the group of 70 individuals studied.

DISCUSSION The present study supports and extends previous reports concerning polymorphism of TCR Vi genes (9-11). Limited polymorphism has been observed by Southern blot analyses using probes that correspond to TCR Vp gene segments. In general, few restriction enzymes reveal RFLPs that can be detected with individual TCR Vp probes, and the majority of systems described have only two allelic forms even in diverse populations. Although there are certain TCR Vp gene probes that detect polymorphism in DNA samples digested with several different restriction enzymes, most examples involve Vp genes that are members of a Vp family with several members. In such cases it is unclear whether the RFLPs are associated with one Vp gene or with different gene segments from the same Vp family. Taken together, these observations suggest that there is a high degree of sequence conservation within the TCR p-chain gene complex.

The present data indicate that the sequence of the V91 gene is highly conserved both in coding and in flanking regions. Intron sequences appeared to be conserved; a single base- pair substitution was found in noncoding regions of the PCR fragment in 2 of 7 individuals. In the present study, comparison of Vpl gene sequences from multiple clones derived from 7 unrelated individuals and 6 previously reported V01 cDNA sequences revealed a single position within the coding region where substitutions occur (12, 13). In addition to the C/G interchange observed in the present report, a sequence with an A/G substitution at the identical position was previously reported for a cDNA clone (13). In the present study of 70 individuals, none were positive for 308A, suggesting that this substitution is rare. Substitution of an adenine for the most frequently observed base at 308, guanine, would be a silent mutation (CAA, glutamine). The substitution of a cytosine at position 308 results in an amino acid change from a neutral glutamine (CAG) to a positively charged histidine (CAC). Based upon a structural model of the TCR, there is reason to believe that this single base substitution in the Vp1 gene may be functionally significant.

Because of amino acid similarities between immunoglobulin (Ig) and TCR molecules, it has been possible to construct structural models of the TCR based on the known Ig crystal structure (5-7). Key residues conserved in Ig and TCR chains are predicted to result in similar p-pleated-sheet framework structures. Three areas of high residue variability in TCR V regions correspond in size and location to the three hypervariable regions in Ig V regions that form the antigen binding site. The variable amino acid in V,91 at position 48 is located



9426 Genetics: Robinson Proc. Natl. Acad. Sci. USA 86 (1989)

in a region predicted to comprise part of the antigen binding site. Models of the TCR predict that the third hypervariable loop (corresponding to the D and J gene segments), where there is the greatest sequence variation due to combinatorial and joining mechanisms, interacts with antigen whereas the other two variable loops interact with major histocompati- bility complex (MHC)-encoded proteins. The loop including amino acid 48 would then be predicted to interact with MHC products. The substitution of a positively charged histidine for a neutral' glutamine represents a potentially significant alteration that may have an impact upon the MHC specific- ities recognized by T cells bearing variants of Vo1.

In a previous report (9), the inheritance of one TCR p-chain constant-region RFLP and two V1-region RFLPs was examined in families to characterize'the markers present in haplotypes. Eight possible distinct haplotypes can result from different combinations of the three markers, and seven combinations were observed in the parents of the eight families studied. In an extension of these studies, the two V1p RFLP were examined in the same eight families. When all five markers were considered, 11 haplotypes could be dis- tinguished (data not shown). One explanation for the degree of heterogeneity observed in the combination of markers found together in TCR p haplotypes is that recombination events have occurred with some frequency (9) within 600-700 kb of the TCR , gene complex (21, 22). It is, however, more difficult to envision that simple recombination events are responsible for the degree of polymorphism observed here in the 4.4-kb region flanking the Vo1 gene, particularly in light of the high degree of primary sequence conservation.

There is considerable heterogeneity in the combinations of allelic forms of three closely linked markers associated with the Vl31 gene even though they are located within a distance of only -4.4 kb. Eight combinations of the three markers are possible, and among the group of 70 individuals studied, six combinations were observed. The most frequently observed combination of the three markers is Pv2/308G/Tq2 (2-G-2) and the sec'ond most frequently observed haplotype is Pvl/ 308C/Tql (1-C-1). To derive all observed haplotypes by recombination events, multiple independent crossovers would have been necessary. For example, if it is assumed that the most frequently observed haplotypes are founder haplotypes (1-C-1 and 2-G-2), two separate recombination events would be required to derive a 2-C-2 haplotype. Therefore, it seems possible that other mechanisms, perhaps gene con- version-like events, may be operative in the TCR ,B gene complex to generate diversity in closely linked markers.

Regardless of the genetic basis for the observed combinations of markers found in a TCR p haplotype, these observations impact directly upon use of the RFLP markers in TCR-disease association studies. RFLP markers may not correlate absolutely with sequence variations within coding regions as illustrated by the present example. Although the three markers are in close proximity to one another, neither RFLP correlates absolutely with the Vo1 coding-region substitution. Assuming that Pvl correlates with 308C, examination of only Pvu II RFLP would result in the incorrect characterization of 9 of 70 individuals. With the same as- sumption for Tql, 4 of 70 individuals would have been incorrectly typed. Therefore, examination of these RFLP markers in unrelated individuals for associations with a disease or functional characteristic has the potential of being seriously misleading.

