analysis of succinate dehydrogenase subunit 1 in plant ... · properties of sdh that is described...
TRANSCRIPT
Analysis of Succinate Dehydrogenase Subunit 1 in Plant
Mitochondrial Stress Signaling and Investigation of SDHAF4 as
a new assembly factor for SDH1
Katharina Belt
MSc of Science
This thesis is presented for the degree of Doctor of Philosophy
(Biochemistry) of the University of Western Australia
ARC Centre of Excellence in Plant Energy Biology
School of Molecular Sciences
September 2017
I
Thesis Declaration
I, Katharina Belt, certify that: This thesis has been substantially accomplished during enrolment in the degree. This thesis does not contain material which has been accepted for the award of any other degree or diploma in my name, in any university or other tertiary institution. No part of this work will, in the future, be used in a submission in my name, for any other degree or diploma in any university or other tertiary institution without the prior approval of The University of Western Australia and where applicable, any partner institution responsible for the joint-award of this degree. This thesis does not contain any material previously published or written by another person, except where due reference has been made in the text. The work(s) are not in any way a violation or infringement of any copyright, trademark, patent, or other rights whatsoever of any person. The following approvals were obtained prior to commencing the relevant work described in this thesis: OGTR (2113), and NLRD (RA/5/1/373). Third party editorial assistance was provided in preparation of the thesis by Professor A. Harvey Millar, Dr. Shaobai Huang and Dr. Olivier Van Aken The work described in this thesis was funded by Scholarship for international research fees (SIRF), University International Stipend (UIS) and UIS Safety-Net-Top Up Scholarships Technical assistance was kindly provided by Professor Bill Plaxton for calculation of kinetic properties of SDH that is described in Chapter 2, Ricarda Fenske for determining peptide abundance of SDH subunits and Dorothee Hahne and Maike Bollen for metabolomic analysis by GC/ MS that is described in Chapter 3. This thesis contains published work and/or work prepared for publication, some of which has been co-authored.
Signature: Date: 12/09/2017
II
Publications
Thesis
Chapter 2:
SA induced plant stress signalling by mitochondria Katharina Belt, Shaobai Huang, Louise F Thatcher, Hayley Casarotto, Karam Singh, Olivier Van Aken, A. Harvey Millar Plant Physiology Feb 2017, pp.00060.2017; DOI: 10.1104/pp.16.00060
Additional
Review The Roles of Mitochondrial Reactive Oxygen Species in Cellular Signaling and Stress Response in Plants Shaobai Huang, Olivier Van Aken, Markus Schwarzländer, Katharina Belt, A. Harvey Millar Plant Physiology Jul 2016, 171 (3) 1551-1559; DOI: 10.1104/pp.16.00166
III
Author contributions
The contribution of each co-author in Chapter 2 is as follows:
1. Katharina Belt: writing, performing and designing experiments, editing
2. A. Harvey Millar, Shaobai Huang, Olivier Van Aken: supervision, editing, writing, experimental design
3. Louise F. Thatcher, Hayley Casarotto, Karam Singh: Design, performance and analysis of GSTF8:luc assays
IV
Acknowledgements
As much as I enjoyed my journey throughout my studies and PhD, it wouldn’t have been such an
amazing experience without a few key people who supported me along the way.
First of all, I would like to sincerely thank my supervisors Professor Harvey Millar, Dr. Shaobai Huang
and Dr. Olivier Van Aken who gave me support and supervision whenever it was needed and their
advice and belief in me helped to increase my scientific skills and confidence in myself and certainly
enabled me to successful milestones throughout my PhD and a successful thesis in the end. I felt
absolutely privileged to work with such experienced and successful scientists and I hope to stay in
touch throughout my next challenges and steps of my own scientific career.
Thank you to my former supervisor Professor Hans-Peter Braun for advising and supporting me in my
decision to move to Perth and for having great discussions scientific and non-scientific throughout my
journey so far. I hope we will keep staying in touch in the future as well.
I would also like to give a big thank you to present and past Millar lab members for being an amazing
welcoming and supportive team who I had many great discussions with and who were always helpful
and friendly in the lab and daily life situations. In particular, I would like to mention Richard, Alex,
Brendan, Ghislaine, Jakob, Martyna, Ben, Julie, Max, Amy, Sandi, Szymon, Jon, Sufy, Tim and all other
PEB PhD students, I had an absolute wonderful time getting to know you all and enjoying life in the lab
as much as outside the lab.
Thank you to everyone in the center and in particular Karina, Rosie, Geetha, Katherine, Jenny and Deb
for helping creating an amazing workplace and supporting us scientist with doing our paperwork and
duties in the lab as well as reminding us of deadlines and organizing retreats and Christmas parties
who have always been a great success thanks to your effort.
Thank you to my partner Kay for being an amazing person and always supporting me. I am so grateful
to have you in my life and absolutely happy and thankful of being able to share all the wonderful
memories with you.
Last but certainly not least to my family and friends back home in Germany who were probably shocked
when they first heard about my move to Australia but nevertheless, have always been a great support
for me when I needed it. Especially I would like to mention my sisters Verena and Larissa as well as my
parents Heike and Achim, my aunt Piti and her partner Rudi as well as my grandparents Hilde and
Hannes, who are one of the main reasons of who I am today and who by always believing in me
certainly contributed of how far I come. I love you all very much.
V
Abbreviations
AA
ABA
ANOVA
AOX
AtOM66OX
BN
BPB
BSA
Cyt c
DCFDA
DCPIP
EDTA
ETC
FA
FAD
Fad1
FADH2
Fe-S
FMN
GC/MS
GFP
GIST
GST
GSTF8
HEPES
HPLC
IAA
IC50
IgG
IMM
IMS
JA
Antimycin A
Abscisic acid
Analysis of Variance
Alternative Oxidase
AtOM66 overexpression
Blue Native
Bromphenolblue
Bovine serum albumin
Cytochrome c
2,7-dichlorofluorescin diacetate
dichlorophenol-indophenol
ethylene diamine tetra-acetic acid
Electron transport chain
Formic acid
Flavin adenosine
FAD synthethase
reduced flavin adenine dinucleotide
iron- sulphur
Flavin mononucleotide
Gas-chromatography/ mass-spectrometry
Green fluorescent protein
Gastrointestinal Stromal Tumor
glutathione S-transferases
glutathione S-transferase
4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid
High purification liquid chromatography
Iodoacetamide
half maximal inhibitory concentration
Immunoglobulin G
Inner mitochondrial membrane
Inner mitochondrial space
Jasmonic acid
VI
KCN
Ler
LPB
Luc
Mal
MEM
Mit.
MM
MRM
MS media
mtROS
NET
NPA
NPR
O2
O2-
OAA
OMM
PAGE
PGL
PHEO
PMS
PR
PVP
Q1
RFP
RNAi
ROS
RP
RT-PCR
S
S. cerevisiae
SA
SDH
SDS
Potassium cyanide
Landsberg
Left primer border
Luciferase
Malonate
Metabolite extraction medium
Mitochondria
Mixer mill
Multiple reaction monitoring
Murashige and Skoog media
Mitochondrial reactive oxygen species
pancreatic neuroendocrine tumor
3-nitropropionate
NON-EXPRESSOR OF PATHOGENESIS-RELATED GENES
Oxygen
Superoxide
Oxaloacetate
Outer mitochondrial membrane
Polyacrylamide Gel Electrophoresis
Paraganglioma
Pheochromocytoma
phenazine methosulfate
pathogenis related
polyvinylpyrrolidone
Ubiquinol-1
Red fluorescent protein
RNA interference
Reactive oxygen species
Right primer
Reverste transcriptace polymerase chain reaction
Soluble
Saccharomyces cerevisiae
Salicylic acid
Succinate dehydrogenase
sodium dodecyl sulfate
VII
SE
SEM
SHAM
SQR
Succ
TCA
TES
TTFA
UQ
UQH2
WB
Standard error
Standard error of the mean
Salicylhydroxamic acid
succinate:quinone reductase
Succinate
Tricarboxylic acid cycle
N-tris [hydro- xymethyl]-methyl-2-aminoethanesulphonic acid
Thenoyltrifluoroacetone
Ubiquinone
Ubiquinol
Western Blot
VIII
Abstract
Succinate dehydrogenase (SDH) is a component of the electron transport chain (ETC), which reduces
ubiquinone (UQ) to ubiquinol (UQH2), as well as part of the tricarboxylic acid cycle (TCA) where succinate
gets oxidized to fumarate. The classic SDH consists of four core subunits, named SDH1 to 4, containing a
Flavin adenine cofactor (FAD), iron-sulfur clusters (Fe-S) and a heme group. In plants four additional
subunits were identified (SDH5 -8) with a yet unknown function.
Previous studies on SDH mutations affecting subunit SDH1 revealed far reaching effects on plant
metabolism and development as well as decreased stress response to certain plant pathogens. Knockout of
SDH1 was shown to be embryo lethal, indicating the essential need of the catalytic SDH subunit. Studies
performed within this thesis revealed that mutations affecting SDH1 structure or maturation result in
severe decrease of salicylic acid (SA) dependent stress signaling and mitochondrial reactive oxygen species
(ROS) production. A point mutation located at the succinate binding site led to a single amino acid change
from Alanine to Threonine, causing a structural change that resulted in an altered substrate affinity as well
as decreased enzymatic efficiency. This mutant was called dsr1, as it showed a disruption in stress response
and was no longer able to respond to SA dependent stress signaling. Forward genetic approaches identified
this mutant prior to studies performed in this thesis. Within this thesis, biochemical analysis performed on
dsr1 and a SDH1 assembly factor knockdown line (sdhaf2) demonstrated that low concentrations of SA
enhance SDH activity at the UQ site in WT to a threshold where increased ROS production occurs. This
further induces a stress response in plants. Both mutant lines were unable to achieve the necessary enzyme
activity due to either a structural change in SDH1 (dsr1) or the decreased abundance of mature SDH1
(sdhaf2), demonstrating the important role of SDH1 in plant stress response and a potential SA acting site
at or near the UQ binding site of SDH.
Due to the variety of defects in plant metabolism and development as well as human neurodegeneration
and tumor disease caused by SDH mutations, the correct assembly of SDH in plants and human is important.
Based on studies in yeast and mammalian cells, 4 assembly factors have been identified to date, named
SDHAF1 to 4. In Arabidopsis, SDHAF2 was previously identified as assembly factor involved in FAD insertion
into SDH1. As the maturation of SDH1 is crucial for plant health and development as well as stress response,
part of this study was to investigate the next essential step in SDH1 assembly after SDHAF2, which would
involve the assembly of SDH1 to SDH2. Studies in yeast have identified SDHAF4 as assembly factor involved
in binding to flavinated SDH1 and promoting assembly of SDH1/ SDH2 intermediate. An Arabidopsis SDHAF4
orthologue (At5g67490) was identified and a T-DNA knockout line (sdhaf4) used to analyze the function of
this potential assembly factor in Arabidopsis. Results obtained within this thesis revealed that plants lacking
SDHAF4 show decreased SDH activity as well as lower succinate dependent respiration, indicating an
important role of SDHAF4 in plant SDH function. Furthermore, sdhaf4 showed high presence of soluble
flavinated SDH1 as well as high accumulation of SDHAF2 peptides, providing evidence for SDHAF4 being
indeed involved in SDH1 stabilization and assembly of SDH1 to SDH2. A severe decrease for SDH2 peptides
was observed in sdhaf4, showing its requirement for stabilization of SDH2 by promoting the formation of
the intermediate of SDH1 and SDH2.
Results obtained within this thesis revealed a new mitochondrial SA dependent plant stress signaling
pathway with SDH being the major site of ROS production as well as identified the second SDH1 assembly
factor in plants following SDHAF2.
IX
Contents
Thesis Declaration ....................................................................................................................................................................... I
Publications ................................................................................................................................................................................ II
Author contributions ................................................................................................................................................................. III
Acknowledgements ................................................................................................................................................................... IV
Abbreviations ............................................................................................................................................................................. V
Abstract ................................................................................................................................................................................... VIII
List of Figures ............................................................................................................................................................................. X
List of Tables ............................................................................................................................................................................. XII
Chapter One: .............................................................................................................................................................................. 1
General Introduction .................................................................................................................................................................. 1
Literature cited .................................................................................................................................................................... 14
Chapter Two: ............................................................................................................................................................................ 18
Salicylic Acid-Dependent Plant Stress Signaling via Mitochondrial Succinate Dehydrogenase ................................................ 18
Abstract ............................................................................................................................................................................... 19
Introduction ......................................................................................................................................................................... 20
Results ................................................................................................................................................................................. 22
Discussion ............................................................................................................................................................................ 34
Materials and Methods ....................................................................................................................................................... 40
Literature Cited.................................................................................................................................................................... 42
Chapter Three: ......................................................................................................................................................................... 46
Assembly factor SDHAF4 is required for promoting assembly of flavinated SDH1 to SDH2 in Arabidopsis ............................. 46
Abstract ............................................................................................................................................................................... 47
Introduction ......................................................................................................................................................................... 48
Results ................................................................................................................................................................................. 51
Discussion ............................................................................................................................................................................ 62
Materials and Methods ....................................................................................................................................................... 66
Designing SDHAF4 GFP Construct ................................................................................................................................... 67
Arabidopsis Transient Transformation using Gold Particle Bombardment .................................................................... 67
Literature cited .................................................................................................................................................................... 72
Chapter Four: ........................................................................................................................................................................... 74
General Discussion ................................................................................................................................................................... 74
Literature cited .................................................................................................................................................................... 86
Appendix .................................................................................................................................................................................. 86
Supplemental Material ........................................................................................................................................................ 90
Supplemental Material for Chapter Two ........................................................................................................................ 90
Supplemental Material for Chapter Three .................................................................................................................... 100
X
List of Figures
Chapter 1
Figure 1 The role of succinate dehydrogenase in the electron transport chain (ETC) and the citric acid cycle (TCA cycle).
Figure 2 Scheme of Complex II SDH showing the electron transfer pathway during succinate oxidation
Chapter 2
Figure 1 GSTF8:luc induction in sdhaf2 and dsr1 after SA treatment compared to wild type
Figure 2 Lower succinate affinity and catalytic efficiency in dsr1.
Figure 3 IC50 of SDH competitive inhibitors malonate and oxaloacetate are higher in dsr1.
Figure 4 SA-induced GSTF8 signal can be rescued in sdhaf2 using high concentrations of succinate.
Figure 5 Low concentrations of SA increase SQR activity.
Figure 6 mtH2O2 production is lower in dsr1 and sdhaf2.
Supplemental Figure 1 GSTF8:LUC induction in the presence of 1 mM SA or H2O2
Supplemental Figure 2 Inhibition of competitive inhibitor malonate in the presence of 5 mM
succinate
Supplemental Figure 3 Significant differences in SQR activity and oxygen consumption between genotypes and SA treatment.
Supplemental Figure 4 Complex III activity in the presence of SA
Supplemental Figure 5 TTFA (A) and carboxin (B) increase SQR activity at low concentrations
Supplemental Figure 6 Complex I and alternative NADH dehydrogenase dependent ROS and oxygen uptake measurements in the presence of SA
Supplemental Figure 7 Measured background signals for mitochondrial H2O2 production in the absence of substrates and effectors.
Supplemental Figure 8 Comparison of structures for TTFA, Carboxin, SA and ubiquinone-1
XI
Chapter 3
Figure 1 SDHAF4 shows conserved region at C-terminus amongst different species
Figure 2 sdhaf4 shows lower SDH activity and succinate dependent oxygen consumption
Figure 3 SDH2 and SDHAF2 is altered in sdhaf4
Figure 4 Figure 5
Figure 6
SDH1 is accumulated in soluble mitochondria fraction in sdhaf4 SDH1 is less incorporated into SDH holo-complex and accumulates as soluble protein in sdhaf4
Scheme of FAD insertion into SDH1 and assembly of SDH1 to SDH2.
Supplemental Figure 1 Genotyping of T-DNA insertion line of At5g67490
Supplemental Figure 2 Plant growth and development not altered in sdhaf4
Supplemental Figure 3 Michaelis- Menten curve shows no difference for Km in sdhaf4 and Ler
Supplemental Figure 4 R script that was used to determine Km and Vmax of Ler and sdhaf4 replicates
Supplemental Figure 5 FAD bound protein is not altered in sdhaf4
Supplemental Figure 6 SDS PAGE of FAD bound protein for soluble and mitochondria protein fraction
Supplemental Figure 7 SDH activity and ROS production are not increased in soluble mitochondria fraction in sdhaf4
XII
List of Tables
Chapter 1
Table 1 List of SDH Subunits Occurring in Plants
Table 2 SDH Assembly Factors in Humans and Yeast and likely Plant homologs
Chapter 2
Supplemental Table 1 p-values of statistical comparisons between genotypes and treatment
(Fisher Least Significant Difference (LSD) test)
Chapter 3
Supplemental Table 1
Supplemental Table 2
Metabolomic data analyses from sdhaf4 and Ler whole plant tissue
calculated in metabolome express (www.metabolome-express.org)
Primer sequence used for RT-PCR analysis given in 5’ 3’ orientation
1
Chapter One:
General Introduction
2
Mitochondria are Essential Organelles in most Eukaryotes
Mitochondria are double membrane-bound organelles, needed for energy production in the form of
adenosine triphosphate (ATP) in most eukaryotic organisms. They evolved from alpha-proteobacteria
about two billion years ago (Blackstone 2016). Mitochondria vary in size and structure but are
commonly between 0.75 and 3 µm in diameter (Wiemerslage and Lee 2016). Besides providing cellular
energy, they are also involved in cell signaling, cellular differentiation as well as cell death and are
important for the regulation of the cell cycle and cell growth (McBride et al. 2006). In addition,
mitochondria are involved in cellular metabolism by providing precursors of certain amino acids as well
as reducing agent such as NADH, which is used in several biochemical reactions (Fernie et al. 2004).
Mitochondria contain different compartments, each with specialized functions. These include the
outer membrane (OMM), intermembrane space (IMS), the inner membrane (IMM) including the
cristae, and the matrix. Mitochondria contain their own genome, independent from the cell’s nuclear
genome, with substantial similarity to bacterial genomes (Andersson et al. 2003). Based on
bioinformatic prediction tools, it is assumed that up to 2000 – 3000 types of proteins are present in
mitochondria at any time dependent on cell type, developmental stage and environmental conditions
(Millar et al. 2005; Millar et al. 2006; Cui et al. 2011).
Embedded in the IMM is the electron transport chain (ETC), a series of four respiratory complexes
which transfer electrons from donors to acceptors via redox reactions (Figure 1). These reactions are
coupled to proton transfer across the IMM in the IMS, thereby creating a proton gradient, which drives
ATP synthesis via the F1Fo ATP Synthase. Located in the mitochondrial matrix is the tricarboxylic acid
cycle or citric acid cycle (TCA cycle), which forms a cyclic series of reactions starting when acetyl-Co-A
is converted to citric acid (Figure 1). Within this cycle 3 NADH, 1 FADH2 and 1 ATP molecule will be
produced using 1 acetyl-Co-A molecule. The electron carriers NADH and FADH2 will then be used by
the ETC as electron donors. In Complex I (NADH:ubiquinone oxidoreductase or NADH dehydrogenase)
NADH is oxidized and two electrons are transferred to ubiquinone (UQ) while four protons are pumped
across the membrane. Complex I forms the main entrance for electrons into the ETC and is one of the
main sites for electron leakage to oxygen which results in the generation of reactive oxygen species
(ROS) (Raha and Robinson 2000; Sweetlove et al. 2002). In Complex II (Succinate:quinone
oxidoreductase, commonly known as succinate dehydrogenase (SDH)), electrons are delivered from
the oxidation of succinate and are then transferred into the quinone pool via flavin adenine
dinucleotide (FAD). SDH forms an additional electron entry pathway into the ETC, but unlike Complex
I, no protons are translocated to the IMS. SDH is the only complex that is part of both TCA cycle and
ETC. It forms the link between these two reactions and is anchored into the IMM. Complex III
(cytochrome bc1 complex) catalyzes the further electron transfer from ubiquinol (UQH2) to
3
cytochrome c (cyt c) coupled to proton translocation across the membrane. Complex IV (cytochrome
c oxidase) forms the final electron acceptor within the ETC. Cyt c is oxidized and four electrons are
transferred to molecular oxygen (O2), thereby forming two molecules of water. The F1Fo ATP Synthase
(also called Complex V) produces ATP by transferring protons back into the matrix in a process overall
referred to as oxidative phosphorylation. Mitochondria are widely known for their function in cellular
energy production and regulation of cell metabolism, which makes them essential in almost all
eukaryotes. Mutations in mitochondrial proteins or enzymes can cause severe genetic diseases in
humans and leads to deficiency in plant growth and development (Hanson 1991; Kushnir et al. 2001;
Taylor and Turnbull 2005; Meyer et al. 2009; Tuppen et al. 2010; Huang and Millar 2013).
Figure 1: The role of succinate dehydrogenase in the electron transport chain (ETC) and the citric acid cycle (TCA cycle). Four complexes (CI – CIV) are involved in electron transfer from electron donors to acceptors within the ETC. At the same time protons (H+) are transferred across the membrane by CI, CIII and CIV, which creates a proton motive force that is used by ATP Synthase to transfer protons back into the matrix and concomitantly phosphorylate ADP to ATP. CII links the ETC to the TCA cycle by catalyzing the oxidation of succinate to fumarate and the transfer of electrons to FADH2 to enter into the ETC. UQ= Ubiquinone; Cytc= cytochrome c; Succ= succinate; Fum= fumarate; Mal= malate; OAA= oxaloacetate, AOX=Alternative oxidase; INT/EXT= Internal/ External NADPH dehydrogenase
4
Structure of Succinate Dehydrogenase in Mammals and Bacteria
The structure of SDH was first resolved for the enzyme from Escherichia coli (E. coli) using X-ray
crystallography (Yankovskaya et al. 2003). It was later confirmed to be similar in the mammalian
mitochondrial SDH isolated from porcine heart (Sun et al. 2005). SDH consists of four subunits, which
are named differently amongst species (Bullis and Lemire 1994; Daignan-Fornier et al. 1994; Iverson et
al. 2012; Huang and Millar 2013), but within this thesis will be referred to as SDH1, SDH2, SDH3 and
SDH4. SDH1 contains an FAD co-factor at its N-terminus (68 kDa). SDH2 (29 kDa) harbors three Fe-S
clusters ([2Fe-2S], [4Fe-4S], [3Fe-3S]), with [2Fe-2S] ligated to its N-terminus while the others are
attached to the C-terminus. Two membrane bound subunits named SDH3 and SDH4 (15 kDa),
incorporate a bound heme group and contain a total of six transmembrane helices (Sun et al. 2005).
The overall shape of the complex is in the shape of the letter “q”, formed by a hydrophilic head, facing
into the matrix, and a hydrophobic transmembrane anchored tail. This arrangement is formed by the
hydrophobic subunits SDH3 and SDH4 being embedded in the IMM to anchor the hydrophilic Fe-S
subunit SDH2 and its attached flavoprotein subunit SDH1. Comparisons between bacterial and
mammalian SDH structure revealed substantial differences in the transmembrane region (SDH3,
SDH4), resulting in significant changes of the midpoint redox potential of SDH (Sun et al. 2005). The
overall location of the FAD, Fe-S clusters and the heme group in the bacteria and mammalian
mitochondrial SDH are almost equivalent. However, some of the residues surrounding the Fe-S clusters
differ, causing altered environments for the prosthetic groups and possible differences in the redox
potential of the clusters (Sun et al. 2005).
Inhibitors have been important tools for the structural and mechanistic exploration of SDH. The
succinate analog 3-nitropropionate (NPA) blocks the succinate binding site and inhibits substrate
oxidation and enzyme activity. 2-thenoyltrifluoroacetone (TTFA) is able to bind at the UQ binding site
and is a strong inhibitor for UQ reduction. Both inhibitors were co-crystallized with SDH and an
inhibitor binding complex model was presented (Sun et al. 2005). In addition, oxaloacetate (OAA)
shows very high affinity for the succinate binding site and acts as competitive inhibitor of the enzyme
(Kotlyar and Vinogradov 1984). Based on biochemical studies, two UQ binding sites were shown to
exist in eukaryotic SDH. One (Qp) on the matrix side face of the IMM and a second (Qd) on the opposite
side of the membrane from Qp site, distal from the matrix (Sun et al. 2005). Studies in yeast identified
several residues of Qp and Qd that could potentially function as UQ binding ligands (Oyedotun and
Lemire 1999; Oyedotun and Lemire 2001). In addition, kinetic analysis of specific inhibitors of SDH also
indicated the existence of two UQ binding sites (Yankovskaya et al. 1996). The inhibitor bound SDH
structure showed one TTFA molecule very tightly bound to the Qp pocket, suggesting a high binding
5
affinity, which further confirms the existence as well as the location of the Qp site in SDH (Sun et al.
2005). A second TTFA molecule was found to bind to the Qd site, which was suggested to exist opposite
to the Qp site (Hagerhall 1997; Sun et al. 2005). Binding affinity of TTFA was found to be higher at the
Qp than on the Qd site, indicating one strong and one weaker inhibitor binding site for UQ reduction
(Yankovskaya et al. 1996; Sun et al. 2005). Altogether, those studies revealed the architecture of SDH
with two distinct active sites. The coordination of the catalysis on both sites links the two biological
pathways of succinate oxidation in the TCA cycle and UQ reduction in the ETC. Although separated
from each other, their chemical turnover is coupled. Electron products from succinate oxidation
become substrates for UQ reduction afterwards (Iverson 2013).
During succinate oxidation to fumarate at SDH1, the FAD cofactor accepts two electrons. These
electrons are transferred, one at a time, from FAD via the [2Fe–2S], [4Fe–4S], and [3Fe–4S] clusters in
SDH2 to finally reduce UQ to UQH2 (Figure 2) at the Qp site. Based on SDH crystal structure and
biochemical analysis, a direct role of the heme group in electron transfer to UQ is not supported. There
is no data available to date that clarifies the role of heme or the function of the second (Qd) UQ site in
the catalytic cycle of the enzyme (Sun et al. 2005; Oyedotun et al. 2007; Tran et al. 2007).
Using a mild and micro-scaled immunoisolation followed by mass spectrometry analysis of bovine and
mouse heart mitochondria led to the identification of several post translational modifications (PTMs)
for SDH subunits (Schilling et al. 2006). N-terminal acetylation, deamidation of Asn and oxidation of
several amino acids were observed. In addition, modification of FAD cofactor was observed (Schilling
et al. 2006).
Figure 2: Scheme of SDH showing the electron transfer pathway during succinate oxidation Two electrons get transferred during succinate oxidation via FAD cofactor in SDH1 and the three Fe-S clusters in SDH2 to reach SDH3 and SDH4 where UQ is reduced to UQH2.
6
Diseases caused by SDH Mutations in Humans
In humans, loss of function mutations in the SDH core subunits can cause a variety of diseases, mainly
cancer and neurodegeneration (Van Vranken et al. 2015). Examples are Paraganglioma (PGL) and
Pheochromocytoma (PHEO) as well as Gastrointestinal Stromal Tumor (GIST) (reviewed in (Bezawork-
Geleta et al. 2017)). Mutations in all subunits and SDH1 assembly factor SDHAF2 are linked with PGL
and PHEO. Mutations in SDH1 were found to cause Leigh syndrome, a neurodegenerative disorder
disease (Bourgeron et al. 1995). Studies showed that SDH2 mutations can cause pancreatic
neuroendocrine tumor (NET) and ganglioneuroma (Niemeijer et al. 2015). Mutations in the assembly
factor SDHAF1, the first ever reported SDH assembly factor, were shown to be responsible for infantile
leukoencephalopathy (Ghezzi et al. 2009; Ohlenbusch et al. 2012). Due to the increasing findings of
SDH being involved in a variety of human disorder diseases, research of biogenesis and assembly of
SDH became of great interest. Assembly of SDH and the involvement of different subunits and
assembly factors in genetic disorder diseases have been reviewed recently (Bezawork-Geleta et al.
2017).
Succinate Dehydrogenase in Plants has a Unique Structure
While the classic SDH complex of bacteria and animals consists of four subunits with a mass of ~110
kDa, in plants four additional plant specific subunits were identified, increasing the mass of SDH to
~160 kDa ((Eubel et al. 2003; Millar et al. 2004), (Table 1)). Named SDH5- 8, these additional subunits
do not show a clear functional domain in their sequence. Recent studies suggested that SDH6 and
SDH7 might have replaced helices in SDH3 and SDH4 during evolution (Schikowsky et al. 2017) and
thus are functionally part of the membrane anchor. Based on sequence analysis, SDH3 and SDH4 were
found to lack helices in plants that are conserved in other organisms. Phylogenetic analysis revealed
that SDH6 and SDH7 potentially replaced these missing helices in plants. SDH5 is a hydrophilic protein,
however, its sequence does not show any similarity to other known protein sequences. It is separated
from SDH domains when treated with a mild detergent, indicating its location might be in the interface
of the SDH1/SDH2 and SDH3/SDH4 domain (Schikowsky et al. 2017). SDH5 might act together with the
hydrophilic regions of SDH6 and SDH7 as an additional plant specific function domain with yet
unknown purpose (Schikowsky et al. 2017). SDH8 (4.9 kDa) is the smallest known subunit of any of the
complexes in the ETC. It has been biochemically described only in Arabidopsis (Millar et al. 2004),
however, homologs were found in the genomes of Brassicaceae and monocotyledoneous plants
(Schikowsky et al. 2017). Amino acid sequences of SDH1 and SDH2 from plants showed an overall 80%
alignment identity across other eukaryotes in regions needed for succinate, FAD and Fe-S binding,
indicating a strong structure dependent function relationship in succinate oxidation (Huang and Millar
2013). However, SDH3 and SDH4 subunits, including the UQ binding region, show great diversity in
7
sequences in plants, fungi and mammals, which further indicates SDH structure evolved differently
amongst eukaryotes (Schikowsky et al. 2017). The existing diversity of SDH size and structure as well
as assembling of the subunits among different organisms might result from differences in the
physiological function of the complex in these species (Huang and Millar 2013).
Whereas SDH1 and SDH2 subunits are highly conserved in their sequences, SDH3 and SDH4 show high
divergence (Burger et al. 1996). During eukaryotic evolution, most mitochondrial genes were lost or
transferred to the nucleus soon after the endosymbiotic origination of the mitochondrion (Gray 1992,
1999; Gray et al. 1999). However, in plants, gene transfer to the nucleus is an ongoing process
(reviewed in Palmer et al. 2000) . SDH1 is not present in any mitochondrial genome of eukaryotes (Lang
et al. 1999), indicating a very ancient gene transfer to the nucleus. SDH2 could not be found in any
characterized mitochondrial genome but SDH3 could be located in mitochondria in the liverwort
Marchantia polymorpha (Oda et al. 1992) but not in vascular plants. SDH4 was found in mitochondrial
genome in Marchantia and is present as a pseudogene in a few angiosperms mitochondrial genomes
(Giege et al. 1998). Studies in angiosperms suggested that the seven genes encoding SDH3 and SDH4
were transferred separately to the nucleus, some just very recent (Adams et al. 2001). In all analyzed
animals and fungi, all four SDH genes were located in the nucleus (Boore 1999; Lang et al. 1999),
indicating differences and divergence throughout SDH evolution between mammals and plants.
Table 1: List of SDH Subunits Occurring in Plants
SDH Subunit Gene Name Accession Number
SDH1 SDH1-1; SDH1-2 At5g66760; At2g18450
SDH2 SDH2-1; SDH2-2; SDH2-3 At3g27380; At5g40650; At5g65165
SDH3 SDH3-1; SDH3-2 At5g09600; At4g32210
SDH4 SDH4 At2g46505
SDH5 SDH5 At1g47420
SDH6 SDH6 At1g08480
SDH7 SDH7-1; SDH7-2 At3g47833; At5g62575
SDH8 SDH8 At2g46390
8
Phenotypes of Succinate Dehydrogenase Mutants in Plants
A series of mutations affecting either subunits or assembly factors of SDH in plants have been reported
that show effects on plant development, SDH function, alterations in organic acid levels, changes in
respiration rate and altered mitochondrial ROS production rates (Leon et al. 2007; Gleason et al. 2011;
Huang et al. 2013). Two genes exist for SDH1 in Arabidopsis, named SDH1-1 (At5g66760) and SDH1-2
(At2g18450). SDH1-2 was only expressed at very low transcript levels and knockout lines of SDH1-2 did
not show any effect on growth or development of Arabidopsis (Leon et al. 2007). Knockout of SDH1-1,
on the other hand, is embryo lethal (Leon et al. 2007). Studies on knockdown lines of SDH1-1 showed
pollen abortion and reduced seed set (Leon et al. 2007). Heterozygous SDH1-1/sdh1-1 plants showed
low SDH activity but increased photosynthesis and improved growth in nitrogen limiting conditions
due to alterations in their stomata conductance (Fuentes et al. 2011). It is speculated that less SDH1 in
these mutants is the reason for the changes in stomatal function and photosynthesis performance.
Studies on a knockdown line of SDHAF2 (sdhaf2), showed specific decrease of root elongation but a
normal leaf development (Huang et al. 2013). Although sdhaf2 also showed reduced SDH activity, this
did not seem to affect photosynthetic rate or stomatal conductance, which is in contrast to the SDH1
knockdown lines (Huang et al. 2013). Knockout of SDHAF2 leads to seed abortion, indicating the
importance of SDH1 assembly and maturation for seed development, similar to the lethal phenotype
of SDH1 knockouts (Huang et al. 2013).
The development of an SDH1-1 point mutation line (dsr1) at a conserved region in the succinate
binding site further allowed the investigation of SDH1 function in plant metabolism. A single amino
acid was mutated from Alanine to Threonine causing not only reduced SDH activity but also an
interrupted salicylic acid (SA) dependent stress signal response. In addition, dsr1 plants showed lower
mitochondrial ROS production, which lead to higher susceptibility to specific bacterial pathogens (P.
syringae Pst DC3000) and fungal (A. brassicicola, R. solani) in these plants (Gleason et al. 2011). This
study demonstrated a role of SDH, more precisely SDH1, in mitochondrial ROS production and SA-
dependent stress signaling, but the mechanism of this specific stress signaling pathway and how SDH1
was involved was still unknown. Taking into account the immense losses of crop yield annually due to
pathogen diseases, it is of great interest to better understand the biochemical mechanisms of plant
stress responses. By gaining further knowledge about stress signaling pathways within the plant cell,
more resistant plants can potentially be created in the future.
SDH2, the iron-sulfur subunit, is encoded by three genes in Arabidopsis named SDH2-1 (At3g27380),
SDH2-2 (At5g40650) and SDH2-3 (At5g65165). In Arabidopsis, SDH2-1 and SDH2-2 show distinct cell
specific expression patterns, in fact, only SDH2-2 is expressed in root tips at high levels (Elorza et al.
9
2004). Knockout of SDH2-1 did not result in any phenotype. SDH2-3 is specifically expressed in the
embryo during seed development (Elorza et al. 2006) and its disruption alone was shown to cause
delayed seed germination (Roschzttardtz et al. 2009). In Solanum lycopersicum, RNA interference lines
of SDH2-2 showed increased rates of photosynthesis and growth caused by their higher stomatal
aperture (Araujo et al. 2011), similar to the reported SDH1-1/sdh1-1 plants mentioned above (Fuentes
et al. 2011). To date it is not clear how and if SDH is directly involved in stomata regulation,
nevertheless, a model exists suggesting that SDH is involved by altering malate and fumarate levels
(Araujo et al. 2011). Overall, the different effects and extent of changes in plant metabolism and
growth development in SDH1 and SDH2 mutants demonstrate the essential role of SDH in plants.
The Role of SDH in Mitochondrial Stress Signaling and ROS Production
For a long time Complex I and III were believed to be the major sources in mitochondrial ROS
production, but recent studies in both mammalian and plant systems demonstrated that SDH can act
as a significant source for ROS production as well (Gleason et al. 2011; Quinlan et al. 2012; Jardim-
Messeder et al. 2015). Based on studies in mammalian mitochondria, it was found that SDH can
generate superoxide (O2-) or hydrogen peroxide (H2O2) at high rates exceeding the maximum rates of
Complex I and III, when Complex I and III are inhibited and the succinate concentration is low (Quinlan
et al. 2012). ROS generated by SDH was shown to originate from both the forward reaction, where
electrons are provided by succinate oxidation, as well as the reverse reaction, where electrons are
supplied from UQH2 (Quinlan et al. 2012). Another study showed that SDH influences reperfusion
injury in mammals through mtROS production that occurred during reverse electron transport after
succinate accumulation (Chouchani et al. 2014). Bovine heart SDH was shown to generate ROS, mostly
as O2- , dependent on the fumarate/succinate ratio (Grivennikova et al. 2017). The highest rates of ROS
production were observed when succinate concentration was low and a so called “ping pong”
mechanism was suggested in which ROS is only generated where dicarboxylate-free reduced enzyme
interacts with oxygen (Grivennikova et al. 2017).
The ETC of higher plants includes a unique feature in order to transport electrons from reduced UQ to
molecular oxygen, the cyanide insensitive alternative oxidase (AOX) pathway, an alternative pathway
that exists parallel to the cyanide sensitive cytochrome c oxidase (Vishwakarma et al. 2015). AOX is
known to be involved in many processes including biotic and abiotic stress response (Cvetkovska et al.
2014), low oxygen (Clifton et al. 2005), nutrient limitation (Noguchi and Terashima 2006), salinity
(Wang et al. 2010) and metal toxicity (Tan et al. 2010). Under stress conditions AOX dissipates excess
energy in form of heat in order to prevent an overreduced UQ pool and the formation of ROS (Vassileva
et al. 2009). In higher concentrations ROS can cause oxidative damage and cell death, therefore cellular
10
processes like AOX are important to prevent oxidative stress (Shah et al. 2001; Mittler 2002). Recent
studies in Arabidopsis thaliana and Oryza sativa have demonstrated that SDH is a direct source of ROS
combined with the induction of ROS production by specific SDH inhibitors which were also shown to
impair plant growth (Jardim-Messeder et al. 2015). It was demonstrated that this effect was
accompanied by the down-regulation of cell cycle genes and the up-regulation of stress-related genes
indicating an important role of SDH in plant development and stress response (Jardim-Messeder et al.
2015). Mitochondrial ROS (mtROS) production was found to have influence on redox signaling,
retrograde signaling, plant hormone action, programmed cell death and defence against pathogens
and its importance for cellular function was reviewed and discussed recently (Huang et al. 2016).
Gleason et al. showed that SDH1 is involved in a ROS induced stress signalling pathway likely triggered
by SA, but the site of ROS production in this pathway is unclear as well as the mechanism by which SA
and SDH would interact to induce a stress response.
SA is involved in many different cellular and signaling functions such as hormone signaling as well as
processes like thermogenesis (Raskin et al. 1987), ethylene synthesis, and fruit ripening (Leslie and
Romani 1988). Additionally, it often acts as a stress regulator during plant defense response (Yalpani
et al. 1991; Rao and Davis 1999; Senaratna et al. 2000). The accumulation of SA correlates with
enhanced ROS production during plant stress response to regulate plant defense gene expression. This
relationship has been reviewed recently (Herrera-Vásquez et al. 2015). The activation of SA signaling
by accumulated ROS originating from various cell compartments is well known (Wrzaczek et al. 2013).
Several studies demonstrated that increases in SA levels are followed by apoplastic H2O2 bursts
generated by NADPH oxidases and extracellular peroxidases (A.-H.-Mackerness et al. 2001; Torres et
al. 2002; Joo et al. 2005; Tsuda et al. 2008; O'Brien et al. 2012; Mammarella et al. 2015). However,
there is also evidence for SA promoting ROS production in order to response to avirulent bacteria
(Grant and Loake 2000), high light (Mateo et al. 2006), ozone (Yoshida et al. 2009) and salinity (Lee and
Park 2010) stress. Previous studies also demonstrated increased mtROS production after SA treatment
(Nie et al. 2015) and it was suggested that Complex III might interact with SA in order to generate ROS.
Overall, various studies within recent years provided evidence for SDH being an important player in
mtROS production and stress response.
A Current Model for Assembly of Succinate Dehydrogenase
Considering the importance of matured SDH for plant development and human health, investigating
the biogenesis and assembly of SDH is of great interest. To date, four assembly factors have been
reported to play a role in assembling of mature SDH holo-complex and are herein named: SDHAF1,
SDHAF2, SDHAF3 and SDHAF4 (Table 2). Based on studies undertaken in yeast, Drosophila and
11
mammalian cells, SDH assembly was recently reviewed intensively and an assembly model was
presented (Bezawork-Geleta et al. 2017).
This model shows that as a first assembly step, SDH1 is flavinated by SDHAF2, which is required for the
covalent attachment of FAD to the subunit SDH1 (Hao et al. 2009; Huang et al. 2013). Yeast as well as
human SDHAF2 interact with catalytic subunit SDH1. Germline loss-of-function mutations in human
SDHAF2 caused a neuroendocrine tumor disease (Hao et al. 2009). An orthologue gene in Arabidopsis
was identified and was shown to be an SDH assembly factor in plants (Huang et al. 2013). SDHAF2
knockout were shown to be lethal and SDHAF2 knockdown lines (sdhaf2) showed a short root
phenotype as well as lower SDH activity (Huang et al. 2013). FAD bound protein in sdhaf2 was reduced,
indicating its function in promoting the incorporation of FAD into SDH1 (Huang et al. 2013).
The assembly factor SDHAF4 was identified in recent studies in yeast, Drosophila and mammalian cells
(Van Vranken et al. 2014). SDHAF4 acts after SDHAF2 on the flavinated SDH1 to promote assembly to
SDH2 (Van Vranken et al. 2014). The binding of flavinated SDH1 is necessary to reduce the risk of auto
oxidation, which would result in excess ROS from the FAD protein in soluble SDH1 (Van Vranken et al.
2014). The current model suggests that following FAD insertion into SDH1 via SDHAF2, SDHAF4 binds
to flavinated SDH1 and promotes the assembly of SDH1 to SDH2 to form the stable SDH1/SDH2
intermediate (Bezawork-Geleta et al. 2017).
Further assembly factors are required for the insertion of Fe-S clusters into SDH2 and the maturation
of SDH2. Studies in yeast and genetic mutations occurring in families suffering from infantile
leukoencephalopathy lead to the identification of SDHAF1 and SDHAF3 (Ghezzi et al. 2009). SDHAF1
encodes a LYR-protein motive, suggested to be a signature for Fe-S interacting proteins (Ghezzi et al.
2009). Mutation of the yeast homolog SDHAF1 as well as the expression of variants corresponding to
human mutants resulted in enzymatic SDH deficiency and failure of OXPHOS-dependent growth
(Ghezzi et al. 2009). Mutations in SDHAF1 affects its interaction with SDH2 resulting in an altered
biogenesis of the SDH holo-enzyme (Bezawork-Geleta et al. 2014; Na et al. 2014; Maio et al. 2016).
Later it was demonstrated that two assembly factors, SDHAF1 and SDHAF3, are involved in maturation
of SDH2 (Na et al. 2014). Studies in yeast and Drosophila lacking SDHAF3 showed decreased SDH
activity and reduced levels of SDH2 expression. In addition, Drosophila showed muscular and neuronal
dysfunction and was hypersensitive to oxidative stress when SDHAF3 was mutated (Na et al. 2014).
SDHAF1 and SDHAF3 were proposed to act together to promote SDH2 maturation by binding to a
SDH1/SDH2 intermediate, thereby, protecting it from oxidants (Ghezzi et al. 2009; Na et al. 2014; Maio
et al. 2016). The chaperone like assembly factor SDHAF3 supports the binding of SDHAF1 to SDH2,
12
which promotes transfer and incorporation of Fe-S clusters into SDH2 (Na et al. 2014). Once the
SDH1/SDH2 intermediate is formed, the membrane bound subunits SDH3 and SDH4 anchor these two
subunits to the inner membrane. However, how many assembly factors might be involved in this step
is still unknown. Chaperones or assembly factors for the maturation of SDH3 and SDH4 as well as the
incorporation and function of the heme group has not been revealed at this stage.
To date, only SDHAF2 of Arabidopsis has been identified as an SDH assembly factor in plants (Huang et
al. 2013). Assembly of SDH1 is essential for optimal plant development and metabolism. Therefore,
investigating the next step in the assembly machinery of SDH1 after FAD insertion, is of great interest.
It is still unknown if a plant SDHAF3 exists as no ortholog gene could be identified and although an
Arabidopsis SDHAF1 gene was identified, it is questionable if this protein is part of the SDH assembly
pathway in plants as no data is yet available about the function of AtSDHAF1. Maturation of SDH2 in
plants might be differently regulated than in yeast or mammalian system and still needs to be
investigated.
Table 2: SDH Assembly Factors in Humans and Yeast and likely Plant homologs
SDH Assembly
Factor
Human
(Homo sapiens)
Yeast
(Saccharomyces
cerevisiae)
Plant
(Arabidopsis
thaliana)
SDHAF1 SDHAF1
NM_001042631
SDH6
YDR379CA
Orthologue gene
At2g39725
SDHAF2 SDHAF2
NM_017841
SDH5
YOL071W
SDHAF2
At5g51040
SDHAF3 SDHAF3
NM_020186
SDH7
YDR511W
No orthologue gene
SDHAF4 SDHAF4
NM_145267
SDH8
YBR269C
Orthologue gene
At5g67490
Aim of this study
The overall aim of this study was to investigate the function of SDH in plant metabolism and stress
response. In particular, to determine the role of SDH1 in plant stress response and mtROS production
in the presence and absence of SA using the dsr1 together with sdhaf2 mutant. Furthermore, the
interaction of SA with SDH during plant stress signaling was one focus within this thesis (Chapter 2).
Given the importance of mature SDH1 for plant development and metabolism, the assembly of SDH1
13
was the second main focus in this study (Chapter 3). Based on previous work that revealed SDHAF2 as
a first SDH assembly factor in plants, essential for FAD insertion into SDH1, I investigated the next
important step in the assembly pathway, which would be the formation of the SDH1/SDH2
intermediate.
The knowledge gained from this thesis will give further insights into the SA-dependent mitochondrial
stress signaling pathway as well as SDH-mediated mtROS production in plants. By getting a better
understanding of the plant stress response machinery on a biochemical level, this work has the
potential to contribute to attempts to influence pathogen resistance/ stress response in plants in the
future.
14
Literature cited
A.-H.-Mackerness S, John CF, Jordan B, Thomas B (2001) Early signaling components in ultraviolet-B responses: distinct roles for different reactive oxygen species and nitric oxide. FEBS Letters 489 (2-3):237-242. doi:10.1016/S0014-5793(01)02103-2
Adams KL, Rosenblueth M, Qiu YL, Palmer JD (2001) Multiple losses and transfers to the nucleus of two mitochondrial succinate dehydrogenase genes during angiosperm evolution. Genetics 158 (3):1289-1300
Andersson GE, Karlberg O, Canbäck B, Kurland CG (2003) On the origin of mitochondria: a genomics perspective. Philosophical Transactions of the Royal Society of London Series B: Biological Sciences 358 (1429):165
Araujo WL, Nunes-Nesi A, Osorio S, Usadel B, Fuentes D, Nagy R, Balbo I, Lehmann M, Studart-Witkowski C, Tohge T, Martinoia E, Jordana X, DaMatta FM, Fernie AR (2011) Antisense Inhibition of the Iron-Sulphur Subunit of Succinate Dehydrogenase Enhances Photosynthesis and Growth in Tomato via an Organic Acid-Mediated Effect on Stomatal Aperture. The Plant Cell Online 23 (2):600-627. doi:10.1105/tpc.110.081224
Bezawork-Geleta A, Rohlena J, Dong L, Pacak K, Neuzil J (2017) Mitochondrial Complex II: At the Crossroads. Trends Biochem Sci 42 (4):312-325. doi:10.1016/j.tibs.2017.01.003
Bezawork-Geleta A, Saiyed T, Dougan DA, Truscott KN (2014) Mitochondrial matrix proteostasis is linked to hereditary paraganglioma: LON-mediated turnover of the human flavinylation factor SDH5 is regulated by its interaction with SDHA. The FASEB Journal 28 (4):1794-1804. doi:10.1096/fj.13-242420
Blackstone N (2016) An Evolutionary Framework for Understanding the Origin of Eukaryotes. Biology 5 (2):18 Boore JL (1999) Animal mitochondrial genomes. Nucleic Acids Res 27. doi:10.1093/nar/27.8.1767 Bourgeron T, Rustin P, Chretien D, Birch-Machin M, Bourgeois M, Viegas-Pequignot E, Munnich A, Rotig A (1995)
Mutation of a nuclear succinate dehydrogenase gene results in mitochondrial respiratory chain deficiency. Nature genetics 11 (2):144-149. doi:10.1038/ng1095-144
Bullis BL, Lemire BD (1994) Isolation and characterization of the Saccharomyces cerevisiae SDH4 gene encoding a membrane anchor subunit of succinate dehydrogenase. The Journal of biological chemistry 269 (9):6543-6549
Burger G, Lang BF, Reith M, Gray MW (1996) Genes encoding the same three subunits of respiratory complex II are present in the mitochondrial DNA of two phylogenetically distant eukaryotes. Proceedings of the National Academy of Sciences 93 (6):2328-2332
Chouchani ET, Pell VR, Gaude E, Aksentijevic D, Sundier SY, Robb EL, Logan A, Nadtochiy SM, Ord EN, Smith AC, Eyassu F, Shirley R, Hu CH, Dare AJ, James AM, Rogatti S, Hartley RC, Eaton S, Costa AS, Brookes PS, Davidson SM, Duchen MR, Saeb-Parsy K, Shattock MJ, Robinson AJ, Work LM, Frezza C, Krieg T, Murphy MP (2014) Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS. Nature 515 (7527):431-435. doi:10.1038/nature13909
Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, Millar AH, Day DA, Whelan J (2005) Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana. Plant Mol Biol 58 (2):193-212. doi:10.1007/s11103-005-5514-7
Cui J, Liu J, Li Y, Shi T (2011) Integrative Identification of Arabidopsis Mitochondrial Proteome and Its Function Exploitation through Protein Interaction Network. PLOS ONE 6 (1):e16022. doi:10.1371/journal.pone.0016022
Cvetkovska M, Dahal K, Alber NA, Jin C, Cheung M, Vanlerberghe GC (2014) Knockdown of mitochondrial alternative oxidase induces the 'stress state' of signaling molecule pools in Nicotiana tabacum, with implications for stomatal function. The New phytologist 203 (2):449-461. doi:10.1111/nph.12773
Daignan-Fornier B, Valens M, Lemire BD, Bolotin-Fukuhara M (1994) Structure and regulation of SDH3, the yeast gene encoding the cytochrome b560 subunit of respiratory complex II. The Journal of biological chemistry 269 (22):15469-15472
Elorza A, León G, Gómez I, Mouras A, Holuigue L, Araya A, Jordana X (2004) Nuclear SDH2-1 and SDH2-2 Genes, Encoding the Iron-Sulfur Subunit of Mitochondrial Complex II in Arabidopsis, Have Distinct Cell-Specific Expression Patterns and Promoter Activities. Plant Physiology 136 (4):4072-4087. doi:10.1104/pp.104.049528
Elorza A, Roschzttardtz H, Gomez I, Mouras A, Holuigue L, Araya A, Jordana X (2006) A nuclear gene for the iron-sulfur subunit of mitochondrial complex II is specifically expressed during Arabidopsis seed development and germination. Plant & cell physiology 47 (1):14-21. doi:10.1093/pcp/pci218
15
Eubel H, Jänsch L, Braun H-P (2003) New insights into the respiratory chain of plant mitochondria. Supercomplexes and a unique composition of Complex II. Plant Physiol 133:274-286
Fernie AR, Carrari F, Sweetlove LJ (2004) Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Curr Opin Plant Biol 7 (3):254-261. doi:10.1016/j.pbi.2004.03.007
Fuentes D, Meneses M, Nunes-Nesi A, Araujo WL, Tapia R, Gomez I, Holuigue L, Gutierrez RA, Fernie AR, Jordana X (2011) A Deficiency in the Flavoprotein of Arabidopsis Mitochondrial Complex II Results in Elevated Photosynthesis and Better Growth in Nitrogen-Limiting Conditions. Plant Physiology 157 (3):1114-1127. doi:10.1104/pp.111.183939
Ghezzi D, Goffrini P, Uziel G, Horvath R, Klopstock T, Lochmuller H, D'Adamo P, Gasparini P, Strom TM, Prokisch H, Invernizzi F, Ferrero I, Zeviani M (2009) SDHAF1, encoding a LYR complex-II specific assembly factor, is mutated in SDH-defective infantile leukoencephalopathy. Nature genetics 41 (6):654-656. doi:10.1038/ng.378
Giege P, Knoop V, Brennicke A (1998) Complex II subunit 4 (sdh4) homologous sequences in plant mitochondrial genomes. Curr Genet 34 (4):313-317
Gleason C, Huang S, Thatcher LF, Foley RC, Anderson CR, Carroll AJ, Millar AH, Singh KB (2011) Mitochondrial complex II has a key role in mitochondrial-derived reactive oxygen species influence on plant stress gene regulation and defense. Proceedings of the National Academy of Sciences of the United States of America 108 (26):10768-10773. doi:10.1073/pnas.1016060108
Grant JJ, Loake GJ (2000) Role of Reactive Oxygen Intermediates and Cognate Redox Signaling in Disease Resistance. Plant Physiology 124 (1):21
Gray MW (1992) The endosymbiont hypothesis revisited. International review of cytology 141:233-357 Gray MW (1999) Evolution of organellar genomes. Curr Opin Genet Dev 9. doi:10.1016/s0959-437x(99)00030-1 Gray MW, Burger G, Lang BF (1999) Mitochondrial evolution. Science 283. doi:10.1126/science.283.5407.1476 Grivennikova VG, Kozlovsky VS, Vinogradov AD (2017) Respiratory complex II: ROS production and the kinetics
of ubiquinone reduction. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1858 (2):109-117. doi:http://dx.doi.org/10.1016/j.bbabio.2016.10.008
Hagerhall C (1997) Succinate: quinone oxidoreductases. Variations on a conserved theme. Biochimica et biophysica acta 1320 (2):107-141
Hanson MR (1991) Plant mitochondrial mutations and male sterility. Annu Rev Genet 25:461-486. doi:10.1146/annurev.ge.25.120191.002333
Hao HX, Khalimonchuk O, Schraders M, Dephoure N, Bayley JP, Kunst H, Devilee P, Cremers CW, Schiffman JD, Bentz BG, Gygi SP, Winge DR, Kremer H, Rutter J (2009) SDH5, a gene required for flavination of succinate dehydrogenase, is mutated in paraganglioma. Science 325 (5944):1139-1142. doi:10.1126/science.1175689
Herrera-Vásquez A, Salinas P, Holuigue L (2015) Salicylic acid and reactive oxygen species interplay in the transcriptional control of defense genes expression. Frontiers in Plant Science 6:171. doi:10.3389/fpls.2015.00171
Huang S, Millar AH (2013) Succinate dehydrogenase: the complex roles of a simple enzyme. Curr Opin Plant Biol 16 (3):344-349. doi:10.1016/j.pbi.2013.02.007