There are several approaches to resolve the potential problems that may be encountered in TCR-disease or TCR- function associations. One approach, which has been infor- mative, has been the examination of multiple markers from mapped locations within the TCR gene complex. In certain cases, it was possible to characterize haplotypes in unrelated individuals (10, 23). A second approach involves stu'dies of

TCR genes in families where RFLP markers may be expected to represent whole haplotypes. Recombination in families may be detected by selecting markers from different regions that span the TCR complex. Correlation between a given trait and TCR haplotype can be evaluated by comparing the observed frequency of haplotypes shared among affected siblings with the frequency expected based on random inheritance. This approach was used to identify a gene either within or closely linked to the TCR 3 gene complex that is involved in susceptibility to-multiple sclerosis (24).

The approach illustrated by the present report provides a means of studying TCR genes in unrelated individuals. Al- though the nucleotide substitution in the Vp1 coding region results in an altered amino acid, it does not result in an altered restriction enzyme recognition site and thus cannot be detected by Southern blotting. RFLPs associated with Vp1 do not show absolute correlation with the sequence variation even though the polymorphic restriction sites are close to the coding-region substitution. The data indicate that allelic differences are present in Vp coding regions and suggest that such polymorphisms may be functionally significant. The use of ASO probes to characterize V3 variants makes it possible to obtain data on the inheritance and expression of variant VP genes in families and in populations.

I thank Dr. T. Rabbitts for providing the V,61 probe and Drs. S. Hauser and D. Kostyu for DNA samples and cell lines. I appreciate the helpful criticism of Drs. T. J. Kindt, A. Rabson, D. Karp, and A. Grier, the editorial assistance of G. Shaw, and the technical assistance of M. Mitchell. 1. Ikuta, K., Ogura, T., Shimizu, A. & Honjo, T. (1985) Proc. Natl.

Acad. Sc. USA 82, 7701-7705. 2. Tillinghast, J. P., Behlke, M. A. & Loh, D. Y. (1986) Science 233,

879-883. 3. Toyonaga, B. & Mak, T. (1987) Ann. Immunol. 5, 585-620. 4. Wilson, R. K., Lai, E., Concannon, P., Barth, R. K. & Hood, L. E.

(1988) Immunol. Rev. 101, 149-172. 5. Chothia, C., Boswell, D. R. & Lesk, A. M. (1988) EMBO J. 7,

3745-3755. 6. Schiffer, M., Wu, T. T. & Kabat, E. A. (1986) Proc. Natl. Acad.

Sci. USA 83, 4461-4463. 7. Davis, M. M. & Bjorkman, P. J. (1988) Nature (London) 334, 395-401. 8. Robinson, M. A. & Kindt, T. J. (1985) Proc. Natl. Acad. Sci. USA

82, 3804-3808. 9. Robinson, M. A. & Kindt, T. J. (1986) Immunogenetics 24, 259-266.

10. Concannon, P., Gatti, R. A. & Hood, L. (1987) J. Exp. Med. 165, 1130-1140.

11. Robinson, M. A. & Kindt. T. J. (1988) in The T-Cell Receptor, ed. Kappler, J. & Davis, M. M. (Liss, New York), Vol. 73, pp. 119-128.

12. Concannon, P., Pickering, L., Kung, P. & Hood, L. (1986) Proc. Natl. Acad. Sci. USA 83, 6598-6602.

13. Kimura, N., Toyonaga, B., Yoshikai, Y., Du, R.-P. & Mak, T. W. (1987) Eur. J. Immunol. 17, 375-383.

14. Mullis, K. B. & Falonna, F. A. (1987) Methods Enzymol. 155, 335-350.

15. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science 239, 487-491.

16. Scharf, S. J., Horn, G. T. & Erlich, H. A. (1986) Science 233, 1076-1078.

17. Vieira, J. & Messing, J. (1982) Gene 19, 259-268. 18. Sanger, F., Nicklen, S. & Coulson, A. (1977) Proc. Natl. Acad. Sci.

USA 74, 5463-5467. 19. Duby, A. (1987) in Current Protocols in Molecular Biology, ed.

Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Sei- dman, J. G., Smith, J. A. & Struhl, K. (Wiley, New York), pp. 6.4.1.-6.4.5.

20. Aebi, M. & Weissmann, C. (1987) TIG 3, 102-107. 21. Lai, E., Concannon, P. & Hood, L. (1988) Nature (London) 331,

543-546. 22. Seboun, E., Robinson, M. A., Kindt, T. J. & Hauser, S. L. (1989)

J. Exp. Med. 170, 1263-1270. 23. Beall, S. S., Concannon, P., Charmley, P., McFarland, H. F.,

Gatti, R. A., Hood, L. E., McFarlin, D. E. & Biddison, W. E. (1989) J. Neuroimmunol. 21, 59-66.

24. Seboun, E., Robinson, M. A., Doolittle, T. J., Ciulla, T. H., Kindt, T. J. & Hauser, S. L. (1989) Cell 57, 1095-1100.



allelic sequence variations in the hypervariable region of a t-cell receptor β chain: correlation...

Documents