Huang S, Taylor NL, Stroher E, Fenske R, Millar AH (2013) Succinate dehydrogenase assembly factor 2 is needed for assembly and activity of mitochondrial complex II and for normal root elongation in Arabidopsis. The Plant journal : for cell and molecular biology 73 (3):429-441. doi:10.1111/tpj.12041
Huang S, Van Aken O, Schwarzländer M, Belt K, Millar AH (2016) The Roles of Mitochondrial Reactive Oxygen Species in Cellular Signaling and Stress Response in Plants. Plant Physiology 171 (3):1551-1559. doi:10.1104/pp.16.00166
Iverson TM (2013) “Catalytic mechanisms of Complex II enzymes: A structural perspective”. Biochimica et biophysica acta 1827 (5):648-657. doi:10.1016/j.bbabio.2012.09.008
Iverson TM, Maklashina E, Cecchini G (2012) Structural Basis for Malfunction in Complex II. J Biol Chem 287 (42):35430-35438. doi:10.1074/jbc.R112.408419
Jardim-Messeder D, Caverzan A, Rauber R, de Souza Ferreira E, Margis-Pinheiro M, Galina A (2015) Succinate dehydrogenase (mitochondrial complex II) is a source of reactive oxygen species in plants and regulates development and stress responses. The New phytologist 208 (3):776-789. doi:10.1111/nph.13515
Joo JH, Wang S, Chen J, Jones A, Fedoroff NV (2005) Different Signaling and Cell Death Roles of Heterotrimeric G Protein α and β Subunits in the Arabidopsis Oxidative Stress Response to Ozone. The Plant cell 17 (3):957-970. doi:10.1105/tpc.104.029603
Kotlyar AB, Vinogradov AD (1984) Interaction of the membrane-bound succinate dehydrogenase with substrate and competitive inhibitors. Biochimica et biophysica acta 784 (1):24-34
16
Kushnir S, Babiychuk E, Storozhenko S, Davey MW, Papenbrock J, De Rycke R, Engler G, Stephan UW, Lange H, Kispal G, Lill R, Van Montagu M (2001) A Mutation of the Mitochondrial ABC Transporter Sta1 Leads to Dwarfism and Chlorosis in the Arabidopsis Mutant starik. The Plant cell 13 (1):89-100
Lang BF, Gray MW, Burger G (1999) Mitochondrial genome evolution and the origin of eukaryotes. Annu Rev Genet 33:351-397. doi:10.1146/annurev.genet.33.1.351
Lee S, Park C-M (2010) Modulation of reactive oxygen species by salicylic acid in arabidopsis seed germination under high salinity. Plant signaling & behavior 5 (12):1534-1536. doi:10.4161/psb.5.12.13159
Leon G, Holuigue L, Jordana X (2007) Mitochondrial complex II is essential for gametophyte development in Arabidopsis. Plant Physiology 143 (4):1534-1546. doi:10.1104/pp.106.095158
Leslie CA, Romani RJ (1988) Inhibition of ethylene biosynthesis by salicylic Acid. Plant Physiol 88 (3):833-837 Maio N, Ghezzi D, Verrigni D, Rizza T, Bertini E, Martinelli D, Zeviani M, Singh A, Carrozzo R, Rouault TA (2016)
Disease-Causing SDHAF1 Mutations Impair Transfer of Fe-S Clusters to SDHB. Cell metabolism 23 (2):292-302. doi:10.1016/j.cmet.2015.12.005
Mammarella ND, Cheng Z, Fu ZQ, Daudi A, Bolwell GP, Dong X, Ausubel FM (2015) Apoplastic peroxidases are required for salicylic acid-mediated defense against Pseudomonas syringae. Phytochemistry 112:110-121. doi:10.1016/j.phytochem.2014.07.010
Mateo A, Funck D, Muhlenbock P, Kular B, Mullineaux PM, Karpinski S (2006) Controlled levels of salicylic acid are required for optimal photosynthesis and redox homeostasis. Journal of experimental botany 57 (8):1795-1807. doi:10.1093/jxb/erj196
McBride HM, Neuspiel M, Wasiak S (2006) Mitochondria: More Than Just a Powerhouse. Current Biology 16 (14):R551-R560. doi:https://doi.org/10.1016/j.cub.2006.06.054
Meyer EH, Tomaz T, Carroll AJ, Estavillo G, Delannoy E, Tanz SK, Small ID, Pogson BJ, Millar AH (2009) Remodeled respiration in ndufs4 with low phosphorylation efficiency suppresses Arabidopsis germination and growth and alters control of metabolism at night. Plant Physiol 151 (2):603-619. doi:10.1104/pp.109.141770
Millar AH, Eubel H, Jänsch L, Kruft V, Heazlewood JL, Braun H-P (2004) Mitochondrial cytochrome c oxidase and succinate dehydrogenase complexes contain plant specific subunits. Plant Mol Biol 56 (1):77-90. doi:10.1007/s11103-004-2316-2
Millar AH, Heazlewood JL, Kristensen BK, Braun HP, Moller IM (2005) The plant mitochondrial proteome. Trends in plant science 10 (1):36-43. doi:10.1016/j.tplants.2004.12.002
Millar AH, Whelan J, Small I (2006) Recent surprises in protein targeting to mitochondria and plastids. Current Opinion in Plant Biology 9 (6):610-615. doi:https://doi.org/10.1016/j.pbi.2006.09.002
Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends in plant science 7 (9):405-410 Na U, Yu W, Cox J, Bricker DK, Brockmann K, Rutter J, Thummel CS, Winge DR (2014) The LYR factors SDHAF1 and
SDHAF3 mediate maturation of the iron-sulfur subunit of succinate dehydrogenase. Cell metabolism 20 (2):253-266. doi:10.1016/j.cmet.2014.05.014
Nie S, Yue H, Zhou J, Xing D (2015) Mitochondrial-Derived Reactive Oxygen Species Play a Vital Role in the Salicylic Acid Signaling Pathway in <italic>Arabidopsis thaliana</italic>. PLoS ONE 10 (3):e0119853. doi:10.1371/journal.pone.0119853
Niemeijer ND, Papathomas TG, Korpershoek E, de Krijger RR, Oudijk L, Morreau H, Bayley J-P, Hes FJ, Jansen JC, Dinjens WNM, Corssmit EPM (2015) Succinate Dehydrogenase (SDH)-Deficient Pancreatic Neuroendocrine Tumor Expands the SDH-Related Tumor Spectrum. The Journal of Clinical Endocrinology & Metabolism 100 (10):E1386-E1393. doi:10.1210/jc.2015-2689
Noguchi K, Terashima I (2006) Responses of spinach leaf mitochondria to low N availability. Plant, cell & environment 29 (4):710-719
O'Brien JA, Daudi A, Finch P, Butt VS, Whitelegge JP, Souda P, Ausubel FM, Bolwell GP (2012) A peroxidase-dependent apoplastic oxidative burst in cultured Arabidopsis cells functions in MAMP-elicited defense. Plant Physiol 158 (4):2013-2027. doi:10.1104/pp.111.190140
Oda K, Yamato K, Ohta E, Nakamura Y, Takemura M, Nozato N, Akashi K, Kanegae T, Ogura Y, Kohchi T, et al. (1992) Gene organization deduced from the complete sequence of liverwort Marchantia polymorpha mitochondrial DNA. A primitive form of plant mitochondrial genome. Journal of molecular biology 223 (1):1-7
Ohlenbusch A, Edvardson S, Skorpen J, Bjornstad A, Saada A, Elpeleg O, Gartner J, Brockmann K (2012) Leukoencephalopathy with accumulated succinate is indicative of SDHAF1 related complex II deficiency. Orphanet journal of rare diseases 7:69. doi:10.1186/1750-1172-7-69
Oyedotun KS, Lemire BD (1999) The Saccharomyces cerevisiae Succinate-ubiquinone Oxidoreductase: IDENTIFICATION OF SDH3P AMINO ACID RESIDUES INVOLVED IN UBIQUINONE BINDING. J Biol Chem 274 (34):23956-23962. doi:10.1074/jbc.274.34.23956
17
Oyedotun KS, Lemire BD (2001) The Quinone-binding sites of the Saccharomyces cerevisiae succinate-ubiquinone oxidoreductase. The Journal of biological chemistry 276 (20):16936-16943. doi:10.1074/jbc.M100184200
Oyedotun KS, Sit CS, Lemire BD (2007) The Saccharomyces cerevisiae succinate dehydrogenase does not require heme for ubiquinone reduction. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1767 (12):1436-1445. doi:https://doi.org/10.1016/j.bbabio.2007.09.008
Palmer JD, Adams KL, Cho Y, Parkinson CL, Qiu YL, Song K (2000) Dynamic evolution of plant mitochondrial genomes: mobile genes and introns and highly variable mutation rates. Proceedings of the National Academy of Sciences of the United States of America 97 (13):6960-6966
Quinlan CL, Orr AL, Perevoshchikova IV, Treberg JR, Ackrell BA, Brand MD (2012) Mitochondrial complex II can generate reactive oxygen species at high rates in both the forward and reverse reactions. The Journal of biological chemistry 287 (32):27255-27264. doi:10.1074/jbc.M112.374629
Raha S, Robinson BH (2000) Mitochondria, oxygen free radicals, disease and ageing. Trends Biochem Sci 25 (10):502-508
Rao MV, Davis KR (1999) Ozone-induced cell death occurs via two distinct mechanisms in Arabidopsis: the role of salicylic acid. The Plant Journal 17 (6):603-614. doi:10.1046/j.1365-313X.1999.00400.x
Raskin I, Ehmann A, Melander WR, Meeuse BJ (1987) Salicylic Acid: a natural inducer of heat production in arum lilies. Science 237 (4822):1601-1602. doi:10.1126/science.237.4822.1601
Roschzttardtz H, Fuentes I, Vasquez M, Corvalan C, Leon G, Gomez I, Araya A, Holuigue L, Vicente-Carbajosa J, Jordana X (2009) A nuclear gene encoding the iron-sulfur subunit of mitochondrial complex II is regulated by B3 domain transcription factors during seed development in Arabidopsis. Plant Physiol 150 (1):84-95. doi:10.1104/pp.109.136531
Schikowsky C, Senkler J, Braun H-P (2017) SDH6 and SDH7 Contribute to Anchoring Succinate Dehydrogenase to the Inner Mitochondrial Membrane in Arabidopsis thaliana. Plant Physiology 173 (2):1094-1108. doi:10.1104/pp.16.01675
Schilling B, Murray J, Yoo CB, Row RH, Cusack MP, Capaldi RA, Gibson BW (2006) Proteomic analysis of succinate dehydrogenase and ubiquinol-cytochrome c reductase (Complex II and III) isolated by immunoprecipitation from bovine and mouse heart mitochondria. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1762 (2):213-222. doi:https://doi.org/10.1016/j.bbadis.2005.07.003
Senaratna T, Touchell D, Bunn E, Dixon K (2000) Acetyl salicylic acid (Aspirin) and salicylic acid induce multiple stress tolerance in bean and tomato plants. Plant Growth Regulation 30 (2):157-161. doi:10.1023/a:1006386800974
Shah K, Kumar RG, Verma S, Dubey RS (2001) Effect of cadmium on lipid peroxidation, superoxide anion generation and activities of antioxidant enzymes in growing rice seedlings. Plant Science 161 (6):1135-1144. doi:https://doi.org/10.1016/S0168-9452(01)00517-9
Sun F, Huo X, Zhai Y, Wang A, Xu J, Su D, Bartlam M, Rao Z (2005) Crystal structure of mitochondrial respiratory membrane protein complex II. Cell 121 (7):1043-1057. doi:10.1016/j.cell.2005.05.025
Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA, Leaver CJ, Millar AH (2002) The impact of oxidative stress on Arabidopsis mitochondria. The Plant journal : for cell and molecular biology 32 (6):891-904
Tan YF, O'Toole N, Taylor NL, Millar AH (2010) Divalent Metal Ions in Plant Mitochondria and Their Role in Interactions with Proteins and Oxidative Stress-Induced Damage to Respiratory Function. Plant Physiol 152 (2):747-761. doi:10.1104/pp.109.147942
Taylor RW, Turnbull DM (2005) MITOCHONDRIAL DNA MUTATIONS IN HUMAN DISEASE. Nature reviews Genetics 6 (5):389-402. doi:10.1038/nrg1606
Torres MA, Dangl JL, Jones JD (2002) Arabidopsis gp91phox homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response. Proceedings of the National Academy of Sciences of the United States of America 99 (1):517-522. doi:10.1073/pnas.012452499
Tran QM, Rothery RA, Maklashina E, Cecchini G, Weiner JH (2007) Escherichia coli succinate dehydrogenase variant lacking the heme b. Proceedings of the National Academy of Sciences 104 (46):18007-18012. doi:10.1073/pnas.0707732104
Tsuda K, Sato M, Glazebrook J, Cohen JD, Katagiri F (2008) Interplay between MAMP-triggered and SA-mediated defense responses. The Plant journal : for cell and molecular biology 53 (5):763-775. doi:10.1111/j.1365-313X.2007.03369.x
Tuppen HAL, Blakely EL, Turnbull DM, Taylor RW (2010) Mitochondrial DNA mutations and human disease. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1797 (2):113-128. doi:http://dx.doi.org/10.1016/j.bbabio.2009.09.005
18
Van Vranken JG, Bricker DK, Dephoure N, Gygi SP, Cox JE, Thummel CS, Rutter J (2014) SDHAF4 promotes mitochondrial succinate dehydrogenase activity and prevents neurodegeneration. Cell metabolism 20 (2):241-252. doi:10.1016/j.cmet.2014.05.012
Van Vranken JG, Na U, Winge DR, Rutter J (2015) Protein-mediated assembly of succinate dehydrogenase and its cofactors. Critical Reviews in Biochemistry and Molecular Biology 50 (2):168-180. doi:10.3109/10409238.2014.990556
Vassileva V, Simova-Stoilova L, Demirevska K, Feller U (2009) Variety-specific response of wheat (Triticum aestivum L.) leaf mitochondria to drought stress. Journal of plant research 122 (4):445-454. doi:10.1007/s10265-009-0225-9
Vishwakarma A, Tetali SD, Selinski J, Scheibe R, Padmasree K (2015) Importance of the alternative oxidase (AOX) pathway in regulating cellular redox and ROS homeostasis to optimize photosynthesis during restriction of the cytochrome oxidase pathway in Arabidopsis thaliana. Ann Bot 116 (4):555-569. doi:10.1093/aob/mcv122
Wang H, Liang X, Huang J, Zhang D, Lu H, Liu Z, Bi Y (2010) Involvement of ethylene and hydrogen peroxide in induction of alternative respiratory pathway in salt-treated Arabidopsis calluses. Plant & cell physiology 51 (10):1754-1765. doi:10.1093/pcp/pcq134
Wiemerslage L, Lee D (2016) Quantification of mitochondrial morphology in neurites of dopaminergic neurons using multiple parameters. Journal of Neuroscience Methods 262:56-65. doi:https://doi.org/10.1016/j.jneumeth.2016.01.008
Wrzaczek M, Brosché M, Kangasjärvi J (2013) ROS signaling loops — production, perception, regulation. Current Opinion in Plant Biology 16 (5):575-582. doi:http://dx.doi.org/10.1016/j.pbi.2013.07.002
Yalpani N, Silverman P, Wilson TM, Kleier DA, Raskin I (1991) Salicylic acid is a systemic signal and an inducer of pathogenesis-related proteins in virus-infected tobacco. The Plant cell 3 (8):809-818
Yankovskaya V, Horsefield R, Tornroth S, Luna-Chavez C, Miyoshi H, Leger C, Byrne B, Cecchini G, Iwata S (2003) Architecture of succinate dehydrogenase and reactive oxygen species generation. Science 299 (5607):700-704. doi:10.1126/science.1079605
Yankovskaya V, Sablin SO, Ramsay RR, Singer TP, Ackrell BAC, Cecchini G, Miyoshi H (1996) Inhibitor Probes of the Quinone Binding Sites of Mammalian Complex II and Escherichia coli Fumarate Reductase. J Biol Chem 271 (35):21020-21024. doi:10.1074/jbc.271.35.21020
Yoshida S, Tamaoki M, Ioki M, Ogawa D, Sato Y, Aono M, Kubo A, Saji S, Saji H, Satoh S, Nakajima N (2009) Ethylene and salicylic acid control glutathione biosynthesis in ozone-exposed Arabidopsis thaliana. Physiologia plantarum 136 (3):284-298. doi:10.1111/j.1399-3054.2009.01220.x
18
Chapter Two:
Salicylic Acid-Dependent Plant Stress Signaling via
Mitochondrial Succinate Dehydrogenase
19
Abstract
Mitochondria are known for their role in ATP production and generation of reactive oxygen species,
but little is known about the mechanism of their early involvement in plant stress signaling. The role
of mitochondrial succinate dehydrogenase (SDH) in salicylic acid (SA) signaling was analyzed using two
mutants: disrupted in stress response1 (dsr1), which is a point mutation in SDH1 identified in a loss of
SA signaling screen, and a knockdown mutant (sdhaf2) for SDH assembly factor 2 that is required for
FAD insertion into SDH1. Both mutants showed strongly decreased SA-inducible stress promoter
responses and low SDH maximum capacity compared to wild type, while dsr1 also showed low
succinate affinity, low catalytic efficiency, and increased resistance to SDH competitive inhibitors. The
SA induced promoter responses could be partially rescued in sdhaf2, but not in dsr1, by supplementing
the plant growth media with succinate. Kinetic characterization showed that low concentrations of
either SA or ubiquinone binding site inhibitors increased SDH activity and induced mitochondrial H2O2
production. Both dsr1 and sdhaf2 showed lower rates of SA-dependent H2O2 production in vitro in line
with their low SA-dependent stress signaling responses in vivo. This provides quantitative and kinetic
evidence that SA acts at or near the ubiquinone binding site of SDH to stimulate activity and contributes
to plant stress signaling by increased rates of mitochondrial H2O2 production, leading to part of the SA-
dependent transcriptional response in plant cells.
20
Introduction
Within the mitochondrial electron transport chain, Complex II (succinate dehydrogenase [SDH])
oxidizes succinate to fumarate by transferring electrons to ubiquinone (UQ), which is reduced to
ubiquinol. The enzyme is formed by four subunits: a flavoprotein (SDH1), which contains the FAD
cofactor, an iron sulfur (Fe-S) protein (SDH2) housing three Fe-S clusters, and two small integral
membrane proteins (SDH3 and SDH4), anchoring the enzyme to the inner membrane and forming the
UQ binding site (Lemire and Oyedotun, 2002; Sun et al., 2005; Huang and Millar, 2013). Several
assembly factors have been identified that facilitate FAD and Fe-S insertion into SDH subunits (Ghezzi
et al., 2009; Hao et al., 2009) and one of these, SDHAF2, has been characterized in Arabidopsis
(Arabidopsis thaliana; Huang et al., 2013).
Complex I and III have been long considered to be the major sources of reactive oxygen species (ROS)
production inside mitochondria (mtROS), but recent studies in both mammals and plants have demon-
strated that Complex II can also be a significant source of mtROS (Quinlan et al., 2012; Jardim-Messeder
et al., 2015). In mammals, Complex II influences reperfusion injury through mtROS production via
reverse electron transport after succinate accumulation (Chouchani et al., 2014). However, the relative
importance of mtROS generated from Complex II in plants has been unclear, and knockout of the SDH
complex or its assembly factors in plants is lethal, largely preventing its direct study through gene
deletion in plants (León et al., 2007; Huang et al., 2013). This limitation changed when a point mutation
of SDH1-1 (dsr1) was identified that did not knockout SDH, but instead lowered SDH activity and
decreased mitochondrial ROS production. It was first identified as a mutant that had lost salicylic acid
(SA) but not H2O2-dependent stress response using a GST GSTF8 promoter stress response assay
(Gleason et al., 2011). The dsr1 mutant showed steady-state decrease expression of peroxidases,
glutaredoxins, and trypsin and protease inhibitor family genes and reduced expression on SA induction
of a set of SA-responsive genes normally induced in response to exposure of Arabidopsis to bacterial,
fungal, or viral pathogens (Gleason et al., 2011). The dsr1 mutant also had higher susceptibility to
fungal and bacterial pathogens, indicating that mitochondrial SDH is involved in response to biotic
stress in vivo in plants. However, despite this evidence for the involvement of a mutated SDH1 and
recovery of signaling when wild-type SDH1 was overexpressed (Gleason et al., 2011), it was still unclear
how a mutation in SDH such as dsr1 could affect mitochondrial ROS production and the downstream
stress response induced by SA.
SA acts as a hormone in plant processes like thermogenesis (Raskin et al., 1987), ethylene synthesis,
and fruit ripening (Leslie and Romani, 1988), but it also acts as a stress regulator during plant defense
21
response (Yalpani et al., 1991; Rao and Davis, 1999; Senaratna et al., 2000). Accumulation of SA is often
correlated with an increase in ROS production during plant stress response (for review, see Herrera-
Vásquez et al., 2015). A series of SA binding proteins has been identified, notably catalase (Chen et al.,
1993a), peroxidase (Durner and Klessig, 1995), and methyl-salicylate esterase (Forouhar et al., 2005)
that appear to explain this correlation, but their roles as general SA receptors have been controversial
(Bi et al., 1995; Attaran et al., 2009). Further sets of SA binding proteins in Arabidopsis have been
identified by affinity screens and include several mitochondrial enzymes and also GSTs including
GSTF8, which showed enzymatic inhibition by SA (Tian et al., 2012; Manohar et al., 2015). However, as
these enzymes are not classical transcription regulators, they are unlikely to directly regulate gene
expression. Recently, there is clear evidence for NON-EXPRESSOR OF PATHOGENESIS-RELATED GENES1
(NPR1), NPR3, and NPR4 acting together as SA receptors based on their binding properties, direct role
in defense gene expression, and their impact on disease resistance (Fu et al., 2012; Wu et al., 2012).
However, studies beyond defense responses have shown an involvement of SA in thermotolerance
and drought resistance combined with an induction of mitochondrial ROS production (Okuma et al.,
2014; Nie et al., 2015). SA at high concentration is also reported to act as an inhibitor of respiration in
isolated mitochondria, but applied in lower concentrations it has been shown to stimulate the
respiration rate of whole-cell tobacco (Nicotiana tabacum) culture (Norman et al., 2004). This indicates
the importance of kinetic analysis at an enzymatic level to uncover the role of SA in respiratory
responses in plants.
To define the role of SDH in this SA signaling process, we utilized two Arabidopsis mutant lines that
have decreased SDH1 function. The fortuitous dsr1 point mutation acts directly to reduce SDH1
function, while knockdown of an SDH assembly factor (sdhaf2) acts indirectly to limit the amount of
functional SDH1. We show that both mutants decrease SA-dependent promoter activity in vivo, with
dsr1 more effective than sdhaf2. Kinetic analysis of SDH activity in these lines showed that while both
mutants had reduced maximum capacity, dsr1 also differed in succinate affinity and enzymatic
efficiency. To determine the nature of the effect of SA and its interaction with SDH for stress signaling,
we measured the change in SDH activity in isolated mitochondria in the presence of different
concentrations of SA. We observed an SA-dependent increase of SDH activity in the presence of
micromolar SA concentrations but only when succinate-dependent electron transport was directed
through the UQ binding site of SDH, increasing the succinate:quinone reductase (SQR) activity. We
show that succinate-dependent mtROS production increased significantly after the addition of SA in
wild type, but less so in dsr1 and sdhaf2. In vivo, we showed that blocking SA-induced promoter activity
could be partially relieved in sdhaf2 by addition of exogenous succinate, but this was not possible with
dsr1, consistent with our analysis of the differing SDH kinetics in the two mutant lines. Together, this
22
provides quantitative and kinetic evidence for a direct involvement of SA in a SDH-dependent signaling
pathway in plants that involves mitochondrial ROS production.
Results
Altered Stress Promoter Response to Stress in dsr1 and sdhaf2
We previously identified a mutant (dsr1), carrying a single SDH1-1 point mutation, and demonstrated
a disruption in SA-induced promoter activity in these plants using a GSTF8 promoter-driven LUC
reporter assay (Gleason et al., 2011). While this effect was linked to SDH1 through a complementation
assay, it could not be independently confirmed with knockout plants, because loss of SDH1 is embryo
lethal in Arabidopsis (León et al., 2007; Huang et al., 2013). To independently investigate the link
between SDH and SA-induced GSTF8 response, we therefore crossed an SDH assembly factor
knockdown line, sdhaf2, that has lower SDH activity (Huang et al., 2013) with Col-0 containing the
GSTF8:luciferase (GSTF8:luc) reporter gene (JC66, referred to as wild type in this manuscript; Gleason
et al. (2011)). We then treated both mutant lines (dsr1 and sdhaf2) with SA to compare stress promoter
response of 4-d-old seedlings (Fig. 1A, at 7 mM SA; Supplemental Fig. S1, at 1 mM SA). Both mutants
showed low or no responses to the treatment compared to wild type (ANOVA P= 0.01); however, unlike
dsr1, sdhaf2 showed significant LUC expression above untreated samples at some time points in the
20-h period following SA application (Fig. 1A, posthoc pairwise test). This strengthened our previous
evidence for SDH being involved in SA signaling and showed the effect was independent of the specific
amino acid mutation in dsr1 (Gleason et al., 2011). Both dsr1 and sdhaf2 showed a significant LUC
expression following H2O2 treatment that was not significantly different from wild type (Supplemental
Fig. S1).
To further confirm that this signaling pathway was SDH dependent, the SDH inhibitor malonate was
added in concentrations of 5 and 10 mM to the growth media, and GSTF8 promoter response was
measured after SA treatment. No change in seedling growth and development could be observed in
the presence of malonate over a period of 4 d. However, 5 mM malonate could significantly reduce
the signal responses in wild type and sdhaf2 (ANOVA P≤ 0.01), but the induction of SA signaling in wild
type was still possible (Fig. 1B, posthoc pairwise test). At 10 mM, malonate inhibited the LUC promoter
response almost to zero in all genotypes (Fig. 1C). The reduction of stress promoter response that we
observed in both SDH mutant lines and the further inhibition of SDH by treatment with malonate in
wild type indicate that the degree of function of the SDH enzyme can titrate the degree of stress
signaling via this pathway.
23
Figure 1: GSTF8:luc induction in sdhaf2 and dsr1 after SA treatment compared to wild type. Average of total fluorescence signal generated by each seedling (n = 10) per hour after treatment of 7 mM SA in the presence of 0 mM (A), 5 mM (B), and 10 mM (C) malonate (mal) in the growth media. Two-factor ANOVA between genotypes (P≤ 0.01), posthoc Tukey test comparing signal induction to time point zero within genotype *P≤ 0.05; **P≤ 0.01.
Catalytic Efficiency of SDH is Significantly Lower in dsr1
To further characterize the GSTF8 promoter response in dsr1, sdhaf2, and wild type, we investigated
the kinetics of SDH activity in these lines using phenazine methosulfate (PMS) and dichlorophenol-
indophenol (DCPIP; Fig. 2A). We isolated mitochondria from each line and compared the SDH
enzymatic catalytic efficiency and substrate affinity using Michaelis-Menten kinetics and Brooks Kinetic
Software (Brooks, 1992).
To calculate the Km of succinate for SDH, a series of succinate concentrations ranging from 0.1 to 10
mM were used for SDH activity measurements (Fig. 2B). Comparing the activity between genotypes
over the range of different succinate concentrations, sdhaf2 and wild type shared a similar trend
(ANOVA P= 0.1), but dsr1 showed significantly lower activity than wild type and sdhaf2 (ANOVA P<
0.01), even when a high concentration of succinate was applied, demonstrating a probable difference
24
in succinate affinity between the two mutants. Looking at the maximum velocity, measured at
saturating concentration of succinate (10 mM), there was a significant distinction in both mutant lines
compared to wild type (Fig. 2C). It should be noted that in the case of sdhaf2, the lower amount of the
SDH enzyme (one-half compared to wild type) is responsible for the lower activity rate per mg
mitochondria (Huang et al., 2013), whereas in dsr1 the same amount of SDH enzyme as wild type is
present in mitochondria (Gleason et al., 2011). Calculation of the Km (succinate) value of SDH (Fig. 2D)
showed that dsr1 had a significantly higher Km than wild type and sdhaf2. A concentration slightly
above 0.4 mM of succinate was required to reach one-half maximum velocity in wild type and sdhaf2,
but over twice as much substrate concentration was needed for dsr1 (0.86 mM). The catalytic
efficiency (Vmax/Km), which takes catalytic potential (activity rate at saturating succinate concentration)
and enzyme affinity for its substrate (Km) into account, was 3-fold lower in dsr1 compared to wild type
and sdhaf2 (Fig. 2E), showing that dsr1 was kinetically distinguishable from sdhaf2.
25
Figure 2. Lower succinate affinity and catalytic efficiency in dsr1. Concentrations of 0.1 to 10 mM of succinate were used to calculate maximal SDH activity, measured as absorbance change of DCPIP at 600 nm. Km (succinate) of SDH was calculated using Hanes-Plot and Brook Kinetics Software. A, Scheme of SDH showing electron transfer from succinate to UQ binding site. B, correlation of SDH activity and succinate concentrations of the wild type, sdhaf2, and dsr1. C, Maximal enzyme velocity (Vmax). D, Calculated Km of succinate for SDH using Brooks kinetic software. E, catalytic efficiency (µmol DCPIP/min) for sdhaf2 and dsr1. SE of six biological replicates. Two-factor ANOVA comparing SDH activity between genotypes (B) P≤ 0.01 (dsr1 compared to the wild type and sdhaf2). Single-factor ANOVA comparing catalytic efficiency and succinate affinity (D and E) between genotypes. Different letters indicate significant differences (P≤ 0.05) between genotypes. n.d., not detected.
26
dsr1 Shows Lower Affinity to the Competitive Inhibitors Malonate and OAA
The changes in SDH kinetics observed in dsr1 were most likely caused by the point mutation that occurs
in the substrate binding site. To further prove that this causes a change in the binding affinity, the
competitive inhibitor malonate together with a low concentration (Km (succinate) value of SDH) of
succinate were added to isolated mitochondria from each genotype and SDH activity was measured.
Because of the low catalytic efficiency of dsr1, twice as much succinate was used in the assay to reach
one-half maximum velocity (0.5 mM for the wild type and sdhaf2; 1 mM for dsr1). Using malonate
concentrations in a range from 10 to 100 µM (Fig. 3A, top), inhibition of SDH activity was calculated to
determine the IC50 value for malonate. The inhibition in dsr1 has less effect on enzyme activity when
compared to wild type and sdhaf2, showing that a higher concentration of inhibitor is necessary to
inhibit SDH in dsr1. An IC50 value of ~70 µM of malonate was determined for dsr1 compared to a IC50
of ~20 µM for wild type and sdhaf2 (Fig. 3B). To confirm that the changes in malonate inhibition were
independent of the higher concentration of succinate used in the assay for dsr1, the assay was
repeated with a saturating (5 mM) concentration of substrate (Supplemental Fig. S2A). A significant
inhibition in wild type and sdhaf2 could be reached using 0.1 (wild type) and 0.5 mM (sdhaf2)
malonate. But for dsr1, no significant inhibition was caused, and SDH was not significantly inhibited
even when a concentration of 1 mM was applied. A significantly higher IC50 of 0.4 mM was calculated
for dsr1 compared to ~0.2 mM for sdhaf2 and wild type (Supplemental Fig. S2B). Based on these kinetic
results, we hypothesized that other succinate competitive inhibitors would also show a lower binding
affinity in dsr1. We applied a second, physiologically more relevant competitive inhibitor, oxaloacetic
acid (OAA), together with the same succinate concentrations used in the malonate assay (Fig. 3A,
bottom) to isolated mitochondria. A significantly higher IC50 of 9.6 µM of OAA for dsr1 compared to 7
µM and 6.2 µM for sdhaf2 and wild type was calculated (Fig. 3B). Together, these findings
demonstrated that the single point mutation in dsr1 changed the kinetics of SDH and led to a lower
binding affinity for the substrate succinate, which results in a lower catalytic efficiency as well as a
lower affinity for the competitive inhibitors malonate and OAA. This is a clear distinction to the
knockdown line sdhaf2, which has reduced SDH1-1 content (Huang et al., 2013) but does not show any
kinetic alterations compared to wild type (Figs. 2 and 3).
27
Figure 3. IC50 of SDH competitive inhibitors malonate and oxaloacetate are higher in dsr1. Inhibition of SDH was measured using increasing amounts of malonate and OAA together with the Km concentration of succinate (0.5 mM for wild type and sdhaf2; 1 mM for dsr1). IC50 was calculated using Brooks Kinetic Software. A, Percentage inhibition of SDH activity in the presence of malonate and OAA. B, Calculated IC50 of malonate (left) and OAA (right). SE of four biological replicates. Single-factor ANOVA comparing IC50 between genotypes. Different letters indicate significant differences, P≤ 0.07.
28
High Concentrations of Succinate Stimulate Stress Promoter Response in sdhaf2 But Not in dsr1
Because our data showed that dsr1 has a low affinity for succinate compared to sdhaf2 and wild type
(Fig. 2, C–E), we investigated if succinate itself would enhance SA-induced signaling. We repeated the
GSTF8:luc assay with 20 mM succinate added to the growth media. No significant induction of
promoter activity could be measured in dsr1 when succinate was present (Fig. 4, bottom), presumably
due to its very low catalytic efficiency. However, the promoter activity in sdhaf2 was significantly
induced within 3 h after the SA treatment in the presence of added succinate (Fig. 4, bottom, posthoc
pairwise test). Because sdhaf2 shares the same SDH kinetic features as wild type, we hypothesized a
higher amount of succinate might induce a higher signal response in wild type; however, the signal
was apparently already saturated by the higher SDH enzymatic activity. Nevertheless, we observed a
shift in signal response in wild type, leading to an earlier peak of signal induction. Higher amounts of
succinate might not further increase the signal in the wild type but could possibly cause a faster
response that also declines more rapidly compared to no additional succinate (Fig. 4, bottom).
Figure 4: SA-induced GSTF8 signal can be rescued in sdhaf2 using high concentrations of succinate. Average of total fluorescence signal generated by each seedling (n = 10) per hour after treatment of 7 mM SA in the presence of 0 (top) and 20 mM succinate (succ, bottom) in the growth media. Error bars: SE, posthoc Tukey test comparing signal induction to time point zero within genotype, *P≤ 0.05, **P≤ 0.01.
29
Low Concentrations of SA Increase SQR Activity
To investigate the role of SA and its interaction with SDH during stress signaling, SQR activity in the
presence of SA (0.01– 0.05 mM) was measured in isolated mitochondria using different electron
acceptors. No significant effect of SA was observed for measurements of succinate-dependent DCPIP
reduction in the presence of PMS that enables direct acceptance of electrons from the flavin in SDH1
(Figs. 2A and 5A). However, within SDH, electrons are normally transferred from the succinate binding
site in SDH1, through SDH2, and finally to the UQ binding site in the membrane. When the assay was
repeated, measuring electron transfer to coenzyme Q1 and then to DCPIP (Fig. 2A), a significant
increase in SQR activity was observed in the presence of SA (Fig. 5B; Supplemental Fig. S3A;
Supplemental Table S1). This suggested that the interaction of Complex II with SA occurred not at the
succinate binding site, but along the electron transfer to UQ or even directly at the UQ binding site.
For both mutant lines, a significant increase in electron flow could be measured following SA addition
(Supplemental Fig. S3A; Supplemental Table S1), but their overall activity response was lower
compared to wild type (ANOVA P< 0.05). dsr1 showed the lowest SA-induced activity, significantly
distinguishable from both sdhaf2 (ANOVA P= 0.04) and the wild type (ANOVA P< 0.01). Previous studies
suggested Complex III contained a potential SA binding protein (Nie et al., 2015) and showed inhibition
of Complex III activity in the presence of 0.1 and 0.5 mM SA. To confirm whether Complex III activity
would be affected by SA, we performed an activity assay using cytochrome c (cyt c) and ubiquinol- 10
as substrates and added SA concentrations from 0.01 to 1 mM to the assay (Supplemental Fig. S4).
Enzyme activity was determined spectrophotometrically, following the reduction of cyt c. In our hands,
no significant differences could be observed in either the genotypes or the response to the SA
treatment (Supplemental Fig. S4), confirming that the SA effect observed in this study is Complex II
dependent (Fig. 5B). To further investigate the hypothesis that SA interacts with SDH at the UQ site,
compounds known to bind to the UQ site (thenoyltrifluoroacetone (TTFA), carboxin) were added at
similar concentrations to SA (Supplemental Fig. S5, A and B). SQR activity showed a significant increase
in wild type in the presence of TTFA, and a similar trend was observed in carboxin treatment. Both
TTFA and carboxin are commercial Complex II inhibitors with a reported IC50 of 5.8 µM and 1.1 µM in
mammals (Miyadera et al., 2003). Nevertheless, using wild-type Arabidopsis, in our hands, low
concentrations of these inhibitors appear to stimulate significantly the electron flow to UQ in a similar
manner and at similar concentrations to SA, leading to a faster reduction of DCPIP and a higher SQR
activity. Inhibition in Arabidopsis mitochondria was achieved using concentrations of 1 mM
TTFA/carboxin (Supplemental Fig. S5), consistent with other reports in Arabidopsis (León et al., 2007;
Jardim-Messeder et al., 2015).
30
To determine if this increased electron transfer to Q1 in the presence of low concentrations of SA would
also be observed via UQ to O2 in intact mitochondrial electron transport, isolated mitochondria of
sdhaf2 and dsr1 were treated with SA in the presence of 5 mM succinate, and oxygen uptake was
measured using a Clark type oxygen electrode. No significant changes in respiration rate across the
lines could be observed after adding low concentrations of SA (Fig. 5C; Supplemental Fig. S3B;
Supplemental Table S1). Using higher concentrations of SA (0.1–1 mM), a gradual inhibition of
respiration rate could be observed (Fig. 5D; Supplemental Fig. 3B; Supplemental Table S1), which is
consistent with previous studies (Norman et al., 2004). This suggested that enhanced electron transfer
from the UQ site to DCPIP in the presence of SA is not observed to significantly increase total
respiratory rate in isolated mitochondria ending in the respiratory oxidases.
To test whether other ETC complexes were affected in these genotypes, O2 uptake in the presence of
SA was measured using the substrates NADH, and malate with glutamate (Supplemental Fig. S6A). All
genotypes showed sufficient oxygen consumption with these substrates, and no significant differences
were observed between the mutants and wild type. Also, no inhibitory effect of SA was observed with
either substrate. This confirmed that the decrease in basal respiration observed in dsr1 and sdhaf2
(Fig. 5, C and D) was specific to succinate and Complex II.
31
Figure 5. Low concentrations of SA increase SQR activity. A, SDH activity measured at the succinate binding site (PMS + DCPIP) in the presence of SA. B, SQR activity measured at UQ binding site (Q1 [80 µM] + DCPIP) in the presence of SA. As a negative control, activity was measured in the absence of Q1 in wild-type mitochondria (yellow bars). In both cases, SDH activity was measured in µmol DCPIP/min/mg Mit. in the presence of 5 mM succinate and SA concentrations ranging from 0.01 to 0.05 mM. C and D, Succinate-dependent oxygen consumption was measured using a Clark type oxygen electrode in the presence of 5 mM succinate and SA concentrations ranging from 0.01 to 1 mM. Fisher’s LSD test was used to determine differences (different letters indicate significant differences; for P values and letter distribution, see Supplemental Table S1 and Supplemental Fig. S3); P≤ 0.05.
Low Concentrations of SA Induce Mitochondrial H2O2 Production
While respiration rate was not affected by low concentrations of SA, another possibility was that
leakage of electrons occurs at the UQ site, which would result in partial reduction of oxygen and the
formation of reactive oxygen species (ROS) such as O2- and H2O2. As ROS production is typically only
3% to 4% of the total respiratory rate, we might not expect to see these changes by monitoring total
O2 consumption (Kudin et al., 2004; Andreyev et al., 2005). To test this hypothesis, freshly isolated
mitochondria from plants were treated with SA (0.03 mM) in the presence of 5 mM succinate and 0.5
mM ATP (Fig. 6). We measured succinate-dependent mitochondrial H2O2 production using the
fluorescent dye 2’, 7’-dichlorofluorescein diacetate (DCFDA; Fig. 6). O2- has a short lifetime and is a
highly reactive molecule that is rapidly converted into H2O2. H2O2 is able to leave the mitochondrion
(Henzler and Steudle, 2000; Bienert et al., 2007). Therefore, the resulting reactive oxygen species that
are measured using DCFDA can be assumed to be H2O2. To determine the basal rate of mitochondrial
32
H2O2 production, 5 mM succinate and 0.5 mM ATP were added to isolated mitochondria as SDH gets
allostericially activated by ATP (Gutman et al. 1971; Huang and Millar 2013). To determine if any
background fluorescence signal occurred, negative controls for all assays were used (Supplemental Fig.
S7). These controls showed that a background signal did occur with just mitochondria and in the
absence of respiratory substrate in the sample (Supplemental Fig. S7). Adding SA in the absence of
respiratory substrate to these samples increased the signal significantly, giving the impression of a high
ROS induction, but the actual difference in signal intensity between the plus and minus succinate
samples shows that only a small fraction of this signal is succinate-dependent (Supplemental Fig. S7).
This fraction was taken as the actual succinate dependent H2O2 production value in our measurements
(Fig. 6). Both dsr1 and sdhaf2 lines have a lower basal rate of H2O2 production when compared with
wild type (Fig. 6). Antimycin A (AA) was used as a positive control, as it is known to induce production
of H2O2 (Dröse and Brandt, 2008), and we observed a significant increase in H2O2 generation when AA
was added to mitochondria from all genotypes. To investigate the SA effect on H2O2 production, 0.03
mM SA together with succinate and ATP were added to mitochondria. Adding SA caused a significant
inductioninH2O2 production compared to the basal rate (Fig. 6), but the overall rate of H2O2 production
was still lower in both mutant lines, which showed no significant difference in SA induction compared
to the AA treatment.
To test whether other ETC complexes could be a source of SA-stimulated ROS production, as was
reported in previous studies (Nie et al., 2015), we measured H2O2 production in the presence of NADH
and malate together with glutamate (Supplemental Fig. S6B). In our hands, we did not observe any
significant ROS production above the background signal without any substrates, as well as no
differences between genotypes. Nie et al. (2015) did not use controls in their experiments to show the
effects observed were dependent on the presence of respiratory substrates. Their measured signals
and SA responses may come from background reactions independent of an active respiratory system
inside mitochondria.
33
Figure 6. mtH2O2 production is lower in dsr1 and sdhaf2. mtH2O2 production was measured using DCFDA with excitation/emission wavelengths of 490/520 nm. Succinate (5 mM), 0.5 mM ATP, 5 µM AA, and 0.03 mM SA were added to freshly isolated mitochondria immediately before the measurement. Fluorescence intensity was measured over 10 min and the rate of fluorescence/min was calculated. SE of eight biological replicates. Wilcoxon signed rank test between genotypes, different letters indicate significant differences, P≤ 0.05.
34
Discussion
SDH-Deficient Plants Show Altered SA-Dependent Signaling Responses
In plants, GSTs are induced by SA, ROS (H2O2), and biotic/abiotic stresses (Moons, 2005), and GSTF8 is
a well-described representative marker for early stress/ defense gene induction (Chen et al., 1996;
Sappl et al., 2009). In this study, we show that the lack of induction of GSTF8:luc by SA in dsr1 (Gleason
et al., 2011) can be mimicked by reduced FAD insertion and assembly of SDH1-1 through knockdown
of the SDH assembly factor SDHAF2. This strengthens the hypothesis that quantitative changes in SDH
function are required for at least one pathway of SA-induced signaling in plants. The level of promoter
activity observed in the sdhaf2 background was between that of dsr1 and wild type (Fig. 1A;
Supplemental Fig. S1, top) demonstrating that the impairment in sdhaf2 was not completely disabled
like it was in dsr1, which showed no induction in signal at any time point (Fig. 1A; Supplemental Fig.
S1, top). Addition of the SDH competitive inhibitor malonate confirmed that the SA-induced signal is
SDH dependent and that it can be titrated, even in wild type (Fig. 1, B and C).
Despite general similarities between dsr1 and sdhaf2 in promoter activities, the GSTF8:luc signal could
be partially rescued in sdhaf2 by the addition of excess succinate, suggesting some different properties
of SDH in the two mutants. Kinetic analysis in dsr1 showed that the SDH enzyme has a significant
difference in succinate affinity, catalytic efficiency, and inhibition by competitive inhibitors
malonate/OAA compared to the wild type (Fig. 2, B and C). This made sense, as dsr1 has a point
mutation located at the succinate binding site, which leads to an amino acid change from Ala to Thr
(A581T; Gleason et al., 2011). This change appeared to cause a lower affinity for succinate and
therefore a lower catalytic efficiency in dsr1 (Fig. 2, D and E). Alteration in SDH kinetics has also been
shown in human SDH1 mutations. A point mutation A409C in the succinate binding site of SDH1 led to
a 50% reduction of SDH activity and caused optic atrophy and myopathy (Birch-Machin et al., 2000;
Sun et al., 2005). Mutation of R554Y in SDH1 caused an unstable SDH1 helix domain and also a 50%
decrease in SDH activity and loss of ATP activation resulting in the neurodegenerative disorder Leigh-
like syndrome (Bourgeron et al., 1995; Sun et al., 2005). To our knowledge, dsr1 is the first SDH1
mutation shown to alter the Km of the enzyme for succinate.
These data infer that a certain threshold of SDH activity is required to induce the GSTF8 SA-dependent
promoter stress signal. This activity threshold cannot be reached in dsr1, and even with higher amounts
of succinate no signal induction and no GSTF8 promoter response occurred (Fig. 4, bottom), leading to
pathogen susceptibility (Gleason et al., 2011). This shows that a relatively subtle change in the Km of a
metabolic enzyme can produce a binary switch in stress signaling, raising the possibility that natural
35
variation in metabolic kinetics could be acted upon to improve plant stress sensitivity and tolerance to
pathogens. In addition, endogenous inhibitors of SDH like oxaloacetate and malonate act as
competitive inhibitors and therefore will change the apparent Km for succinate of SDH, thus acting
dynamically in a manner not unlike the dsr1 mutation, as illustrated by the effect of malonate on wild-
type signaling (Fig. 1, B and C).
Low Concentrations of SA Increase SQR Activity
SA is an effective signaling molecule, and only micromolar concentrations are required for these effects
inside plant cells (Raskin et al., 1987; Wu et al., 2012). The basal level of SA can vary between species
and even within the same plant family (Raskin et al., 1990). For Arabidopsis, basal levels of SA between
2 µmol and 8 µmol g-1 FW have been reported (Brodersen et al., 2005; Klessig et al., 2016; Nawrath
and Métraux, 1999; Wildermuth et al., 2001), with SA rising to ~40 µmol g-1 FW during infection, which
has been equated to ~70 µM inside infected plant cells (Bi et al., 1995). The importance of SA in
response to biotic and abiotic stress and its involvement in the transcriptional regulation of defense
genes has been extensively studied and reviewed (Herrera-Vásquez et al., 2015). Previous studies of
the effect of SA on respiration have focused on the notion of this hormone as an inhibitor and
uncoupler of the respiratory chain at concentrations >100 µM (Norman et al., 2004), but no systemic
investigations of the effect of low µM levels on respiratory functions have been undertaken. We show
here that SA influences the function of Complex II at concentrations as low as 10 µM SA when applied
to isolated mitochondria (Fig. 5B), potentially placing the effects in the physiological range for
Arabidopsis and other SA binding proteins in plants with NPR4 and NRP3 having an SA affinity in
nanomolar and micromolar range (Fu et al., 2012; Moreau et al., 2012) as well as several potential
effector proteins (catalase, ascorbate peroxidase, carbonic anhydrase) that bind SA with an affinity of
3.7 to 14 µM (Chen et al., 1993a, 1993b; Durner and Klessig, 1995; Slaymaker et al., 2002).
SA Likely Interacts with the UQ Binding Site of Complex II
We show the effect of SA on SDH activity did not occur when electrons were accepted directly from
SDH1, but only when they were accepted via a quinone. A chemical reaction between SA and the
acceptor DCPIP can be excluded, as only very low activity was measured when no Q1 was present in
the sample (Fig. 5B), showing that SA together with Q1 is necessary to allow the induction in activity.
This implies that SA does not act via the succinate binding site of SDH1 but instead via or near the UQ
binding site of SDH (Fig. 5, A and B). We also show that known UQ binding site inhibitors (TTFA,
carboxin) can lead to an increase in SQR activity at low micromolar concentrations (Supplemental Fig.
S5). TTFA and carboxin are generally described as Complex II inhibitors in mammalian and plant
systems, causing decreased SQR activity and mitochondrial respiration rates at high micromolar to
36
millimolar concentrations (Ramsay et al., 1981; Miyadera et al., 2003; León et al., 2007; Byun et al.,
2008; Jardim- Messeder et al., 2015). As noted previously, sensitivity of SQR to these inhibitors varies
between different species; mammals show a very high sensitivity with IC50 values in micromolar
concentrations (Miyadera et al., 2003), whereas Arabidopsis SQR is less sensitive, showing inhibitory
effects at millimolar concentrations (Supplemental Fig. S5; León et al. (2007); Jardim-Messeder et al.
(2015)). It has also been shown that TTFA binds to a site within SDH3/4 based on x-ray crystallography
(Sun et al., 2005). Two binding sites in SDH for quinones have been described for mammals and
Escherichia coli (Yankovskaya et al., 2003; Sun et al., 2005): one site (Qp), located on the matrix side,
and a second (Qd) near the intermembrane space site (Hagerhall 1997). UQ reduction is a single
electron two-step transfer, forming an ubisemiquinone after the transfer of the first electron, before
the complete reduction to ubiquinol occurs following the acceptance of the second electron (Hagerhall
1997). Inhibitors like TTFA are proposed to block the electron transfer between these two sites, causing
electron leakage (Yankovskaya et al., 2003). SA may act similarly to these inhibitors and prevent
complete reduction of UQ by blocking the electron transfer from Qp to Qd, which could cause electron
leakage. Structural similarity between UQ, TTFA, and carboxin is not high in strictly chemical terms, but
it would appear that SA could structurally mimic some features of both UQ and/or these inhibitors
(Supplemental Fig. S8). If SA binds to membrane-embedded SDH3/4 at the UQ binding site as
proposed, then this may explain why SDH subunits have not been identified in affinity assay screens
for SA binding in Arabidopsis that focused on soluble proteins (Manohar et al., 2015; Tian et al., 2012).
Neither the point mutation in dsr1 nor the assembly defect in sdhaf2 should affect the UQ site directly,
and we did not observe a difference in the SA effect on SQR activity in either line. Although both mutant
lines show SA induction, their overall SA-induced SQR activity level was still significantly lower than
wild type and this threshold could be the basis of these mutant effects.
Previous studies have reported Complex III as a potential SA binding enzyme (Nie et al., 2015). Within
this study, we could not observe any SA effect on Complex III activity in any of the lines; neither was
there a genotypic difference among the SA treatments (Supplemental Fig. S4). Our results also showed
that only when using succinate as substrate, and not when using NADH or malate + glutamate, could
SA drive H2O2 production above background levels in the absence of respiratory substrates. This
strengthens our hypothesis that Complex II has a SA binding site near the UQ site and is the major
source of H2O2 in Arabidopsis mitochondria.
37
SA Stimulates SDH-Dependent H2O2 Production
The effect of SA stimulation of SDH activity in a manner associated with the UQ binding site could lead
to reactions with oxygen to form ROS including superoxide (O2-). Within mitochondria, superoxide is
rapidly dismutated by MnSOD to form H2O2. Our previous study showed a clear correlation between
SA treatment and accumulation of H2O2 (Gleason et al., 2011). Wild-type seedlings treated with SA and
the H2O2 scavenger catalase showed a reduced GSTF8 signal, showing that this signaling pathway is
H2O2 dependent (Gleason et al., 2011). We also showed that exogenous H2O2 induces GSTF8 response
in wild type as well as in sdhaf2 and dsr1, indicating that SDH is involved upstream of ROS signaling
(Supplemental Fig. S1, bottom). We measured ROS in isolated mitochondria in the presence and
absence of SA, together with succinate and ATP, using DCFDA as a fluorescent marker of H2O2 (Fig. 6).
DCFDA reacts with any ROS, but as O2- is highly reactive, unstable, and non-membrane permeable,
H2O2 is the ROS that dominates DCFDA fluorescence in isolated mitochondria (Bienert and Chaumont,
2014; Huang et al., 2016). Both mutant lines show a lower basal H2O2 production rate compared to
wild type. Micromolar concentrations of SA induced H2O2 production in all genotypes, but significantly
less in the mutant lines compared to wild type (Fig. 6) and not significantly higher compared to AA
treatment. Lower H2O2 production in both lines can be explained by their decreased SDH activity (Fig.
2B), even when stimulated by SA at the UQ site (Fig. 5B). Due to the lower rate of succinate oxidation
in dsr1 and sdhaf2, fewer electrons are transferred to the UQ pool, decreasing its redox poise and
slowing the rate of side reactions that would lead to superoxide and then H2O2 production. It appears
that a threshold of SDH activity needs to be reached for increased H2O2 production to occur. This
observation of enzymatic dependency is similar to the threshold we observed in the GSTF8:luc
induction by SA (Figs. 1 and 4; Supplemental Fig. S1). Considering that sdhaf2 compared to dsr1 showed
a higher GSTF8 promoter signal in the presence of exogenous succinate addition, one might expect to
measure a higher H2O2 production in this line as well, but this could not be observed (Fig. 6).
Differences in the mutants downstream of the SA stress signal pathway might occur to explain these
observations.
We noted earlier that we observed a significant background signal with DCFDA that is caused by
reactions independent of the respiratory substrate (Supplemental Fig. S7). We found it essential to run
control samples parallel to the actual samples to exclude background signals (Fig. 6) that might be
caused by site reactions in the sample itself or the auto-fluorescence of other sample components.
Previous studies investigated the effect of SA in mitochondrial ROS production in Arabidopsis and
reported a significant ROS induction after SA addition (Jardim- Messeder et al., 2015). However, no
negative controls were used to exclude substrate-independent signals, which could mean that the
actual substrate-dependent signal was significantly lower. In another study, H2O2 production in
38
isolated mitochondria has been measured in the presence of different SA concentrations and different
substrates for Complex I and Complex II (Nie et al., 2015). A very high induction of H2O2 production
was shown after SA was added, but this study also lacks a negative control without substrate.
Therefore, the scale of the measured signals in these reports might need reconsideration, as they could
be substrate independent and might be mainly caused by background signals occurring in both assays.
We did not observe any significant ROS production above background signals when NADH or malate
together with glutamate was used as substrate (Supplemental Fig. S6B), showing that firstly, negative
controls without any substrate are essential to determine that any significant signal is not independent
of mitochondrial respiration and secondly, that succinate together with SA drives enhanced H2O2
production. This demonstrates that Complex II can act as a major source of ROS production with higher
rates than Complex I,III or alternative NADH dehydrogenases, a phenomenon that has previously be
shown in mammalian mitochondria where SDH was found to produce the highest amounts of ROS
(Ralph et al., 2011; Quinlan et al., 2012; Dedkova et al., 2013) and recently in barley (Hordeum vulgare)
roots, where Complex II-derived ROS was shown to be the major source of mitochondrial ROS during
mercury toxicity (Tamás and Zelinová, 2017).
The interplay between SA and H2O2 and which of these molecules acts first in plant defense appear to
vary depending on the pathway being examined (Vlot et al., 2009). We have previously shown that
GSTF8 regulation is H2O2 dependent (Gleason et al., 2011; Supplemental Fig. S1, bottom) and that
accumulation of H2O2 follows the SA effect and quantitatively depends on the degree of function of
the mitochondrial SDH complex. Earlier studies also showed that SA can enhance H2O2 production
(Shirasu et al., 1997). Recent studies identified GSTF8 as a SA binding protein (Manohar et al., 2015;
Tian et al., 2012), but the biological consequences of that interaction and whether it is involved in
stress signaling remain unclear. Based on our data, it does not seem to interact with GSTF8:luc
signaling, as dsr1 does not show a signal response after SA treatment (Fig. 1; Supplemental Fig. S1,
top).
Besides mitochondria, ROS are also produced in the apoplast, chloroplasts, and peroxisomes (Love et
al., 2008; Vlot et al., 2009; Herrera-Vásquez et al., 2015) under different stress conditions, and the
interaction between organelles is important for an efficient stress response (Herrera-Vásquez et al.,
2015). Microarray analysis showed that 18 genes were differentially expressed after SA treatment in
dsr1 vs wild type (Gleason et al., 2011), showing that SA induces only a selection of plant defense genes
via this pathway and, notably, it does not directly affect the expression of classical NPR1 targets
(Gleason et al., 2011). The SDH-dependent SA pathway described here is thus one part of SA signaling
39
in plants that likely operates independently of how SA is perceived via NPR1/3/4 in plants and in
parallel to other ROS-linked pathways that depend on SA-binding proteins (Moreau et al., 2012).
Finally, our results add to a growing body of work showing the importance of mitochondria in plant
stress/defense responses (Huang et al., 2016), at least in part through the increased production of
H2O2 from mitochondrial respiratory complexes.
40
Materials and Methods
Growth of Arabidopsis Hydroponic Plants
Arabidopsis (Arabidopsis thaliana; Col-0) transgenic lines (JC66, called wild type throughout the
manuscript), dsr1, and sdhaf2 mutant seeds were washed in 70% (v/v) ethanol for 2 min and in
sterilization solution (5% [v/v] bleach, 0.1% [v/v] Tween 20) for 5 min with periodical shaking. Seeds
were washed five times in sterile water before being dispensed into 250-mL plastic vessels containing
80 mL of half-strength Murashige and Skoog (MS) media (without vitamins, half-strength Gamborg B5
vitamin solution, 5 mM MES, and 2.5% [w/v] Suc, pH 7). Hydroponic cultures were grown under a 16-
h-light/8-h-dark period with light intensity of 100 to 125 µmol m2 s-1 at 22°C shaking at 220 rpm for 2
weeks or continuously in the dark for the DCFDA measurements.
GSTF8:luc Signaling of Arabidopsis Seedlings
Four-day-old seedlings of wild type, dsr1, and sdhaf2 (in the JC66 background) were grown on MS
media plus luciferin. 1/2 MS medium without vitamins, 1% (w/v) Suc, pH 7.0, 50 µM luciferin (Biosynth)
with or without malonate or succinate using 92 x 16 mm petri dishes as described previously (Gleason
et al., 2011). After incubation with 7 mM SA for 40 min, whole plant bioluminescence was captured
over 24 h using a NightShade imager (Berthold Technologies with data calculated in average light units
(counts/s) per seedling using IndiGo (v 2.0.3.0) software (Berthold Technologies).
Isolation of Mitochondria from Hydroponic Cultures
Mitochondria were isolated from 2 week old hydroponically grown Arabidopsis plants using a
previously described method from Millar et al. (2001), with slight modifications. Plant material was
homogenized in grinding buffer (0.3 M Suc, 25 mM tetrasodium pyrophosphate, 1% [w/v] PVP-40, 2
mM EDTA, 10 mM KH2PO4, 1% [w/v] BSA, and 20 mM ascorbic acid, pH 7.5) using mortar and pestle
for 2 to 5 min, twice. The homogenate was filtered through four layers of Miracloth and centrifuged at
2, 500 g for 5 min; the resulting supernatant was then centrifuged at 14, 000 g for 20 min. The resulting
pellet was resuspended in Suc wash medium (0.3 M Suc, 0.1% [w/v] BSA, and 10 mM TES, pH 7.5) and
carefully layered over 35 mL PVP-40 gradient (30% Percoll and 0– 4% PVP). The gradient was
centrifuged at 40, 000 g for 40 min. The mitochondrial band was collected and washed three times in
Suc wash buffer without BSA at 20, 000 g for 20 min.
41
Measurement of SDH Activity and Kinetic Calculations
SDH activity was measured directly at the subunit SDH1-1 by succinate-dependent DCPIP reduction at
600 nm. Isolated Arabidopsis mitochondria (50 µg) were used in 1 mL of reaction medium (50 mM
potassium phosphate, pH 7.4, 0.1 mM EDTA, 0.1% [w/v] BSA, 10 mM potassium cyanide, 0.12 mM
DCPIP, and 1.6 mM PMS). To calculate SDH activity, an extinction coefficient of 21 mM-1 cm-1 at 600
nm for DCPIP was used. Brooks Kinetic Software and linear Hanes-Plot calculations were used for
kinetic calculations. For measurements targeting the UQ binding site of SDH (SQR activity), 80 µM
Coenzyme Q1 instead of PMS was used in the reaction medium (Miyadera et al., 2003).
Measurement of Complex III Activity
The assay was performed as previously described in Petrosillo et al. (2003). Isolated mitochondria (50
µg) were used in a 1-mL reaction mixture containing 3 mM sodium azide, 1.5 µM rotenone, 50 µM cyt
c, and 50 mM phosphate buffer, pH 7.2. The reaction was started by the addition of 50 µM ubiquinol
Q10. Complex III activity was determined spectrophotometrically at 550 nm following the reduction of
cyt c, and a rate in nmol cyt c/min/mg Mit. was calculated using extinction coefficient (EmM) of 28.0
(reduced cyt c).
Measurement of Oxygen Consumption Using an O2 Clark Electrode
Oxygen consumption was measured using an O2 Clark electrode. Isolated Arabidopsis mitochondria
(100 µg) were used and oxygen uptake measured as previously described in Huang et al. (2013) in the
presence of 5 mM succinate, 1 mM NADH, or 10 mM malate + glutamate. To investigate the effect of
SA on respiration, concentrations from 0.01 to 1 mM were added after the substrate.
Mitochondrial ROS Measurements Using DCFDA
DCFDA, a cell permeant reagent that is reacting with ROS within the cell, was used. DCFDA is
deacetylated by cellular esterases and forms the fluorescent compound 2’, 7’-dichlorofluorescein once
it is oxidized by ROS. 2’, 7’- dichlorofluorescein can be detected by fluorescence spectroscopy using
excitation/emission spectra of 480/520 nm. Freshly isolated mitochondria (10 µg) from hydroponically
grown Arabidopsis plants (continuously in the dark) were transferred in 50 µl buffer (0.3 M Suc, 5 mM
KH2PO4, 10 mM TES, 10 mM NaCl, 2 mM MgSO4, and 0.1% [w/v] BSA, pH 7.2). DCFDA was diluted to
10 µM, a final volume of 50 µL in the same buffer solution together with the individual substrates. Both
solutions were transferred and mixed in a 96-well plate to a final volume of 100 µL. Fluorescence was
measured over 10 min and the slope was calculated.
42
Literature Cited
Andreyev AY, Kushnareva YE, Starkov AA (2005) Mitochondrial metabolism of reactive oxygen species. Biochemistry Biokhimiia 70 (2):200-214
Attaran E, Zeier TE, Griebel T, Zeier J (2009) Methyl salicylate production and jasmonate signaling are not essential for systemic acquired resistance in Arabidopsis. The Plant cell 21 (3):954-971. doi:10.1105/tpc.108.063164
Bi YM, Kenton P, Mur L, Darby R, Draper J (1995) Hydrogen peroxide does not function downstream of salicylic acid in the induction of PR protein expression. The Plant journal : for cell and molecular biology 8 (2):235-245
Bienert GP, Chaumont F (2014) Aquaporin-facilitated transmembrane diffusion of hydrogen peroxide. Biochimica et biophysica acta 1840 (5):1596-1604. doi:10.1016/j.bbagen.2013.09.017
Bienert GP, Moller AL, Kristiansen KA, Schulz A, Moller IM, Schjoerring JK, Jahn TP (2007) Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes. The Journal of biological chemistry 282 (2):1183-1192. doi:10.1074/jbc.M603761200
Birch-Machin MA, Taylor RW, Cochran B, Ackrell BA, Turnbull DM (2000) Late-onset optic atrophy, ataxia, and myopathy associated with a mutation of a Complex II gene. Annals of neurology 48 (3):330-335
Bourgeron T, Rustin P, Chretien D, Birch-Machin M, Bourgeois M, Viegas-Pequignot E, Munnich A, Rotig A (1995) Mutation of a nuclear succinate dehydrogenase gene results in mitochondrial respiratory chain deficiency. Nature genetics 11 (2):144-149. doi:10.1038/ng1095-144
Brodersen P, Malinovsky FG, Hematy K, Newman MA, Mundy J (2005) The role of salicylic acid in the induction of cell death in Arabidopsis acd11. Plant Physiol 138 (2):1037-1045. doi:10.1104/pp.105.059303
Brooks SP (1992) A simple computer program with statistical tests for the analysis of enzyme kinetics. BioTechniques 13 (6):906-911
Byun HO, Kim HY, Lim JJ, Seo YH, Yoon G (2008) Mitochondrial dysfunction by Complex II inhibition delays overall cell cycle progression via reactive oxygen species production. Journal of cellular biochemistry 104 (5):1747-1759. doi:10.1002/jcb.21741
Chen W, Chao G, Singh KB (1996) The promoter of a H2O2-inducible, Arabidopsis glutathione S-transferase gene contains closely linked OBF- and OBP1-binding sites. The Plant Journal 10 (6):955-966. doi:10.1046/j.1365-313X.1996.10060955.x
Chen Z, Ricigliano JW, Klessig DF (1993a) Purification and characterization of a soluble salicylic acid-binding protein from tobacco. Proceedings of the National Academy of Sciences of the United States of America 90 (20):9533-9537
Chen Z, Silva H, Klessig DF (1993b) Active oxygen species in the induction of plant systemic acquired resistance by salicylic acid. Science 262 (5141):1883-1886
Chouchani ET, Pell VR, Gaude E, Aksentijevic D, Sundier SY, Robb EL, Logan A, Nadtochiy SM, Ord EN, Smith AC, Eyassu F, Shirley R, Hu CH, Dare AJ, James AM, Rogatti S, Hartley RC, Eaton S, Costa AS, Brookes PS, Davidson SM, Duchen MR, Saeb-Parsy K, Shattock MJ, Robinson AJ, Work LM, Frezza C, Krieg T, Murphy MP (2014) Ischaemic accumulation of succinate controls reperfusion injury through mitochondrial ROS. Nature 515 (7527):431-435. doi:10.1038/nature13909
Dedkova EN, Seidlmayer LK, Blatter LA (2013) Mitochondria-mediated cardioprotection by trimetazidine in rabbit heart failure. Journal of molecular and cellular cardiology 59:41-54. doi:10.1016/j.yjmcc.2013.01.016
Drose S, Brandt U (2008) The mechanism of mitochondrial superoxide production by the cytochrome bc1 complex. The Journal of biological chemistry 283 (31):21649-21654. doi:10.1074/jbc.M803236200
Durner J, Klessig DF (1995) Inhibition of ascorbate peroxidase by salicylic acid and 2,6-dichloroisonicotinic acid, two inducers of plant defense responses. Proceedings of the National Academy of Sciences of the United States of America 92 (24):11312-11316
Forouhar F, Yang Y, Kumar D, Chen Y, Fridman E, Park SW, Chiang Y, Acton TB, Montelione GT, Pichersky E, Klessig DF, Tong L (2005) Structural and biochemical studies identify tobacco SABP2 as a methyl salicylate esterase and implicate it in plant innate immunity. Proceedings of the National Academy of Sciences of the United States of America 102 (5):1773-1778. doi:10.1073/pnas.0409227102
Fu ZQ, Yan S, Saleh A, Wang W, Ruble J, Oka N, Mohan R, Spoel SH, Tada Y, Zheng N, Dong X (2012) NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486 (7402):228-232. doi:10.1038/nature11162
Ghezzi D, Goffrini P, Uziel G, Horvath R, Klopstock T, Lochmuller H, D'Adamo P, Gasparini P, Strom TM, Prokisch H, Invernizzi F, Ferrero I, Zeviani M (2009) SDHAF1, encoding a LYR complex-II specific assembly factor,
43
is mutated in SDH-defective infantile leukoencephalopathy. Nature genetics 41 (6):654-656. doi:10.1038/ng.378
Gleason C, Huang S, Thatcher LF, Foley RC, Anderson CR, Carroll AJ, Millar AH, Singh KB (2011) Mitochondrial Complex II has a key role in mitochondrial-derived reactive oxygen species influence on plant stress gene regulation and defense. Proceedings of the National Academy of Sciences of the United States of America 108 (26):10768-10773. doi:10.1073/pnas.1016060108
Hagerhall C (1997) Succinate: quinone oxidoreductases. Variations on a conserved theme. Biochimica et biophysica acta 1320 (2):107-141
Hao H-X, Khalimonchuk O, Schraders M, Dephoure N, Bayley J-P, Kunst H, Devilee P, Cremers CWRJ, Schiffman JD, Bentz BG, Gygi SP, Winge DR, Kremer H, Rutter J (2009) SDH5, a Gene Required for Flavination of Succinate Dehydrogenase, Is Mutated in Paraganglioma. Science 325 (5944):1139-1142. doi:10.1126/science.1175689
Henzler T, Steudle E (2000) Transport and metabolic degradation of hydrogen peroxide in Chara corallina: model calculations and measurements with the pressure probe suggest transport of H(2)O(2) across water channels. Journal of experimental botany 51 (353):2053-2066
Herrera-Vásquez A, Salinas P, Holuigue L (2015) Salicylic acid and reactive oxygen species interplay in the transcriptional control of defense genes expression. Frontiers in Plant Science 6:171. doi:10.3389/fpls.2015.00171
Huang S, Millar AH (2013) Sequence diversity and conservation in factors influencing succinate dehydrogenase flavinylation. Plant signaling & behavior 8 (2):e22815. doi:10.4161/psb.22815
Huang S, Taylor NL, Ströher E, Fenske R, Millar AH (2013) Succinate dehydrogenase assembly factor 2 is needed for assembly and activity of mitochondrial Complex II and for normal root elongation in Arabidopsis. The Plant Journal 73 (3):429-441. doi:10.1111/tpj.12041
Huang S, Van Aken O, Schwarzländer M, Belt K, Millar AH (2016) The Roles of Mitochondrial Reactive Oxygen Species in Cellular Signaling and Stress Response in Plants. Plant Physiology 171 (3):1551-1559. doi:10.1104/pp.16.00166
Jardim-Messeder D, Caverzan A, Rauber R, de Souza Ferreira E, Margis-Pinheiro M, Galina A (2015) Succinate dehydrogenase (mitochondrial Complex II) is a source of reactive oxygen species in plants and regulates development and stress responses. The New phytologist 208 (3):776-789. doi:10.1111/nph.13515
Klessig DF, Tian M, Choi HW (2016) Multiple Targets of Salicylic Acid and Its Derivatives in Plants and Animals. Frontiers in Immunology 7. doi:10.3389/fimmu.2016.00206
Kudin AP, Bimpong-Buta NY, Vielhaber S, Elger CE, Kunz WS (2004) Characterization of superoxide-producing sites in isolated brain mitochondria. The Journal of biological chemistry 279 (6):4127-4135. doi:10.1074/jbc.M310341200
Lemire BL, Oyedotun KS (2002) The Saccharomyces cerevisiae mitochondrial succinate:ubiquinone oxidoreductase. Biochim Biophys Acta 1553:102-116.
Leon G, Holuigue L, Jordana X (2007) Mitochondrial Complex II is essential for gametophyte development in Arabidopsis. Plant Physiology 143 (4):1534-1546. doi:10.1104/pp.106.095158
Leslie CA, Romani RJ (1988) Inhibition of ethylene biosynthesis by salicylic Acid. Plant Physiol 88 (3):833-837 Love AJ, Milner JJ, Sadanandom A (2008) Timing is everything: regulatory overlap in plant cell death. Trends in
plant science 13 (11):589-595. doi:10.1016/j.tplants.2008.08.006 Manohar M, Tian M, Moreau M, Park SW, Choi HW, Fei Z, Friso G, Asif M, Manosalva P, von Dahl CC, Shi K, Ma S,
Dinesh-Kumar SP, O'Doherty I, Schroeder FC, van Wijk KJ, Klessig DF (2014) Identification of multiple salicylic acid-binding proteins using two high throughput screens. Front Plant Sci 5:777. doi:10.3389/fpls.2014.00777
Millar AH, Liddell A, Leaver CJ (2001) Isolation and subfractionation of mitochondria from plants. Methods in cell biology 65:53-74
Miyadera H, Shiomi K, Ui H, Yamaguchi Y, Masuma R, Tomoda H, Miyoshi H, Osanai A, Kita K, Ōmura S (2003) Atpenins, potent and specific inhibitors of mitochondrial Complex II (succinate-ubiquinone oxidoreductase). Proceedings of the National Academy of Sciences of the United States of America 100 (2):473-477. doi:10.1073/pnas.0237315100
Moons A (2005) Regulatory and functional interactions of plant growth regulators and plant glutathione S-transferases (GSTs). Vitamins and hormones 72:155-202. doi:10.1016/s0083-6729(05)72005-7
Moreau M, Tian M, Klessig DF (2012) Salicylic acid binds NPR3 and NPR4 to regulate NPR1-dependent defense responses. Cell Res 22 (12):1631-1633
Nawrath C, Metraux JP (1999) Salicylic acid induction-deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. The Plant cell 11 (8):1393-1404
44
Nie S, Yue H, Zhou J, Xing D (2015) Mitochondrial-Derived Reactive Oxygen Species Play a Vital Role in the Salicylic Acid Signaling Pathway in <italic>Arabidopsis thaliana</italic>. PLoS ONE 10 (3):e0119853. doi:10.1371/journal.pone.0119853
Norman C, Howell KA, Millar AH, Whelan JM, Day DA (2004) Salicylic Acid Is an Uncoupler and Inhibitor of Mitochondrial Electron Transport. Plant Physiol 134 (1):492-501. doi:10.1104/pp.103.031039
Okuma E, Nozawa R, Murata Y, Miura K (2014) Accumulation of endogenous salicylic acid confers drought tolerance to Arabidopsis. Plant signaling & behavior 9 (3):e28085
Petrosillo G, Ruggiero FM, Di Venosa N, Paradies G (2003) Decreased Complex III activity in mitochondria isolated from rat heart subjected to ischemia and reperfusion: role of reactive oxygen species and cardiolipin. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 17 (6):714-716. doi:10.1096/fj.02-0729fje
Quinlan CL, Orr AL, Perevoshchikova IV, Treberg JR, Ackrell BA, Brand MD (2012) Mitochondrial Complex II can generate reactive oxygen species at high rates in both the forward and reverse reactions. The Journal of biological chemistry 287 (32):27255-27264. doi:10.1074/jbc.M112.374629
Ralph SJ, Moreno-Sanchez R, Neuzil J, Rodriguez-Enriquez S (2011) Inhibitors of succinate: quinone reductase/Complex II regulate production of mitochondrial reactive oxygen species and protect normal cells from ischemic damage but induce specific cancer cell death. Pharmaceutical research 28 (11):2695-2730. doi:10.1007/s11095-011-0566-7
Ramsay RR, Ackrell BA, Coles CJ, Singer TP, White GA, Thorn GD (1981) Reaction site of carboxanilides and of thenoyltrifluoroacetone in Complex II. Proceedings of the National Academy of Sciences of the United States of America 78 (2):825-828
Rao MV, Davis KR (1999) Ozone-induced cell death occurs via two distinct mechanisms in Arabidopsis: the role of salicylic acid. The Plant Journal 17 (6):603-614. doi:10.1046/j.1365-313X.1999.00400.x
Raskin I, Ehmann A, Melander WR, Meeuse BJ (1987) Salicylic Acid: a natural inducer of heat production in arum lilies. Science 237 (4822):1601-1602. doi:10.1126/science.237.4822.1601
Raskin I, Skubatz H, Tang W, Meeuse BJD (1990) Salicylic Acid Levels in Thermogenic and Non-Thermogenic Plants. Annals of Botany 66 (4):369-373. doi:10.1093/oxfordjournals.aob.a088037
Sappl PG, Carroll AJ, Clifton R, Lister R, Whelan J, Harvey Millar A, Singh KB (2009) The Arabidopsis glutathione transferase gene family displays complex stress regulation and co-silencing multiple genes results in altered metabolic sensitivity to oxidative stress. The Plant Journal 58 (1):53-68. doi:10.1111/j.1365-313X.2008.03761.x
Senaratna T, Touchell D, Bunn E, Dixon K (2000) Acetyl salicylic acid (Aspirin) and salicylic acid induce multiple stress tolerance in bean and tomato plants. Plant Growth Regulation 30 (2):157-161. doi:10.1023/a:1006386800974
Shirasu K, Nakajima H, Rajasekhar VK, Dixon RA, Lamb C (1997) Salicylic acid potentiates an agonist-dependent gain control that amplifies pathogen signals in the activation of defense mechanisms. The Plant cell 9 (2):261-270. doi:10.1105/tpc.9.2.261
Slaymaker DH, Navarre DA, Clark D, del Pozo O, Martin GB, Klessig DF (2002) The tobacco salicylic acid-binding protein 3 (SABP3) is the chloroplast carbonic anhydrase, which exhibits antioxidant activity and plays a role in the hypersensitive defense response. Proceedings of the National Academy of Sciences of the United States of America 99 (18):11640-11645. doi:10.1073/pnas.182427699
Sun F, Huo X, Zhai Y, Wang A, Xu J, Su D, Bartlam M, Rao Z (2005) Crystal structure of mitochondrial respiratory membrane protein Complex II. Cell 121 (7):1043-1057. doi:10.1016/j.cell.2005.05.025
Tamás L, Zelinová V (2017) Mitochondrial Complex II-derived superoxide is the primary source of mercury toxicity in barley root tip. Journal of Plant Physiology 209:68-75.
Tian M, von Dahl CC, Liu PP, Friso G, van Wijk KJ, Klessig DF (2012) The combined use of photoaffinity labeling and surface plasmon resonance-based technology identifies multiple salicylic acid-binding proteins. The Plant journal : for cell and molecular biology 72 (6):1027-1038. doi:10.1111/tpj.12016
Vlot AC, Dempsey DA, Klessig DF (2009) Salicylic Acid, a multifaceted hormone to combat disease. Annual review of phytopathology 47:177-206. doi:10.1146/annurev.phyto.050908.135202
Wildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414 (6863):562-565. doi:10.1038/35107108
Wu Y, Zhang D, Chu JY, Boyle P, Wang Y, Brindle ID, De Luca V, Despres C (2012) The Arabidopsis NPR1 protein is a receptor for the plant defense hormone salicylic acid. Cell reports 1 (6):639-647. doi:10.1016/j.celrep.2012.05.008
Yalpani N, Silverman P, Wilson TM, Kleier DA, Raskin I (1991) Salicylic acid is a systemic signal and an inducer of pathogenesis-related proteins in virus-infected tobacco. The Plant cell 3 (8):809-818
45
Yankovskaya V, Horsefield R, Tornroth S, Luna-Chavez C, Miyoshi H, Leger C, Byrne B, Cecchini G, Iwata S (2003) ppppppp Architecture of succinate dehydrogenase and reactive oxygen species generation. Science 299 pppppppp(5607):700-704. doi:10.1126/science.1079605 Gutman M, Kearney EB, Singer TP (1971) Control of succinate dehydrogenase in mitochondria. Biochemistry 10
(25):4763-4770. doi:10.1021/bi00801a025 Hagerhall C (1997) Succinate: quinone oxidoreductases. Variations on a conserved theme. Biochimica et
biophysica acta 1320 (2):107-141 Huang S, Millar AH (2013) Succinate dehydrogenase: the complex roles of a simple enzyme. Curr Opin Plant Biol
16 (3):344-349. doi:10.1016/j.pbi.2013.02.007
46
Chapter Three:
Assembly factor SDHAF4 is required for promoting assembly
of flavinated SDH1 to SDH2 in Arabidopsis
47
Abstract
Succinate dehydrogenase (Complex II; SDH) plays an important role in mitochondrial respiratory
metabolism as an enzyme of both, the electron transport chain (ETC) as well as the tricarboxylic acid
cycle (TCA). It consists of four core subunits which need to be assembled correctly in order for SDH to
function. Maturation and assembly of subunit SDH1 is essential as it forms the catalytic subunit of SDH
and to date only SDHAF2 has been identified as an assembly factor for SDH in plants. SDHAF2 is
required for FAD insertion into SDH1 in Arabidopsis. We herein report the identification of a second
SDH assembly factor by analyzing the T-DNA knockout line of At5g67490, an orthologous gene to the
previous identified yeast and human SDH assembly factor SDHAF4, which was shown to promote the
assembly of SDH1 to SDH2. Knockout of At5g67490 (sdhaf4) resulted in decreased SDH activity and
succinate dependent respiration rate as well as a high accumulation of succinate in Arabidopsis
seedlings. Mass spectrometry analyzes showed an elevated abundance of soluble flavinated SDH1 in
sdhaf4, together with an accumulation of SDHAF2 but a decreased abundance of SDH2 compared to
WT. The loss of SDHAF4 may have caused destabilization of SDH2 and inhibited the formation of SDH1/
SDH2 intermediate, leading to an accumulation of soluble SDH1 but loss of SDH2. The increased
presence of SDHAF2 may indicate that stabilization of soluble flavinated SDH1 depends on SDHAF2
availability. It is concluded that SDHAF4 acts on the flavinated SDH1 and promotes its assembly to
SDH2, thereby stabilizing SDH2.
48
Introduction
Mitochondria are dynamic and essential organelles that are involved in a series of cellular processes
including adenosine triphosphate (ATP) synthesis, signal transduction and ROS production. Embedded
in the inner mitochondrial membrane (IMM) is the electron transport chain (ETC), which consist of four
complexes (I to IV). These complexes are essential to the formation of a proton gradient formed by
redox reactions along the ETC and the translocation of protons across the IMM, which in turn, drives
the production of ATP via ATP synthase (Complex V). Within the ETC, succinate dehydrogenase (SDH;
Complex II) is the smallest complex and uniquely forms part of both the ETC and tricarboxylic acid (TCA)
cycle. In addition, it is the only complex within the classical ETC that does not pump protons across the
IMM. SDH catalyzes the oxidation of succinate to fumarate and in doing so, reduces ubiquinone (UQ)
to ubiquinol (UQH2). It forms a heterotetrameric protein complex, anchored to the IMM by two integral
membrane proteins (SDH3, SDH4), which dimerize to bind a heme and generate the ubiquinone
binding sites. The SDH3/SDH4 dimer binds to subunit SDH2, which contains three iron sulfur (Fe-S)
clusters and is assembled to the catalytic subunit SDH1. SDH1 carries a covalently bound flavin adenine
dinucleotide (FAD) cofactor (Lemire and Oyedotun 2002; Sun et al. 2005; Huang and Millar 2013a).
Comparisons of plant SDH with other organisms showed that the plant SDH complex is very divergent.
Although SDH1 and SDH2 subunits are highly conserved in their sequences, SDH3 and SDH4 show high
divergence between different species, and notably between plants and animals (Burger et al. 1996).
Furthermore, the purified plant SDH complex contains four additional subunits (SDH5 to SDH8) with
yet unknown function. A recent study suggests that SDH6 and SDH7 may act as substitutes for missing
helices in SDH3 and SDH4 which are not present in plants, but are conserved in other organisms
(Schikowsky et al. 2016). This demonstrates once more a complex evolutionary history for plant SDH
(Huang and Millar 2013b) . For SDH to function it must be assembled and a series of cofactors must be
inserted into the different subunits. Four SDH assembly factors (named SDHAF1 to SDHAF4) have been
identified in mammals and yeast to build SDH1 and SDH2 into a complex intermediate, and three of
them (SDHAF1, SDHAF2, SDHAF4) have putative orthologues in Arabidopsis.
SDHAF1 has been studied in yeast (YDR379C-A; SDH6) and is suggested to function in Fe-S insertion
into SDH2. SDHAF1 contains a highly conserved LYR motif, which is suggested to be a signature for
proteins involved in Fe-S metabolism (Ghezzi et al. 2009). More recently, it was shown that SDHAF1
contributes to Fe-S cluster incorporation into SDH2 by transiently binding to SDH2 through an arginine-
rich region in its C-terminus, which specifically engages with the Fe-S domain (Maio et al. 2016). In
humans it was demonstrated that mutations in SDHAF1 can cause infantile leukoencephalopathy
49
disease due to Complex II deficiency (Ghezzi et al. 2009; Ohlenbusch et al. 2012). An orthologous gene
(At2g39725) has been shown to exist in Arabidopsis but there are no data available that would suggest
a role for this gene in SDH assembly in plants.
Analysis of an uncharacterized but highly conserved mitochondrial protein in yeast led to the
identification of Sdh5, later named SDHAF2 (Hao et al. 2009). SDHAF2 was shown to interact with SDH1
in both yeast and human and it was demonstrated that SDHAF2 is required for SDH-dependent
respiration as well as for FAD insertion into SDH1 (Hao et al. 2009). Germline loss-of-function
mutations in the human SDHAF2 was shown to cause hereditary paraganglioma disease (Hao et al.
2009).
SDHAF3 was identified in yeast (YDR511W; SDH7) and Drosophila (CG14898; Sdhaf3) and suggested to
act together with SDHAF1 to generate maturation of Fe-S clusters in SDH2 (Na et al. 2014). However,
an orthologous gene for SDHAF3 has yet to be found in plants, making it difficult to investigate the
function of this gene further.
Recently, studies in yeast, Drosophila and mammalian cells revealed an additional SDH assembly
factor, later named SDHAF4 (C6orf57 in human), which was shown to bind specifically to the flavinated
SDH1 subunit, thereby promoting the assembly of SDH1 to SDH2 after the FAD cofactor is incorporated
into SDH1 (Van Vranken et al. 2014). The correct assembly of SDH core subunits is crucial in mammalian
system as the loss of function of these subunits is associated with a range of human diseases including
diabetes, neurodegeneration, cancer and tumor syndromes (Ghezzi et al. 2009; Hao et al. 2009; Na et
al. 2014). The assembly of SDH and its intermediates formed by the four identified and potentially
more yet unidentified assembly factors as well as the role of SDH in human disease has been reviewed
intensively (Van Vranken et al. 2015; Bezawork-Geleta et al. 2017).
In plants, one assembly factor (SDHAF2) has been successfully characterized to date (Huang et al.
2013). According to Huang et al. (2013), knockdown of SDHAF2 in Arabidopsis resulted in a significant
reduction of the mature SDH complex, as only 50% of assembled SDH holo-complex could be found in
sdhaf2. Reduced abundance of SDH1 protein as well as decreased FAD bound protein in SDH1 was
shown for sdhaf2, indicating an important role of SDHAF2 for FAD insertion into SDH1 and SDH1
maturation in Arabidopsis (Huang et al. 2013). Additionally, recent studies demonstrated the
importance of matured and assembled SDH1 in SA induced stress response (Belt et al. 2017). A mutant,
carrying a point mutation at the succinate binding site of SDH1 (dsr1), showed a change in substrate
affinity and catalytic efficiency and was, together with sdhaf2, used to measure SA induced stress
50
signaling. Due to the kinetic changes in dsr1 and the lower abundance of mature SDH1 in sdhaf2, stress
response was severely decreased in both lines (Belt et al. 2017). In addition, previous studies
demonstrated that reduced expression of SDH1 or SDH2 resulted in seed abortion as well as reduced
seed set (Leon et al. 2007). Besides the incorporation of FAD into SDH1 via SDHAF2, not much is known
about the assembly and maturation of SDH1 and its binding to SDH2. As SDH1 maturation is essential
for functional mitochondrial metabolism and plant development, it is important to investigate its
assembly further by determining the next essential step, the assembly of SDH1 to SDH2.
Based on sequence orthology with SDHAF4 from human and yeast, a gene in Arabidopsis (At5g67490,
herein named SDHAF4), with a yet unknown function, was identified. To investigate the role of this
gene and its potential to be an assembly factor for SDH1 in plants after SDHAF2, reverse genetic
approaches were used in this study. A T-DNA insertion line (Landsberg erecta (Ler) background) for
SDHAF4 (sdhaf4) was obtained to analyze SDHAF4 function. Knockout of SDHAF4 resulted in
accumulation of succinate, together with decreased SDH activity and succinate dependent respiration
rate. Interestingly, it was found that SDH1 protein accumulated in the soluble mitochondrial protein
fraction, suggesting that SDH1 was made, but it was not assembled into the mature SDH holo-complex
in sdhaf4. Additionally, SDHAF2 accumulated about three fold in sdhaf4, likely to prevent
destabilization of soluble SDH1 but also hinting at a function of SDHAF4 downstream of SDHAF2.
Comparisons of sdhaf2, sdhaf4 and an additional SDH1 silenced Arabidopsis line (RNAi_SDH1-1, Leon
et al. (2007)) showed that SDH2 protein was consistently decreased, likely because all these genotypes
show decreased amounts of SDH1, demonstrating the importance of mature SDH1 for further
assembly of SDH2. Within this study, evidence will be provided for SDHAF4 acting on the flavinated
SDH1 subunit and promoting assembly of SDH1 to SDH2. The results obtained in this study extend the
model of the assembly pathways of SDH1 in plants, following the FAD insertion aided by SDHAF2.
51
Results
SDHAF4 is Located in Mitochondria and Shares a Conserved Protein Region at the C-terminus
Previous studies described the first SDH assembly factor identified in plants, which is involved in FAD
insertion into SDH1 (Huang et al. 2013). Following FAD insertion, the next step in SDH1 assembly is the
formation of a SDH1/SDH2 intermediate. In order to investigate this crucial step in plants, the
orthologue Arabidopsis gene (At5g67490), noted in the studies of the previous identified assembly
factor SDHAF4 in yeast and human (Van Vranken et al. 2014), was investigated as a potential SDHAF4
in Arabidopsis. Alignment of SDHAF4 amino acid sequences showed an overall sequence similarity of
~28% between humans (H. sapiens), yeast (S. cerevisiae) and plants (A. thaliana, Brassica napus,
Eutrema salsugenium). Although sequences showed great variability between species, a conserved
region located at the C-terminus could be identified (blast.ncbi.nlm.nih.gov, Fig. 1A)
(http://www.pantherdb.org). Using subcellular localization information (SUBA4), a mitochondrial
targeting sequence could be predicted for At5g67490 and it was reported as unknown protein in mass
spectrometry analysis of mitochondrial extracts, (http://suba.plantenergy.uwa.edu.au/,(Taylor et al.
2011). The At5g67490 gene consists of one single exon in Arabidopsis and is expressed in all
Arabidopsis plant tissue as well as seeds with the highest expression patterns found in cotyledons
(http://bar.utoronto.ca). AtSDHAF4 has a molecular weight of approximately 12 kDa
(www.arabidopsis.org). To further confirm the localization of SDHAF4, green fluorescent protein (GFP)
was fused to the N-terminal of SDHAF4 and transiently expressed in Arabidopsis cell culture.
Microscopic analysis of SDHAF4:GFP as well as mitochondrial alternative oxidase fused to red
fluorescent protein (AOX-RFP) as marker, confirmed mitochondrial localization for SDHAF4 (Fig. 1B).
Combined evidence of localization prediction and identification by mass spectrometry as well as the
GFP localization makes At5g67490 a clear mitochondrial protein and the lead candidate for SDHAF4 in
plants.
To prove this protein is a second assembly factor for SDH, acting after SDHAF2, it can be hypothesized
that its loss will affect the assembly of SDH1 to SDH2 once FAD is inserted into SDH1. The aim of this
study was thus to determine the role of AtSDHAF4 in regards to SDH function and assembly of SDH1
through study of a knockout line. A knockdown line of SDHAF2 (sdhaf2) was also included in this study
to determine possible similarities or distinctions between the two assembly factor mutant lines and to
determine the different steps and order of these two assembly factors that are involved in maturation
of SDH1 and assembly of SDH1 to SDH2.
52
Characterization of SDHAF4 T-DNA insertion line and phenotypic analysis
To analyze the function of the SDHAF4-like gene in Arabidopsis (At5g67490; SDHAF4), a T-DNA
insertion line (GT_5_75821, in Landsberg erecta (Ler) background, hereafter referred to as sdhaf4)
from the Nottingham Arabidopsis Stock Center (NASC) (http://signal.salk.edu/cgi-bin/tdnaexpress)
was obtained and genotyping analysis revealed homozygous lines (Supplemental Fig. 1). The T-DNA
insertion was located within the exon of At5g67490 (SDHAF4, Figure 1C). Reverse Transcriptase PCR
(RT-PCR) was used to determine the expression level of SDHAF4 in sdhaf4 compared to Ler (Fig. 1D).
Primers covering a region outside the T-DNA insertion (Fig. 1C, red arrows, Supplemental Table 2) were
designed. A significant decrease in expression level of about 60% could be observed in sdhaf4 (Fig. 1D),
showing that due to the T-DNA insertion, gene expression is reduced but not completely inhibited. In
order to investigate if SDHAF4 protein translation would still occur in sdhaf4, multiple reaction
monitoring (MRM) was used to detect peptides for SDHAF4 as well as other SDH subunits and SDHAF2
(Fig. 1D). Peptide amount was calculated as the ratio of sdhaf4 to Ler. From the results obtained, SDH1
is slightly decreased in sdhaf4. SDH2 is severely decreased in sdhaf4 and SDHAF4 was not detectable
in the mutant, demonstrating that, although gene expression still occurs, translation to SDHAF4
protein is inhibited or a truncated protein is unstable (Fig. 1D), indicating an effective knockout of
SDHAF4. SDHAF2 is three times more abundant in sdhaf4, indicating a possible compensatory response
to the loss of SDHAF4.
Looking at phenotypic differences between sdhaf4 and Ler, we did not observe any change in plant
growth or development when lines were grown on soil under long day condition (Supplemental Fig.
2A). As it is known from previous studies that knockdown of SDH assembly factor 2 (sdhaf2) affects
root elongation in Arabidopsis (Huang et al. 2013), root development of sdhaf4 against Ler as well as
sdhaf2 against Col-0 (background of sdhaf2) lines (Supplemental Fig. 2B) were compared. As previously
published, growing sdhaf2 on MS media with a pH of 5.8 results in strong decrease in root elongation
after 6 days (Huang et al. 2013). For sdhaf4, no such inhibition of root growth could be observed
(Supplemental Fig. 2B). Root elongation is slightly slowed down in sdhaf4 between 6th and 9th day after
germination but reaches the same root length as Ler after 15 days. So unlike sdhaf2, sdhaf4 does not
have a strong root phenotype (Supplemental Fig. 2B).
53
Figure 1: SDHAF4 sequences contain a conserved region at the C-terminus amongst different species, the Arabidopsis protein is located within mitochondria and sdhaf4 is an effective knockout Arabidopsis line at the protein level for SDHAF4. A) Sequence alignment of SDHAF4 between Saccharomyces cerevisiae (YBR269C), Homo sapiens (NM_145267), Arabidopsis thaliana (At5g67490), Brassica napus (XM_013885343) and Eutrema salsugenium (XM_006393894) (Clustal Omega). Conserved region is highlighted in red. B) GFP_SDHAF4 and RFP_AOX constructs were transiently expressed in Arabidopsis cell culture. GFP localization of SDHAF4 in mitochondria was performed macroscopically. C) Location of T-DNA insertion in At5g67490 (SDHAF4) within the exon region. Red arrows show region of primers used for RT-PCR. D) SDHAF4 gene expression and protein detection in Ler and sdhaf4. RT-PCR using primers outside the T-DNA region (red arrows in C) was performed to determine gene expression. Expression levels were normalized to actin and expression of SDHAF4 in Ler was set as 1 (left). Protein peptide detection of SDH subunits, SDHAF2 and SDHAF4 was determined using mass spectromerty. Isolated mitochondria of Ler and sdhaf4 were used and protein specific peptides were used for identification. Samples were normalized to ATP Synthase (right). Shown is the ratio of sdhaf4 to Ler. SE, standard error of n=4; **P≤ 0.01 (t-test)
54
sdhaf4 Shows High Accumulation of Succinate as well as Decreased SDH Activity and Succinate
Dependent Respiration
In order to determine whether metabolomic changes occur in sdhaf4, GC/MS analysis of metabolites
extracted from whole plant tissues of 10 days old seedlings was performed. sdhaf4 showed a
significant increase in the abundance of succinate, approximately 5-fold compared to Ler (N=4, p=
0.015, Figure 2A, Supplemental Table 1). Besides succinate, 51 metabolites were quantified, including
20 with an unknown classification. Besides succinate, glycine showed the next most significant increase
in abundance (2 fold, (N=4, p= 0.07). To determine whether knocking out SDHAF4 would directly affect
SDH function, SDH activity was measured in isolated mitochondria obtained from Ler and sdhaf4 plants
(Figure 2B). Phenazine methosulfate (PMS) and 2,6-dichloro-indolephenol (DCPIP) were used to accept
electrons being generated at the succinate binding site of SDH. Within this assay, SDH activity is
measured directly at subunit SDH1. PMS acts as acceptor of electrons that are liberated through
succinate oxidation, which then are transferred to DCPIP. DCPIP is then reduced and changes its
absorbance at 600 nm. By measuring this change in absorbance spectrophotometrically, a rate of µmol
DCPIP/ min/ mg mito-chondria (Mit.) is calculated and this illustrates SDH activity (Figure 2B). Using a
range of 0.1 to 10 mM succinate, a significant decrease in SDH activity was observed in sdhaf4 in
comparison to Ler at most substrate concentrations (Figure 2B). Approximately one third of the activity
seen in Ler could be measured in sdhaf4 (Figure 2D). Looking at the calculated Km value for succinate
of SDH (R software, Supplemental Fig. 3, 4), which describes the substrate concentration necessary to
reach half maximum enzyme velocity, no significant difference between sdhaf4 and Ler could be
observed (t-test p> 0.1, Figure 2E, Supplemental Fig. 3, 4). Both lines showed a Km of approximately 0.4
mM of succinate, indicating that this key kinetic property of SDH in Ler is maintained in sdhaf4. Due to
its low SDH activity even at high concentrations of succinate, the catalytic efficiency (Vmax/Km) is only
about a third as high in sdhaf4 compared to Ler (Figure 2F). Overall, these data show that knockout of
SDHAF4 leads to a decrease in SDH activity, which results in an accumulation of succinate and a lower
catalytic efficiency of SDH, when considered on a mitochondrial protein basis.
To determine if succinate-dependent oxygen (O2) uptake would be altered in sdhaf4, mitochondrial
respiration rate was measured using a Clark-type O2 electrode (Figure 2C). 5 mM succinate were added
to 100 µg of freshly isolated mitochondria in a 1 ml reaction solution and respiration was calculated as
nmol O2/ min/ mg Mit. From the results obtained, a significant decrease in respiration rate in sdhaf4
was observed (Figure 2C), it was about half the rate of Ler (Figure 2C), which again, is very similar to
what was observed in sdhaf2 (Huang et al. 2013). To confirm that respiration through complexes other
than SDH of the ETC were not affected in sdhaf4, the assay was repeated using 1 mM NADH as
substrate (Figure 2C). No significant differences between genotypes could be observed and both Ler
55
and sdhaf4 showed substantial mitochondrial respiration rates of ~ 100 nmol O2/ min/ mg Mit (Figure
2C). Mitochondria from both lines also showed almost complete sensitivity of their respiratory rate to
1 mM cyanide (KCN) treatment (Figure 2C). This indicates that AOX capacity was similar in both
genotypes in vitro.
Taken together, these data showed that sdhaf4 had a decreased mitochondrial respiration rate when
electron flow passes through SDH in a succinate-dependent manner.
Figure 2: sdhaf4 shows high succinate accumulation together with lower SDH activity and succinate dependent oxygen consumption compared to Ler. A, GC/MS analysis of whole leave tissue of sdhaf4 and Ler were performed to determine differences in succinate content ( N=4, p= 0.015); B, SDH activity at different succinate concentrations in a range from 0.1 to 10 mM; C, Oxygen consumption in the presence of 5 mM succinate or 1 mM NADH. Kinetic analysis using Michaelis-Menten calculations were performed to determine maximum SDH velocity (D), Km value of succinate (E) and catalytic efficiency (µmol DCPIP/min) of SDH for succinate (F) in sdhaf4 and Ler. Error bars, SE, t-test was performed to determine significant differences between genotypes (n=4); *p< 0.05, **p< 0.01, ***p< 0.001
56
Protein Abundance of SDH2 and SDHAF2 is Altered in sdhaf4 Mitochondria
The above results showed that the loss of functional SDHAF4 resulted in decreased SDH activity and
succinate dependent respiration. Based on the model in yeast, it was hypothesized that SDHAF4 would
act as an assembly factor of the flavinated SDH1 and would be important for assembly of a SDH1/SDH2
intermediate. To further investigate this hypothesis, the abundance of protein peptides of SDHAF4 as
well as SDHAF2 and the subunits SDH1, 2, 6 and 7, obtained from isolated mitochondria, was
determined using MRM analysis of gene specific peptides. Samples of mitochondrial proteins from
sdhaf4 and Ler plants, sdhaf2 and Col-0 were analyzed as well as mitochondria from a SDH1 RNAi
silencing line (Leon et al. 2007) to further investigate alterations of SDHAF2 and SDHAF4 abundance
when SDH1 is reduced.
Comparing protein abundance in sdhaf4 and Ler, SDH1 was only slightly reduced in sdhaf4. Although
SDH1 abundance was not severely changed (Figure 3A) in sdhaf4, SDH2 was reduced by half in sdhaf4
compared to Ler (Figure 3A). The reduced abundance of SDH2 provides further evidence that SDHAF4
may be an assembly factor of SDH and acts during incorporation of SDH2 in SDH1/SDH2 assembly
intermediates. The loss of SDHAF4 would result in reduction of SDH2 and a change in stoichiometry of
SDH1 to SDH2 in sdhaf4. Looking at sdhaf2, both SDH1 and SDH2 abundances were decreased,
indicating that without SDHAF2 and without the inserted FAD, SDH1 was not stable enough to
accumulate, leading to decreased amounts of SDH1 and therefore most likely causing reduced
accumulation of SDH2 as well.
The SDH1 silencing line only shows slightly reduced abundance of SDH1, similar to sdhaf4, but highly
reduced amounts of SDH2, demonstrating that, similar to the decreased amount of SDH2 in sdhaf2
and sdhaf4, stability of SDH2 is dependent on abundance of available mature SDH1. The abundances
of SDH6 and 7 peptides were slightly reduced in the mutant lines. Being potential replacements of
helices for SDH3 and 4 (Schikowsky et al. 2017), SDH6 and 7 can be used as representations for subunits
SDH3 and 4, as specific peptides for these subunits could not be identified by mass spectrometry (MS).
Nevertheless, the lack of severe consequences in stability or abundance of SDH6 and 7 indicated that
the assembly of the SDH3/4/6/7 membrane aim might occur independently from SDH1/SDH2.
Looking at SDHAF2 and SDHAF4 peptides in the different lines, the results showed a significant increase
of about 3 fold of SDHAF2 in sdhaf4 (Fig. 4A). It could be hypothesized that due to the loss of SDHAF4,
SDHAF2 may accumulate in order to keep SDH1 stable as a soluble protein. Depending on where
SDHAF4 acts, one might expect to see the same effect in sdhaf2 with accumulation of SDHAF4 in order
to keep SDH1 as stable as possible. However, from the results obtained, sdhaf2 plants did not show an
57
increase in SDHAF4 abundance, in fact, it was reduced by half compared to Col-0 (Fig. 4A). The fact
that SDHAF2 is accumulated in sdhaf4, but not the reverse, provides evidence that SDHAF2 is acting
upstream of SDHAF4 in the assembly pathway of SDH. The SDH1 silencing line with slightly decreased
SDH1 peptides showed decreased abundance of both SDHAF2 and SDHAF4, demonstrating that both
SDHAF2 and SDHAF4 are involved in SDH1 maturation and the accumulation of both is dependent on
the abundance of SDH1. Together, these findings indicate that SDHAF4 abundance was dependent on
SDH1 presence, which is reduced in sdhaf2 and the SDH1 silencing line. SDHAF2, on the other hand, is
highly increased in sdhaf4, demonstrating that it is involved in SDH1 maturation and stability and acts
upstream of SDHAF4.
In previous work, the sdhaf2 line showed reduced FAD bound SDH1 protein (Huang et al. 2013). As
SDHAF4 is suggested to act after SDHAF2, following the incorporation of FAD into SDH1, sdhaf4 should
not show any differences in FAD binding compared to Ler. To test this theory, a FAD bound protein
assay developed by Bafunno et al. (2004) was performed (Figure 3B). Based on gel band area
comparisons calculated in Image J (Supplemental Fig. 5), no differences could be detected between
Ler and sdhaf4, showing that FAD insertion into SDH1 is unaltered in sdhaf4 and strengthens the
hypothesis that SDHAF4 acts upon the already flavinated SDH1 subunit in plants.
Figure 3: SDH2 and SDHAF2 is altered in sdhaf4 but FAD bound protein is not changed in abundance Multiple reaction monitoring (MRM) was used to detect peptides of SDH subunits and assembly factors (A), shown is the ratio of peptides (mutant/WT) based on whole mitochondria protein samples (50 µg, N=4). FAD bound protein assay was performed to compare FAD binding in SDH1 in sdhaf4 (af4) and Ler (B), 10 µg mitochondrial protein were separated on SDS PAGE, following a gel incubation in 10% acetic acid for 30 min. FAD fluorescence scans were performed before and after the acetic acid treatment using Typhoon Trio Laser (Amersham Biosciences) and filters Cy5 (670 bp) and Cy3 (580 bp). The FAD band becomes visible after acetic acid incubation, marked here with a black arrow.
58
SDH1 Protein Accumulates in the Soluble Fraction of sdhaf4 Mitochondria
Based on the MRM assay results, sdhaf4 displayed decreased amounts of SDH2 but increased amounts
of SDHAF2 while SDH1, 6 and 7 were mainly unaltered in abundance (Figure 3A). Furthermore, FAD
binding in SDH1 was unaltered in sdhaf4 (Fig. 4B). From these results, it was hypothesized that in the
case of sdhaf4, SDH1 may be stable and accumulate as a soluble protein, however, is unable to be
attached to SDH2, which therefore becomes unstable as a result. To test this idea, the MRM assays
were repeated but mitochondria samples were firstly separated into soluble and membrane fractions.
Mitochondria were freeze/ thawed three times before membrane and soluble fraction were separated
by a 20 min high speed centrifugation at 20 000 x g. The supernatant (soluble fraction) was removed
and the pellet (membrane fraction) was resuspended in sucrose wash buffer. To compare possible
differences in SDH components and SDH assembly factors, peptide detection of SDH subunits 1 and 2
as well as the assembly factors SDHAF2 and 4 was determined in sdhaf4, Ler, sdhaf2 and Col-0 (Figure
4). To visualize differences in the mutant lines, peptide detection was calculated as the ratio of mutant
to WT (Fig. 4A). Results showed that within the membrane samples (M), the abundance of SDH1 and
2 proteins is reduced to half in the two assembly factor mutants (Figure 4A), indicating that there is
less membrane assembled SDH holo-complex present. However, comparing soluble fractions (S),
sdhaf4 showed significantly higher amounts of SDH1 (t-test; p= 0.04) compared to its matched
membrane sample with about the same amount of SDH1 protein as in Ler. On the other hand, sdhaf2
showed no significant difference in abundance between its membrane and soluble fractions (t-test; p>
0.1, Figure 4A). In both cases the mutant had about half the protein amount measured in Col-0. There
was no SDH2 protein accumulation in the soluble fraction in sdhaf4, as shown for whole mitochondria
samples (Figure 3A). It was about half the amount compared to Ler (Figure 4A). SDH2 did not
accumulate as a soluble protein like SDH1 in sdhaf4 line and may be degraded by proteases in this
background (Figure 4A). In agreement with MRM analyzes on whole mitochondria, SDHAF2 protein
was accumulated in both fractions in sdhaf4, however, this accumulation was significantly higher in
the soluble fraction (Fig. 4A). Looking at the sdhaf2 line compared to Col-0, there was not a clearly
reduced amount of SDHAF4, which was previously shown in whole mitochondria samples (Fig. 3A).
Nevertheless, SDHAF4 also did not accumulated in any of the mitochondrial fractions of sdhaf2, still
consistent with SDHAF2 acting upstream of SDHAF4.
By visualizing the data as ratio of soluble to membrane protein amounts (Figure 4B) we could consider
partitioning of proteins during the assembly process. Col-0 and Ler showed half as much SDH1 and
SDH2 protein in the soluble fraction compared to their respective membrane fractions. sdhaf2 had
approximately a fourth of its protein of SDH1 and SDH2 content in the soluble mitochondrial fraction
(Figure 4B). In contrast, sdhaf4 has about the same amount of SDH1 protein in its soluble mitochondria
59
fraction compared to its membrane fraction (Figure 4B), a significantly higher soluble to membrane
ratio than in Ler. These findings are in agreement with the hypothesis that SDHAF4 is acting on the
flavinated SDH1 and promotes assembly of SDH1 to SDH2. Due to the knockout of SDHAF4, SDH1
assembly to SDH2 is inhibited, resulting in accumulation of soluble SDH1 and degradation of SDH2. The
assembly factors SDHAF2 and SDHAF4 were more abundant in the soluble fraction in all lines,
indicating that they are mostly present as soluble proteins in mitochondria.
To further confirm that SDH1 is accumulated as a soluble FAD-bound protein in sdhaf4, the FAD binding
assays were also repeated with soluble and membrane mitochondrial samples (Figure 4C,
Supplemental Fig. 6). Quantitation of the fluorescence of the FAD gel bands, visualized on SDS PAGE
(Supplemental Fig. 6), were calculated using Image J. Comparisons were made between genotypes in
soluble and membrane fractions and are shown as ratios of mutant to WT of FAD bound protein (Figure
4C). No significant differences in sdhaf2 could be observed between soluble and membrane fractions.
Both samples showed reduced FAD binding with a more severe reduction in the soluble sample (Figure
4C). These results are in agreement with the MRM findings and previous studies in sdhaf2 (Huang et
al. 2013). In contrast, sdhaf4 showed decreased amounts of FAD protein in the membrane section but
increased amounts in the soluble fraction (t-test, p=0.08) with approximately the same amount of FAD
bound protein in the mutant as in Ler (Figure 4C). This provides further evidence for SDH1 being
accumulated in the soluble fraction as a FAD-bound protein in sdhaf4 and SDHAF4 is thus important
for SDH1 assembly.
60
Figure 4: SDH1 accumulates as a soluble FAD-bound protein in sdhaf4 A, Peptide abundance of soluble (S) and membrane (M) mitochondrial protein fraction compared between mutant lines and WT (N=3); B, Ratio of protein abundance of soluble to membrane mitochondrial fraction compared within each genotype (N=3); C, Comparison of gel band area of FAD bound protein between mutant lines and WT in soluble and membrane mitochondrial fraction (N=4); M=membrane, S=soluble; t-test *p≤ 0.08, **p≤ 0.05
Having a high amount of free flavinated SDH1 in the soluble fraction of mitochondria isolated from
sdhaf4 plants might also lead to a higher SDH activity or ROS production in that fraction. Therefore, to
check for either scenario, SDH activity was measured in soluble and membrane fractions of isolated
mitochondria of Ler, sdhaf4, sdhaf2 and Col-0 (Supplemental Fig. 7A). Based on total protein amount
no increased activity rate in the soluble fraction in sdhaf4 could be observed, but rather quite the
opposite was demonstrated (Supplemental Fig. 7A). The soluble fraction in all genotypes showed less
DCPIP-dependent SDH activity rates than in the membrane fraction. Similar results were obtained from
ROS detection of soluble and membrane fractions using DCFDA as a fluorescence dye (Supplemental
Fig. 7B). Soluble mitochondria samples showed less than half the rates of ROS production compared
to membrane samples (Supplemental Fig. 7B). A possible explanation could be that flavinated SDH1 by
itself is not enough to achieve functional electron transfer and it might need to be further assembled
to SDH2, and potentially reach a Fe-S cluster, in order to promote electron transfer from succinate to
DCPIP.
61
Assembly of SDH holo-complex is decreased in sdhaf4
To further visualize that SDH1 is less assembled into SDH holo-complex in sdhaf4, mitochondria of Ler
and sdhaf4 were loaded on a blue native (BN) gel and polyacrylamide gel electrophoresis (PAGE) was
performed (Fig. 5 left). SDH1 antibody (provided by Professor Braun, Germany) was used to detect
SDH1 protein after BN gel was blotted on PVDF membrane (Fig. 5 right). Ler shows a strong SDH1 signal
coming from the SDH holo-complex (~ 170 kDa). In case of sdhaf4, two distinct bands could be
detected, one about the same as Ler, representing mature SDH complex, but showing only a weak
signal compared to Ler. A second slightly lower band, which is absent in Ler, was detected in sdhaf4
with a stronger signal and likely represents the soluble SDH1 (~ 70 kDa) which could not be
incorporated into the holo-complex (Fig. 5 right).
This demonstrates, that majority of SDH1 protein is not assembled into the mature enzyme complex
in sdhaf4, which is in agreement with the previous findings and the hypothesis of SDHAF4 being
required as assembly factor for SDH1.
Figure 5: SDH1 is less incorporated in SDH holo-complex and accumulates as soluble protein in sdhaf4. SDH1 antibody was used to detect SDH1 abundance in whole mitochondria samples of Ler and sdhaf4 loaded on a BN gel (left) and blotted on PVDF membrane (right). Indicated by arrows are the two bands representing SDH holo-complex and soluble SDH1 protein.
62
Discussion
The important role of SDH in plants is demonstrated by the variety of dysfunctions that can occur in
plant development and metabolism (Leon et al. 2007; Gleason et al. 2011; Huang et al. 2013; Belt et
al. 2017). Functional assembly of SDH1 is crucial as it forms the catalytic subunit where succinate is
oxidized to fumarate. In addition, availability of matured SDH1 is also important for the assembly of
SDH2 and the formation of SDH1/SDH2 intermediate. SDHAF2 was previously identified as the first
assembly factor of SDH in Arabidopsis (Huang et al. 2013), inserting the FAD cofactor into SDH1. Within
this study, we now present evidence for a second SDH assembly factor in Arabidopsis, named SDHAF4,
promoting the next essential assembly step, the formation of SDH1/ SDH2 intermediate. An analog
gene to the SDHAF4 version in human was identified in Arabidopsis (At5g67490). Based on analysis of
an At5g67490 T-DNA knockout line (sdhaf4), evidence was provided demonstrating the importance of
AtSDHAF4 for SDH2 stability and SDH1/SDH2 intermediate assembly. Results obtained from this study
bring us one step closer to unravel the complex machinery of SDH assembly in plants.
The protein sequence of the putative plant SDHAF4 showed a conserved region in the C-terminus
amongst different yeast and animal species as well as broadly within the plant kingdom (
Figure 1A). Studies in yeast, Drosophila and mammalian cells have demonstrated that the SDHAF4
homologs in these species are SDH assembly factors and that the C-terminus is the part that is
conserved throughout evolution (Van Vranken et al. 2014). Van Vranken et al. first identified SDHAF4
and introduced a model that indicated SDHAF4 might act directly at the FAD bound protein in SDH1,
thereby blocking the production of ROS during assembly and also facilitating the assembly of SDH1 to
SDH2. Within this study, a SDHAF4 knockout line (sdhaf4) was used to establish evidence that the
homologous AtSDHAF4 is a SDH assembly factor in Arabidopsis. Using this mutant, a decrease of SDH
activity and succinate dependent respiration was shown (Figure 2), demonstrating that SDHAF4 is
important, but not essential, for SDH function as low enzyme activity and respiration rate could still be
achieved. This finding was also previously shown for mutants of SDHAF4 in yeast and Drosophila (Van
Vranken et al. 2014). No significant changes in SDH1 abundance or FAD bound protein on the whole
mitochondria level were observed in sdhaf4 compared to Ler (Figure 3), demonstrating that in contrast
to sdhaf2, the amounts of available SDH1 and SDH1-FAD bound protein are not reduced in sdhaf4. In
contrast, SDH2 abundance was reduced by half, indicating that the assembly of SDH1 to SDH2 was
likely disrupted. Furthermore, a mismatch of stoichiometry of SDH1 and SDH2 occured in sdhaf4.
Comparison of an additional decreased SDH1 mutant line (RNAi silencing of SDH1, Leon et al. 2007)
also showed decreased SDH2 abundance as well as decreased amounts of both assembly factors. This
is in agreement with studies performed in yeast, where knockout of SDHAF4 caused a decrease
63
abundance of SDH2 (Van Vranken et al. 2014). Altogether, this further strengthens the evidence of
SDH2 stability being dependent on SDH1 availability and maturation. Interestingly, in Drosophila,
SDHAF4 deletion demonstrated that dSDHAF4 is necessary for SDH1 stabilization and maintaining of
SDH1 levels, indicating that possibly in higher eukaryotes, SDHAF4 orthologues are required to support
the hydrophilic head of SDH by maintaining SDH1 subunit stability (Van Vranken et al. 2014).
No phenotype, like short root growth in sdhaf2, was observed in sdhaf4 (Supplemental Fig. 2B). Studies
of other SDH1 mutants in plants did not report a short root phenomenon either (Leon et al. 2007;
Gleason et al. 2011). sdhaf2 is the only mutant with decreased abundance of flavinated SDH1 and
potentially accumulates free FAD. One scenario that could be further tested is whether FAD
accumulation influences root growth in Arabidopsis by creating an environment that inhibits root
elongation.
Looking at mitochondrial membrane and soluble fractions, an accumulation of soluble flavinated SDH1
protein in sdhaf4 was determined (Figure 4). Looking at membrane bound SDH1 and SDH2 abundance,
both proteins were clearly reduced by half in sdhaf4 compared to Ler (Figure 4A), which indicates that
there was a reduced amount of membrane bound SDH holo-complex. Once again, this is in agreement
with studies in yeast and Drosophila, which also showed decreased steady-state levels of the SDH holo-
complex (Van Vranken et al. 2014). In addition, SDHAF2 was increased about three fold in sdhaf4, likely
to prevent destabilization of SDH1. In the case of sdhaf2, SDHAF4 was not accumulated but reduced in
abundance. Together, these results indicate that SDHAF2 acts upstream of SDHAF4 (Figure 3). A high
availability of non-assembled SDH1 protein in the soluble fraction is good evidence for SDHAF4 being
involved in SDH1/SDH2 assembly as described in previous studies (Van Vranken et al. 2014). It most
likely will also be acting on the FAD bound protein in SDH1 (Van Vranken et al. 2014), following FAD
insertion by SDHAF2 (Hao et al. 2009; Huang et al. 2013). It could be shown that SDHAF4 binds to SDH1
independently of any other core subunit and SDHAF2. In addition, the interaction of SDHAF4 and SDH1
has been shown to be dependent on covalent binding of FAD to SDH1 as SDHAF4 was shown to fail to
interact with SDH1 if the FAD cofactor is missing (Van Vranken et al. 2014). Furthermore, BN-PAGE
analysis revealed that SDHAF4 forms a stable sub-complex with SDH1 which is not associated with SDH
holo-complex and which accumulates if SDH2 is not present (Van Vranken et al. 2014). This is in
agreement with data obtained in this study showing decreased SDH holo-complex in sdhaf4 and the
formation of a slightly smaller sub-complex of soluble SDH1 (Fig. 5).
64
The high abundance of flavinated SDH1 in sdhaf4 could in theory have toxic effects. ROS could be
generated by solvent-accessible FAD, which could be capable of oxidizing succinate to fumarate
independently of the SDH complex. This would lead to the reduction of FAD, which could be auto-
oxidized by molecular oxygen and result in the formation of superoxide (Messner and Imlay 2002; Guzy
et al. 2008). However, measurement of SDH activity via DCPIP reduction as well as ROS measurements
using DCFDA as a fluorescence dye, in soluble and membrane fractions of isolated mitochondria
showed no increase in SDH activity or ROS accumulation in the soluble samples of sdhaf4
(Supplemental Fig. 7). As a matter of fact, SDH activity and ROS production rates were lower in the
soluble mitochondria samples compared to the membrane ones in sdhaf4 (Supplemental Fig. 7),
indicating that in Arabidopsis, free flavinated SDH1 is not sufficient to promote succinate oxidation.
These results are in contrast to previous findings, where deletion of SDHAF4 resulted in a high
sensitivity to oxidative stress induced by hyperoxia in Drosophila and accumulation of ROS in yeast
(Van Vranken et al. 2014), indicating that assembly of SDH1 and its catalytic capability may be
regulated differently in plants. Studies to date on SDH disagree in regards to the site of autoxidation
responsible for ROS production. Some studies point to the FAD site within SDH (Imlay 1995; Messner
and Imlay 1999, 2002), while others indicate ubisemiquinone and Fe-S centers to be the responsible
sites (Guo and Lemire 2003; Liang and Patel 2004; Huang and Lemire 2009). Furthermore, studies in
mammalian cells showed that knockdown of SDH2 but not SDH1 caused an increase in ROS production
(Ishii et al. 1998; Guzy et al. 2008). Based on results obtained within this study, FAD does not seem to
be the site responsible for ROS production in Arabidopsis SDH. It is possible that Fe-S clusters or the
UQ site form the reactive site or a combination of FAD and Fe-S centers.
Overall, it is concluded that SDHAF4 forms a second SDH assembly factor in plants. It likely acts
downstream of SDHAF2 action, on the flavinated SDH1 subunit (Fig. 6), and is likely involved in the
formation of SDH1/SDH2 intermediate given the decreased abundance of SDH2 but high accumulation
of SDHAF2 in sdhaf4. Recent studies in yeast showed that SDH1/SDH2 dimers can exist in the absence
of either or both membrane bound subunits SDH3 and SDH4, indicating that SDH1/SDH2 is assembled
before being linked to SDH3 and SDH4 (Kim et al. 2012). Assembly of the SDH holo-complex has been
intensively studied and reviewed in mammals and yeast (Van Vranken et al. 2015; Bezawork-Geleta et
al. 2017) largely due to increasing evidence of the impact of SDH mutations in human disease (Rutter
et al. 2010; Hoekstra and Bayley 2013). Within the mitochondrial matrix, SDHAF2 is proposed to act
during FAD insertion into SDH1 and is required to ensure covalent attachment of FAD (Hao et al. 2009;
Huang et al. 2013). But previous studies also showed that additional, species specific factors, may play
a role as catalytically active SDH1 is still formed in the absence of SDHAF2 in thermophilic bacteria
(Kounosu 2014). In addition, recent studies in human breast cancer cells showed that despite the
65
depletion of SDHAF2, flavinated SDH1 was still assembled and SDH activity retained (Bezawork-Geleta
et al. 2016). In Arabidopsis, knockout of SDHAF2 is embryo lethal, indicating that SDHAF2 is essential
for SDH1 flavination in plants (Huang et al. 2013). However, it remains unclear how different organisms
are still able to assemble flavinated SDH1 without SDHAF2. Knockout of SDHAF4, on the other hand,
did not result in embryo lethality in Arabidopsis and SDH activity could still be achieved demonstrating
that SDHAF4 is important but not essential for SDH assembly and function. Interestingly, as mentioned
earlier, the loss of SDHAF4 shows different consequences between organisms (Van Vranken et al.
2014). Drosophila had a more severe phenotype with mutants showing reduced SDH activity and
destabilization of both, SDH1 and SDH2 as well as a significant decrease of SDH holo-complex (Van
Vranken et al. 2014). Yeast and mammalian cells, on the other hand, were able to maintain 40 – 50%
of WT SDH activity and showed similar level of mature SDH complex assembly (Van Vranken et al.
2014). Furthermore, while yeast mutants showed relatively unaltered levels of SDH1, Drosophila had
highly reduced abundance of SDH1, which potentially is responsible for the almost complete loss of
holo-complex (Van Vranken et al. 2014). Similar to yeast and mammalian cells, Arabidopsis was also
able to maintain SDH1 levels in form of soluble protein as well as maintain some SDH activity,
suggesting that either other additional assembly factors might exist in plants, yeast and mammalian
cells that are still functioning in the absence of SDHAF4, or the process of SDH1/SDH2 intermediate
assembly occurs at a low rate without the requirement for assembly factors.
Figure 6: Scheme of FAD insertion into SDH1 and assembly of SDH1 to SDH2. As a first SDH1 assembly step, SDHAF2 is required to insert FAD cofactor into SDH1. SDHAF4 likely binds to the FAD site in SDH1 and promotes assembly of SDH1 to SDH2 (left). Loss of SDHAF4 causes decreased assembly of SDH1/SDH2 intermediate, leading to degradation of SDH2 (right).
66
Materials and Methods
Growing of Arabidopsis Plants on Soil
Seeds of Arabidopsis lines were sown on a 1:3:1 perlite: shamrock compost: vermiculite soil mix and
covered with a transparent acrylic hood. After 3 days of stratifying in the dark at 4°C, plants were
transferred in a growth chamber with controlled long day conditions (16 hour light/ 8 hour dark, light
intensity of 200 µmol m-2 s-1, relative humidity of 70%, 22°C day/ 17°C).
Growth of Arabidopsis Hydroponic Plants
Arabidopsis seeds were washed in 70% (v/v) ethanol for 2 min and in sterilization solution (5% (v/v)
bleach, 0.1% (v/v) Tween 20) for 5 min with periodical shaking. Seeds were washed 5 times in sterile
water before being dispensed into 250 ml plastic vessels containing 80 ml of MS media (half-strength
Murashige and Skoog medium without vitamins, half-strength Gamborg B5 vitamin solution, 5 mM
MES, 2.5% (w/v) sucrose, pH 7). Hydroponic cultures were grown under long day conditions (described
above) shaking at 220 rpm for 2 weeks.
Isolation of Mitochondria from Hydroponic Cultures
Mitochondria were isolated from 2 weeks old hydroponically grown Arabidopsis plants based on the
method described in Millar et al. (2001) with slight modifications. WT and sdhaf4 plant material was
homogenized in grinding buffer (0.3 M sucrose, 25 mM tetrasodium pyrophosphate, 1% (w/v) PVP-40,
2 mM EDTA, 10 mM KH2PO4, 1% (w/v) BSA, 20 mM ascorbic acid, pH 7.5) using mortar and pestle for
2 to 5 min, twice. The homogenate was filtered through four layers of Miracloth and centrifuged at
2500 x g for 5 min. Supernatant was centrifuged at 14 000 x g for 20 min and the resulting pellet was
resuspended in sucrose wash buffer (0.3 M sucrose, 0.1% [w/v]) BSA, 10 mM TES (N-
tris[hydroxymethyl]- methyl-2- aminoethanesulfonic acid], pH 7.5). Resuspended tissue material was
carefully layered over 35 ml PVP-40 gradient (30% Percoll, 0 – 4% PVP). The gradient was centrifuged
at 40 000 x g for 40 min. The mitochondrial band was collected and washed 3 times in sucrose wash
buffer without BSA at 20 000 x g for 20 min and aliquots of isolated mitochondrial protein were stored
at -80°C.
Determination of Root Growth
Plant line seeds were washed in 70% (v/v) ethanol for 2 min and in sterilization solution (5% (v/v)
bleach, 0.1% (v/v) Tween 20) for 5 min with periodical shaking. Seeds were washed 5 times in sterile
water before individual seeds were transferred onto 100 mm square petri dishes containing MS media
(half-strength Murashige and Skoog medium without vitamins, half-strength Gamborg B5 vitamin
67
solution, 5 mM MES, 2.5% (w/v) sucrose, pH 5.8). Plates were wrapped in aluminium foil and kept at
4°C for 48 hours before being transferred into a growth chamber set up with controlled conditions
(16/8-h light/dark period with light intensity of 100–125 µmol m2 sec-1 at 22°C). Over a time period of
2 weeks root length development was documented and root area calculated using Image J.
Designing SDHAF4 GFP Construct
Gateway Technologies (ThermoFisher) was used to design GFP construct. Full length SDHAF4 genomic
sequence was amplified in a PCR reaction designing primers with attb overlap:
Primer Forward: GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACCATGGCGACGAACAACATCGTACG
Primer reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTCGAAATCAGAGCATCGACCACGTTG
PCR fragments were loaded onto 1.5% agarose gel, followed by gel purification (Qiagen). Purified DNA
of SDHAF4 was cloned into GFP vector (pDest/NGFP, Gateway Technology) under the control of 35S
promoter of cauliflower mosaic virus using BP and LR reaction kit (Thermofisher), followed by
transformation into E.coli (DH5α). A plasmid isolation using Plasmid Midi Kit (Qiagen) was performed
as described by the manufacturer (www.qiagen.com) and plasmids of GFP constructs of SDHAF4 were
stored at -20°C.
Arabidopsis Transient Transformation using Gold Particle Bombardment
As a mitochondria marker, red fluorescent protein was fused to Glycine max alternative oxidase
(RFP_AOX). Arabidopsis suspension cell culture was used for transient transformation. Arabidopsis
cells were cultured in a 250 ml conical flask containing cell culture media (1x Murashige and Skoog
medium without vitamins, 3% (w/v) sucrose, 0.5 mg/liter naphthalene acetic acid, 0.05 mg/liter
kinetin, pH 5.8). Cell cultures were sub-cultured every 7 days. For transformation, 4 to 5 days after sub-
culturing, 1 to 2 ml of culture is placed onto sterile Whatman filter paper and placed onto cell culture
MS plates containing mannitol as osmoticum 2 hours prior to transformation. 0.03 g of 1 micron gold
particles were weight into a 1.5 ml microcentrifuge tube and 1 ml of 70% ethanol was added. It was
votexed intensively for 3 to 5 min and quickly spinned afterwards. Supernatant was removed and 1 ml
of 100% ethanol was added and soaked for 15 min, followed by a quick centrifugation and the discard
of the supernatant after. Gold was washed twice with 1 ml 70% ethanol and resuspended in 500 µl
50% (v/v) glycerol and aliquoted in 50 µl aliquots for transformation use.
To 50 µl of gold, 5 µl of DNA (SDHAF4, AOX; 1 µg/µl) were added and mixed. Whilst vortexed, 50 µl of
2.5 M CaCl2 and 20 µl of 100 mM Spermidine were added straight after each other. Tubes were mixed,
quickly centrifuged and supernatant was removed. 140 µl of 70% ethanol was added, mixed and
supernatant removed, followed by adding 140 µl of 100% ethanol, vortex and removal of supernatant.
At last 56 µl of 100% ethanol were added.
68
7 macrocarriers were prepared for each and precipitated gold was resuspended before 8 µl were
transferred onto the center of each macrocarrier. Ethanol was allowed to dry.
Arabidopsis cell culture was transformed using PDS-1000 system according to the manufacturer’s
instructions (Bio-Rad). Gold particles were fired under vacuum at an approximately pressure of 1300
psi onto cells. Cells were kept at 22˚C in the dark for 12 – 24 hours before GFP and RFP were visualized
at 100 x magnification using a BX61 Olympus microscope with the excitation of 460/480 nm (GFP) and
535/555 nm (RFP), and emission wavelengths of 495–540 nm (GFP) and 570–625 nm (RFP). Images
were captured using CellR imaging software as previously described (Carrie et al. 2009).
Metabolite Extraction and GC/MS Data Analysis of Arabidopsis Leaves
2 weeks old plant leaves grown on MS petri dishes under long day conditions were collected in 2 ml
microfuge tubes and kept in liquid nitrogen. Stainless grinding balls were added and leave tissue was
homogenized twice using a mixer mill (MM 301, Retsch) at frequency 20/ s for 1 min each. 150 µl of
metabolite extraction medium (MEM, 20 ml of HPLC grade methanol, 2 ml fresh MilliQ water and 1 ml
Ribitol (0.2 mg/ml)) per 10 mg leave material was added to samples, mixed and incubated at 65°C for
20 min. Samples were centrifuged at maximum speed for 10 min and 60 µl of supernatant was
transferred into verex insert (6 mm diameter, phenomenex) tubes and set in 2 ml tubes. Samples were
vacuum dried and derivatized before analyzed on an Agilent GC/MSD system (Agilent Technologies).
Data pre-processing and statistical analysis were performed using METABOLOME-EXPRESS software
(version 1.0, http://www.metabolome-express.org) as described previously (Carroll et al. 2010).
Quantitative RT-PCR to determine SDHAF4 gene expression
Ler and sdhaf4 plants were grown on soil under long day conditions for 3 weeks. RNA isolation was
performed using RNAeasy extraction kit (Qiagen), following the manufacturer’s instructions. 3 µg of
DNA free RNA sample was used for cDNA synthesis using reverse-Transcriptase (RT) provided in
Superscript III kit (Invitrogen). 1 µl of 25 fold diluted RT reaction was used for quantitative RT-PCR
reaction. Samples were loaded to 384-well plates and mixed with 4 µl of SYBR Green I Master Mix
(Roche Diagnostics). Samples were analyzed using the LightCycler 480 Roche real-time PCR system as
described previously (de Longevialle et al. 2008). Primers are listed in Supplemental Table 2.
SDH Activity and Kinetic Analysis
SDH activity was measured spectrophotometrically, following the reduction of DCPIP at 600 nm, using
succinate as substrate directly at the subunit SDH1. Isolated Arabidopsis mitochondria (50 µg) of WT
and sdhaf4 were used in 1 ml of reaction medium (50 mM potassium phosphate pH 7.4, 0.1 mM EDTA,
0.1% (w/v) BSA, 10 mM potassium cyanide, 0.12 mM dichlorophenolindophenol (DCPIP) and 1.6 mM
69
phenazine methosulfate (PMS)). To calculate SDH activity, an extinction coefficient of 21 mM-1 cm-1 at
600 nm for DCPIP was used. Kinetic calculations of Michaelis-Menten constant Km and Vmax were
determined using R Software (script can be found in Supplemental Fig. 4).
Measurement of Oxygen Uptake Using Clark Electrode
Oxygen consumption was measured using an O2 Clark electrode. Isolated Arabidopsis mitochondria
(100 µg) of WT and sdhaf4 were used and oxygen uptake measured as previously described (Huang et
al. 2013) in the presence of either 5 mM succinate or 1 mM NADH with the addition of 1 mM cyanide
(KCN).
Measurement of Flavin-protein Binding
Isolated mitochondria protein samples were separated on a SDS mini-gel (Mini-PROTEAN, any kD,
Biorad). 10 µg of mitochondrial protein was mixed with β-mercaptoethanol and 2x SDS buffer (8% SDS,
125 mM Tris-HCL, 20% glycerol, spatel bromphenolblue (BPB)) in a 1:4 ratio and samples were
incubated at 95°C for 3 min before loaded onto the mini-gel. The gel run was set to a constant voltage
of 200 V for 20 min. Flavin-protein binding was measured based on the method described in Bafunno
et al. (2004). After electrophoresis, the gel was incubated in 10% acetic acid solution and scanned
before and after the treatment using a Typhoon Trio Laser Imager (Amersham Biosciences) using the
filter Cy5 (670 bp) and Cy3 (580 bp). Bounded FAD can be measured based on Gel band area that
becomes visible after acetic acid treatment. ImageJ was used to determine band area between
different genotypes.
Blue Native PAGE and Western Blot SDH1-1 Detection
A pre-cast gradient gel (4.5% - 16%, Invitrogen) was used to load mitochondria samples of WT and
sdhaf4. 30 µg of mitochondria pellet was resuspended in 10 µl solubilization buffer (30 mM HEPES, pH
7.4; 150 mM potassium acetate, 10% glycerole, 0.5 g digitonin/ 10 ml) per 100 µg mitochondrial
protein. Samples were incubated on ice for 20 min, followed by a second centrifugation for 20 min at
18 300 x g at 4°C. Supernatant was transferred into a new 1.5 ml microfuge tube and 1 µl 5% Serva
Blue G per 20 µl of solubilisation buffer was added. Gel electrophoresis was running for 150 V for 2 to
3 hours following manufacturer’s protocol.
For western blot transfer, the protein gel was soaked in transfer buffer (25 mM Tris-HCL (pH 7.6), 192
mM glycine, 20% methanol, 0.03% SDS) for 30 min before assembled in a Hoefer semiphor semi-dry
blotting apparatus in between 3 layers of whatman paper on the bottom, followed by a layer of PVDF
membrane, the gel on top of the membrane and another 3 layers of whatman paper on top of the gel.
All layers were soaked in transfer buffer and the membrane was incubated in methanol for 2 min,
70
followed by incubation in transfer buffer for 5 min prior to assembly. Blot transfer was set up for 0.8
mA/ cm2 membrane area and voltage was limited to 100 V. After blot transfer, the membrane was
incubated in blocking solution (3 ml of 10 x blocking solution (Sigma), 27 ml of 1x TBS Tween buffer
(1.5 M NaCl, 100 mM Tris-HCL pH 7.4) at room temperature for 1 hour before incubated with primary
antibody in a 1:1000 dilution in TBS Tween buffer (SDH1-1 purified from rabbit, kindly provided by
Prof. Hans-Peter Braun, Germany) overnight at 4°C on a shaker. Membrane was washed in TBS Tween
solution 3 times (rinse, 15 min, 5 min) before incubated with secondary antibody (Anti-rabbit IgG
(Sigma)) for 1 hour at room temperature. Washing steps in TBS Tween buffer were repeated and
membrane was detected using 3 ml of western blot detection substrates in a 1:1 ratio (Clarity Western
Blotting Substrates, Biorad).
Multiple Reaction Monitoring (MRM) Sample Preparation and Analysis
50 to 100 µg of isolated mitochondrial protein extraction (see Isolation of mitochondria) per plant line
were used for MRM analysis. Whole mitochondria protein samples as well as membrane and soluble
fractions were used. To separate soluble and membrane mitochondrial fractions, whole mitochondria
samples were frozen and thawed 3 times while being vortexed in between. To separate fractions,
samples were centrifuged at 20 000 x g for 20 min. Supernatant was transferred into a new tube
(soluble fraction) and the pellet was resuspended in sucrose wash buffer (membrane fraction).
4 volumes of acetone (pre-chilled at -20°C) were added to the samples and incubated overnight at -
20°C for acetone precipitation. Protein samples were centrifuged at 20 000 x g for 20 min at 4°C and
the pellet was washed twice with 100% chilled acetone before centrifuged at 20 000 x g again as
described before. Acetone was removed and the samples were centrifuged in a vacuum centrifuge for
15 min to completely remove the acetone. Pellets were resuspended in buffer containing 7 M Urea, 2
M Thiourea, 50 mM NH4HCO3 and 10 mM DTT. Samples were solubilized at room temperature (RT)
shaking with 500 rpm. Iodacetamide (IAA) was added to a final concentration of 25 mM and samples
were incubated for 45 min at RT in the dark before diluted to a final concentration to ≤ 1 M urea using
50 mM NH4HCO3. Trypsin (0.8 µg/ µl) was added to the samples in a 1:20 ratio of trypsin to protein
content and samples were incubated overnight at 37°C, followed by acidification to 0.1% using formic
acid (FA). Peptides from trypsin digested protein extracts from soluble and membrane fractions were
analyzed by triple-quadrupole mass spectrometry as described previously (Huang et al. 2013). The
following peptide sequences were used:
71
Protein Peptide sequence
SDH1 AVIELENYGLPFSR
SMTMEIR
SSYTIVDHTYDAVVVGAGGAGLR
SDH2 NEMDPSLTFR
SDH6 FMEWWER
LSFFENYTR
SDH7 ALLAEDASLR
SDHAF2 AAAGQPWVR
SDHAF4 YGDWEQR
A 6495 triple-quadrupole mass spectrometer (Agilent Technologies, Santa Clara, CA, USA) regulated
by MassHunter Workstation Data Acquisition software (version B.07.01, build 7.1.7112.0, Agilent
Technologies) was used and MRM data was analyzed in Skyline (version 3.5.0.9319, MacCoss Lab,
University of Washington, USA; https://skyline.gs.washington.edu) by integrating peak areas for each
quantifier ion. To correct for differences, the sum of all detected peptides in each run was normalized
to the sum of ATP Synthase peptides.
72
Literature cited
Bafunno V, Giancaspero TA, Brizio C, Bufano D, Passarella S, Boles E, Barile M (2004) Riboflavin uptake and FAD synthesis in Saccharomyces cerevisiae mitochondria: involvement of the Flx1p carrier in FAD export. The Journal of biological chemistry 279 (1):95-102. doi:10.1074/jbc.M308230200
Belt K, Huang S, Thatcher LF, Casarotto H, Singh K, Van Aken O, Millar AH (2017) Salicylic acid-dependent plant stress signalling via mitochondrial succinate dehydrogenase. Plant Physiol. doi:10.1104/pp.16.00060
Bezawork-Geleta A, Dong L, Rohlena J, Neuzil J (2016) The Assembly Factor SDHAF2 Is Dispensable for Flavination of the Catalytic Subunit of Mitochondrial Complex II in Breast Cancer Cells. J Biol Chem 291 (41):21414-21420. doi:10.1074/jbc.C116.755017
Bezawork-Geleta A, Rohlena J, Dong L, Pacak K, Neuzil J (2017) Mitochondrial Complex II: At the Crossroads. Trends Biochem Sci 42 (4):312-325. doi:10.1016/j.tibs.2017.01.003
Burger G, Lang BF, Reith M, Gray MW (1996) Genes encoding the same three subunits of respiratory complex II are present in the mitochondrial DNA of two phylogenetically distant eukaryotes. Proceedings of the National Academy of Sciences 93 (6):2328-2332
Carrie C, Kuhn K, Murcha MW, Duncan O, Small ID, O'Toole N, Whelan J (2009) Approaches to defining dual-targeted proteins in Arabidopsis. The Plant journal : for cell and molecular biology 57 (6):1128-1139. doi:10.1111/j.1365-313X.2008.03745.x
Carroll AJ, Badger MR, Harvey Millar A (2010) The MetabolomeExpress Project: enabling web-based processing, analysis and transparent dissemination of GC/MS metabolomics datasets. BMC Bioinformatics 11 (1):376. doi:10.1186/1471-2105-11-376
de Longevialle AF, Hendrickson L, Taylor NL, Delannoy E, Lurin C, Badger M, Millar AH, Small I (2008) The pentatricopeptide repeat gene OTP51 with two LAGLIDADG motifs is required for the cis-splicing of plastid ycf3 intron 2 in Arabidopsis thaliana. The Plant journal : for cell and molecular biology 56 (1):157-168. doi:10.1111/j.1365-313X.2008.03581.x
Ghezzi D, Goffrini P, Uziel G, Horvath R, Klopstock T, Lochmuller H, D'Adamo P, Gasparini P, Strom TM, Prokisch H, Invernizzi F, Ferrero I, Zeviani M (2009) SDHAF1, encoding a LYR complex-II specific assembly factor, is mutated in SDH-defective infantile leukoencephalopathy. Nature genetics 41 (6):654-656. doi:10.1038/ng.378
Gleason C, Huang S, Thatcher LF, Foley RC, Anderson CR, Carroll AJ, Millar AH, Singh KB (2011) Mitochondrial complex II has a key role in mitochondrial-derived reactive oxygen species influence on plant stress gene regulation and defense. Proceedings of the National Academy of Sciences of the United States of America 108 (26):10768-10773. doi:10.1073/pnas.1016060108
Guo J, Lemire BD (2003) The Ubiquinone-binding Site of the Saccharomyces cerevisiae Succinate-Ubiquinone Oxidoreductase Is a Source of Superoxide. J Biol Chem 278 (48):47629-47635. doi:10.1074/jbc.M306312200
Guzy RD, Sharma B, Bell E, Chandel NS, Schumacker PT (2008) Loss of the SdhB, but Not the SdhA, subunit of complex II triggers reactive oxygen species-dependent hypoxia-inducible factor activation and tumorigenesis. Molecular and cellular biology 28 (2):718-731. doi:10.1128/mcb.01338-07
Hao HX, Khalimonchuk O, Schraders M, Dephoure N, Bayley JP, Kunst H, Devilee P, Cremers CW, Schiffman JD, Bentz BG, Gygi SP, Winge DR, Kremer H, Rutter J (2009) SDH5, a gene required for flavination of succinate dehydrogenase, is mutated in paraganglioma. Science 325 (5944):1139-1142. doi:10.1126/science.1175689
Hoekstra AS, Bayley J-P (2013) The role of complex II in disease. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1827 (5):543-551. doi:http://doi.org/10.1016/j.bbabio.2012.11.005
Huang J, Lemire BD (2009) Mutations in the C. elegans succinate dehydrogenase iron-sulfur subunit promote superoxide generation and premature aging. Journal of molecular biology 387 (3):559-569. doi:10.1016/j.jmb.2009.02.028
Huang S, Millar AH (2013a) Sequence diversity and conservation in factors influencing succinate dehydrogenase flavinylation. Plant signaling & behavior 8 (2). doi:10.4161/psb.22815
Huang S, Millar AH (2013b) Succinate dehydrogenase: the complex roles of a simple enzyme. Curr Opin Plant Biol 16 (3):344-349. doi:10.1016/j.pbi.2013.02.007
Huang S, Taylor NL, Stroher E, Fenske R, Millar AH (2013) Succinate dehydrogenase assembly factor 2 is needed for assembly and activity of mitochondrial complex II and for normal root elongation in Arabidopsis. The Plant journal : for cell and molecular biology 73 (3):429-441. doi:10.1111/tpj.12041
73
Imlay JA (1995) A metabolic enzyme that rapidly produces superoxide, fumarate reductase of Escherichia coli. The Journal of biological chemistry 270 (34):19767-19777
Ishii N, M Fujii, Hartman P, Tsuda M, Yasuda K, Senoo-Matsuda N, Yanase S, Ayusawa D, Suzuki. K (1998) A mutation in succinate dehydrogenase cytochrome b causes oxidative stress and ageing in nematodes. Nature 394:694-697
Kim HJ, Jeong MY, Na U, Winge DR (2012) Flavinylation and assembly of succinate dehydrogenase are dependent on the C-terminal tail of the flavoprotein subunit. The Journal of biological chemistry 287 (48):40670-40679. doi:10.1074/jbc.M112.405704
Kounosu A (2014) Analysis of covalent flavinylation using thermostable succinate dehydrogenase from Thermus thermophilus and Sulfolobus tokodaii lacking SdhE homologs. FEBS Letters 588 (6):1058-1063. doi:10.1016/j.febslet.2014.02.022
Lemire BD, Oyedotun KS (2002) The Saccharomyces cerevisiae mitochondrial succinate:ubiquinone oxidoreductase. Biochimica et biophysica acta 1553 (1-2):102-116
Leon G, Holuigue L, Jordana X (2007) Mitochondrial complex II is essential for gametophyte development in Arabidopsis. Plant Physiology 143 (4):1534-1546. doi:10.1104/pp.106.095158
Liang LP, Patel M (2004) Iron-sulfur enzyme mediated mitochondrial superoxide toxicity in experimental Parkinson's disease. Journal of neurochemistry 90 (5):1076-1084. doi:10.1111/j.1471-4159.2004.02567.x
Maio N, Ghezzi D, Verrigni D, Rizza T, Bertini E, Martinelli D, Zeviani M, Singh A, Carrozzo R, Rouault TA (2016) Disease-Causing SDHAF1 Mutations Impair Transfer of Fe-S Clusters to SDHB. Cell metabolism 23 (2):292-302. doi:10.1016/j.cmet.2015.12.005
Messner KR, Imlay JA (1999) The identification of primary sites of superoxide and hydrogen peroxide formation in the aerobic respiratory chain and sulfite reductase complex of Escherichia coli. The Journal of biological chemistry 274 (15):10119-10128
Messner KR, Imlay JA (2002) Mechanism of superoxide and hydrogen peroxide formation by fumarate reductase, succinate dehydrogenase, and aspartate oxidase. The Journal of biological chemistry 277 (45):42563-42571. doi:10.1074/jbc.M204958200
Millar AH, Sweetlove LJ, Giege P, Leaver CJ (2001) Analysis of the Arabidopsis Mitochondrial Proteome. Plant physiology 127 (4):1711-1727. doi:10.1104/pp.010387
Na U, Yu W, Cox J, Bricker DK, Brockmann K, Rutter J, Thummel CS, Winge DR (2014) The LYR factors SDHAF1 and SDHAF3 mediate maturation of the iron-sulfur subunit of succinate dehydrogenase. Cell metabolism 20 (2):253-266. doi:10.1016/j.cmet.2014.05.014
Ohlenbusch A, Edvardson S, Skorpen J, Bjornstad A, Saada A, Elpeleg O, Gartner J, Brockmann K (2012) Leukoencephalopathy with accumulated succinate is indicative of SDHAF1 related complex II deficiency. Orphanet journal of rare diseases 7:69. doi:10.1186/1750-1172-7-69
Rutter J, Winge DR, Schiffman JD (2010) Succinate Dehydrogenase—Assembly, Regulation and Role in Human Disease. Mitochondrion 10 (4):393-401. doi:10.1016/j.mito.2010.03.001
Schikowsky C, Senkler J, Braun H-P (2016) SDH6 and SDH7 contribute to anchoring succinate dehydrogenase to the inner mitochondrial membrane in Arabidopsis thaliana. Plant Physiology. doi:10.1104/pp.16.01675
Schikowsky C, Senkler J, Braun H-P (2017) SDH6 and SDH7 Contribute to Anchoring Succinate Dehydrogenase to the Inner Mitochondrial Membrane in Arabidopsis thaliana. Plant Physiology 173 (2):1094-1108. doi:10.1104/pp.16.01675
Sun F, Huo X, Zhai Y, Wang A, Xu J, Su D, Bartlam M, Rao Z (2005) Crystal structure of mitochondrial respiratory membrane protein complex II. Cell 121 (7):1043-1057. doi:10.1016/j.cell.2005.05.025
Taylor NL, Heazlewood JL, Millar AH (2011) The Arabidopsis thaliana 2-D gel mitochondrial proteome: Refining the value of reference maps for assessing protein abundance, contaminants and post-translational modifications. Proteomics 11 (9):1720-1733. doi:10.1002/pmic.201000620
Van Vranken JG, Bricker DK, Dephoure N, Gygi SP, Cox JE, Thummel CS, Rutter J (2014) SDHAF4 promotes mitochondrial succinate dehydrogenase activity and prevents neurodegeneration. Cell metabolism 20 (2):241-252. doi:10.1016/j.cmet.2014.05.012
Van Vranken JG, Na U, Winge DR, Rutter J (2015) Protein-mediated assembly of succinate dehydrogenase and its cofactors. Critical Reviews in Biochemistry and Molecular Biology 50 (2):168-180. doi:10.3109/10409238.2014.990556
74
Chapter Four:
General Discussion
75
Loss or mutation of SDH subunits and/or assembly factors can result in decreased SDH activity,
accumulation of succinate and alteration in the concentration of other organic acid abundances,
decreased respiration rate and ROS production as well as changes in plant development and stress
response (Leon et al. 2007; Gleason et al. 2011; Huang et al. 2013). Given the variety of plant defects
caused by SDH mutations, it is important to understand the function of SDH in plant metabolism and
development as well as its assembly mechanism in plant mitochondria and the potential for
accumulation of partially assembled SDH sub-complexes in mutants. Mutations affecting the catalytic
subunit SDH1, either, by changing its structure slightly via a point mutation near the succinate binding
site (dsr1) or by silencing the assembly factor necessary for SDH1 maturation (sdhaf2), were shown to
alter a plant’s ability to respond to SA induced stress signalling and made plants susceptible to certain
pathogens (Gleason et al. 2011; Belt et al. 2017). Huge annual losses of crop yield are due to plant
pathogens, therefore, enhancing pathogen resistance and stress response in plants is a major research
focus. Based on investigations on SDH mutants which showed a decreased stress response, a new SA
dependent plant stress signalling pathway was revealed involving SDH as a direct source for ROS and
possible interacting site of SA ((Belt et al. 2017), Chapter 2).
Single Mutations Capable of Changing Enzyme Affinity for the Better or for Worse
Analysis of two SDH1 mutants (dsr1, sdhaf2) revealed a new SA-dependent plant stress signalling
pathway with SDH being the major site for ROS production (Gleason et al. 2011; Belt et al. 2017). As
knockout of SDH1-1 is lethal, the discovery of dsr1, a mutant that carries a point mutation affecting
SDH1-1 and SDH activity, but not showing an effect on plant viability opened up new opportunities to
study SDH1 function in plant metabolism and stress response (Gleason et al. 2011; Belt et al. 2017).
For the first time a SDH mutant was presented that was capable of changing enzyme affinity by
switching a single amino acid at the substrate binding site. The fact that single mutations can alter
enzymatic kinetics has been described previously (Ma et al. 2001; Funke et al. 2006). Mutations in
barley beta-amylase were shown to improve substrate binding affinity (Ma et al. 2001). There are three
allelic forms of barley beta-amylase, each having a different thermostability and kinetic properties,
which influence the malting quality of barley varieties. Ma et al. discovered that an R115C mutation is
the reason for the differences in kinetic properties. The different thermostabilities of beta-amylase
forms are caused by two amino acid substitutions, V233A and L347S, which are responsible for an
enhanced enzyme thermostability index (Ma et al. 2001). By combining the preferred amino acid
residues for higher substrate binding affinity as well as higher thermostability, a better malting quality
barley variety could be generated (Ma et al. 2001). Another example for a single point mutation
changing enzyme kinetics was described for EPSP synthase (5-enolpyruvylshikimate 3-phosphate),
engineered from bacteria in transgenic crops, resistant to the broad-spectrum herbicide glyphosate.
76
Kinetics and crystallography studies on a synthetic EPSP synthase showed that a single point mutation
in the active site (Ala-100-Gly) changes kinetics of the enzyme, allowing glyphosate to bind in an
inhibitory conformation instead of the usual non-inhibitory conformation (Funke et al. 2006). This is
similar to dsr1, which also showed inhibitory effect of SDH due to a possible conformational change at
the succinate binding site (Gleason et al. 2011; Belt et al. 2017). In another study, substitution of Arg-
220 with Thr caused a total loss of enzyme activity of catechol-O-methyltransferase, an enzyme that
degrades drugs and substances containing catechol and catecholamines such as epinephrine or
norepinephrine, in rat liver (Hoffmann et al. 2001). Alterations of Asp-58 to Ala and Gln-61 to Ser
resulted in an increased Km for caffeoyl coenzyme A and caused a decreased catalytic efficiency
(Hoffmann et al. 2001) similar to the changes in SDH kinetics observed for the dsr1 mutant (Belt et al.
2017). In plants, O-methyltransferases are involved in phenylpropanoid biosynthesis. Deletion of two
plant specific amino acid sequences was shown to abolish activity (Hoffmann et al. 2001),
demonstrating again that small changes near the substrate sites of enzymes have the power to alter
their kinetic properties and in doing so either inhibit or enhance enzyme activity.
Plant Mitochondrial ROS Production, Oxidative Stress and Signalling
Two terminal oxidases, Complex IV and alternative oxidase (AOX), are present in mitochondria that
reduce O2 to water. The ETC is known to be a source for ROS production under normal conditions.
Usually, under steady state conditions, high levels of ROS are prevented by antioxidant enzymes like
superoxide dismutase, catalase or ascorbate peroxidase in order to prevent cellular damage.
Nevertheless, under stress conditions (biotic/abiotic) those defence mechanisms can get over-
whelmed and ROS start to accumulate (Jacoby et al. 2012). The UQ pool and Complex I are major sites
for ROS production but recent studies (as well as data obtained within this thesis) demonstrated that
SDH can act as a major site for ROS under certain circumstances (Quinlan et al. 2012; Jardim-Messeder
et al. 2015; Belt et al. 2017). The rate of ROS production within mitochondria depends on the
concentration of O2 as well as the redox poise of the ETC complexes. Therefore, ROS generation is low
under hypoxic conditions (Noctor et al. 2007). ROS production occurs when inhibitors block respiratory
ETC and cause an over reduction of ETC components (Maxwell et al. 1999). This can be altered by
environmental factors as well as chemicals that are able to influence the rate of electron transfer
within the ETC (Moller 2001; Moller et al. 2007; Noctor et al. 2007). Specific inhibitors of the ETC are
usually used to investigate sites of ROS production within the ETC. High rates of ROS were observed
when both terminal oxidases were inhibited by cyanide (KCN) and Salicylhydroxamic acid (SHAM)
(Purvis et al. 1995). Antimycin A blocks electron transfer at the Complex III site, causing leakage of
electrons and ROS production. Rotenone is an inhibitor for Complex I, leading to increased ROS at the
Complex I site in the presence of glutamate as substrate (Chen et al. 2003). However, if succinate is
77
the supplied substrate, antimycin A still increases ROS production, whereas rotenone can decrease
ROS (Panov et al. 2005; Panov et al. 2007). ROS production also decreased when AOX was activated,
which can be achieved by exogenous addition of pyruvate (Purvis 1997; Braidot et al. 1999). This way,
potential pathways of ROS have been identified by using substrates and inhibitors, however, there are
many seemingly contradictory observations in the literature.
Studying and measuring ROS rates in isolated mitochondria is challenging and usually involves a
fluorescent detection system like Amplex Red, MitoSOX or 2’,7’- dichlorofluorescein (DCFDA) (Gleason
et al. 2011; Martin et al. 2013; Belt et al. 2017). However, there are concerns about the specificity of
these systems and possible interference with endogenous redox biology within mitochondria. Based
on ROS measurements obtained within this thesis, it was concluded that a significant ROS
accumulation can occur from just mitochondria itself without the supply of substrates (Belt et al. 2017).
In order to determine a substrate or chemical specific ROS signal, it is essential to compare measured
signals with a negative mitochondria control lacking the substrate/inhibitor or chemical substance.
Failing to use these controls can lead to false assumptions of ROS accumulation, like in previous studies
(Jardim-Messeder et al. 2015; Nie et al. 2015).
The interconnected ROS signalling network in plant cells is complex, which makes it difficult to
determine if specific cellular responses are due to mtROS signals alone or a combination of ROS signals
and downstream signalling pathways (Mittler et al. 2004; Moller and Sweetlove 2010). Therefore,
investigating certain gene expression patterns that occur after treatment of respiratory inhibitors or
transcriptional alterations in plants carrying mutations of mitochondrial genes are useful tools to
determine gene clusters that could be used as markers for mtROS signals or mtROS signal responses.
One example are glutathione-s-transferases (GSTs) which are used as molecular stress markers as they
are upregulated by mtROS. dsr1 was a mutant developed in a forward genetics approach that showed
a loss of specific GSTF8 promoter element activity after SA treatment. Promoter activity could be
restored by exogenous H2O2, suggesting the ROS signal occurs downstream of SA (Gleason et al. 2011).
Studies within this thesis revealed that low concentrations of SA increase SDH activity at the UQ site,
leading to an increase in ROS accumulation, which enhances GSTF8 promoter activity. This
demonstrates that SDH is directly involved in plant stress response in a manner of SA dependent
mitochondrial ROS signalling pathway (Belt et al. 2017).
SA is known to be beneficial in the relationship between plants and pathogens and together with other
plant phytohormones like abscisic acid (ABA), ethylene and jasmonic acid (JA), it forms part of a
complex signalling network involved in many stress related pathways (Bandurska and Stroi ski 2005;
78
Yasuda et al. 2008; Tamaoki et al. 2013; Ben Rejeb et al. 2014). Exposure to abiotic or biotic stress
activates specific ion channels and kinase cascades (Sinha et al. 2011), followed by accumulation of
ROS and/ or specific phytohormones (Ben Rejeb et al. 2014; Huang et al. 2016). This leads to
reprogramming of the genetic machinery in order to adequately react to stress and increase plant
tolerance as well as minimize plant cell damage (Fujita et al. 2006). SA is the most pervasive stress
defence hormone in interactions with biotrophic pathogens (Loake and Grant 2007).
One important signaling pathway regulated by SA is the mitogen-activated protein kinase (MAPK)
pathway with substrates located in the cytoplasm, mitochondria, endoplasmic reticulum and, in
particular, the nucleus (Yoon and Seger 2006). It gets activated by pathogen attack and results in the
induction of pathogenesis-related (PR) genes which trigger a defence reaction (Xiong and Yang 2003).
MAPK cascades respond to a variety of abiotic stresses and regulate many fundamental cellular
processes such as growth, proliferation and differentiation (Ichimura et al. 2000; Gudesblat et al. 2007;
Shaul and Seger 2007). In order to specifically respond to certain stress, SA often acts antagonistically
with other phytohormones like ABA and JA (Asselbergh et al. 2008; Liu et al. 2008; Jaillais and Chory
2010), but recent studies also demonstrated that SA can activate JA signaling (Liu et al. 2016).
Many mitochondrial proteins are known to be involved in plant stress response including alternative
oxidase, NADH-dehydrogenases or heat shock proteins (Clifton et al. 2005; Taylor et al. 2009; Giraud
et al. 2012) as well as many proteins with an unknown function (Van Aken et al. 2009).
Studies of AtOM66, an outer mitochondrial membrane stress-responsive gene, suggested, that it is
involved in cell death and amplifying SA signalling (Zhang et al. 2014). AtOM66 silencing lines did not
show any particular change in phenotype. Overexpression lines (AtOM66OX), on the other hand,
resulted in abnormal rosette development and altered response to cell death and pathogen infection
(Zhang et al. 2014). ATOM66 is strongly induced by biotic and abiotic stress. The overexpression lines
were shown to be more tolerant to drought stress. In addition, they had a decrease in stomatal
conductance and high accumulation of SA (Zhang et al. 2014). Previous studies showed that mutant
plants with high levels of SA result in reduced stomata closure as well as drought tolerance in an SA-
dependent manner (Miura and Tada 2014). AtOM66OX lines showed reduced resistance to the hemi-
biotrophic pathogen P. syringae p.v. tomato (Pst DC3000), similar to the dsr1 phenotype (Gleason et
al. 2011; Zhang et al. 2014). Studies in dsr1 showed SDH is involved downstream of SA whereas the
AtOM66 overexpression seems to induce the high levels of SA in the mutants, thereby, acting possibly
upstream of SA. A possible interaction between AtOM66 and SDH subunits was tested by yeast-two-
hybrid assays, but no interactions with any of the eight subunits could be detected (Zhang et al. 2014).
79
Overall, SA is a widespread plant hormone signalling molecule and high levels can have far reaching
consequences for biotic and abiotic stress response. Mitochondria play a significant part within the
global plant stress signaling pathway by being a source of ROS and harbouring many stress responsive
genes, enzymes and proteins (Huang et al. 2016; Sewelam et al. 2016; Belt et al. 2017).
Studies are controversial in regards to the site of ROS production of ETC components. FAD cofactor as
well as Fe-S centres are suggested (Messner and Imlay 2002; Guo and Lemire 2003; Carrie et al. 2009;
Huang and Lemire 2009). In E. coli it was shown that O2- and H2O2 can be produced by flavoprotein,
purified from sulfite reductase containing only the FAD and flavin mononucleotide cofactor, at about
the same rate as the holoenzyme (Messner and Imlay 1999). Studies of E.coli fumarate reductase,
which catalyses the opposite reaction to SDH by reducing fumarate to succinate, also demonstrated
FAD as the most likely site for ROS production (Messner and Imlay 2002). Studies in yeast SDH, on the
other hand, suggested the UQ site might likely be responsible for ROS production rather than FAD (Guo
and Lemire 2003). Designed mutations in yeast SDH2 and SDH3, as they occur in paraganglioma- and
mev-1-like mutations in human, resulted in decreased succinate-ubiquinone oxidoreductase activities
and hypersensitivity to oxygen and paraquat. Although the mutant enzymes showed lower turnover
rates for UQH2 reduction, higher fractions of the remaining activities were diverted towards ROS
production, suggesting that certain mutations in SDH can lead to a significant source of ROS in
mitochondria, which may contribute to the disease progression in human (Guo and Lemire 2003).
Analysis of a variety of SDH2 mutations introduced to Caenorhabditis elegans showed that a Pro211
mutation located near the UQ reduction site, can become a source of superoxide (Huang and Lemire
2009). Overall, studies are very controversial if it comes to the ROS producing site in SDH. Based on
results obtained within this thesis, FAD does not seem to be the responsible site for ROS produced by
SDH in Arabidopsis. Accumulated FAD bound SDH1 protein did not show a higher rate of ROS
production. This suggests that, at least in plants, FAD by itself is not able to autoxidation.
SDH is not the only ETC complex with a known role in stress response. Another study identified a cold
stress responsive mutant using stress responsive RD29A promoter fused to firefly luciferase led to the
discovery of the frostbite1 (fro1) mutant, which showed reduced luminescence signal after cold
induction in Arabidopsis (Lee et al. 2002). Mapping of FRO1 (At5g67590) revealed that the encoded
protein showed high similarity to the 18 kDa Fe-S subunit of Complex I (Lee et al. 2002). GFP analyses
confirmed location of FRO1 in mitochondria. fro1 mutants showed decreased expression of stress
responsive genes such as RD29A, KIN1, COR15A and COR47, indicating that gene expression induced
by cold acclimation is regulated by mitochondrial function (Lee et al. 2002). Another Complex I T-DNA
insertion line, affecting the same gene as fro1, called ndufs4 (Complex I fragment S subunit 4), showed
80
that the loss of one subunit caused decreased assembly and activity of Complex I, but no significant
changes in general mitochondrial functions including respiration rate (Meyer et al. 2009). ATP
production by OXPHOS was decreased in ndufs4, but this could be tolerated in Arabidopsis due to
rearrangements in cellular metabolism, leading to an altered tolerance to abiotic stress (Meyer et al.
2009). Root growth analysis showed increased tolerance to abiotic stress and microarray analysis
showed increased expression of stress related genes. Nitroblue tetrazolium staining confirmed a
higher ROS production in ndufs4, like it was shown previously for fro1 plants (Lee et al. 2002; Meyer
et al. 2009). Together with the fro1 study, this provides good evidence for cold induced gene regulation
being modulated by mitochondrial function. This is another example of mitochondrial ETC components
being involved in plant stress response and stress responsive gene induction and shows that what was
observed in regards to SDH is a specific example of a wider biological role of the ETC in environmental
response.
81
Assembly of Mitochondrial Succinate Dehydrogenase
Although it is known that SDH plays an important role in plant stress response and plant metabolism,
the assembly of SDH in plants is not well understood. Within this thesis, SDHAF4 was identified as a
second SDH assembly factor in plants, following the previously identified assembly factor SDHAF2. It
was shown that SDHAF4 is important for SDH function as well as assembly of SDH1 to SDH2, an
essential step in order to ensure stability of SDH2 and its assembly to SDH1 (Chapter 3).
The ETC includes four complexes, all are embedded or associated with the inner mitochondrial
membrane (IMM). The assembly of these complexes presents the cell with challenges as the synthesis
and stepwise assembly of individual subunits are transcribed and translated from two different
genomes in two distinct cell compartments. Furthermore, some of the subunits are embedded in the
IMM, very hydrophobic and vulnerable to aggregation before and during complex assembly. In
addition, complexes of the ETC contain redox active cofactors which could potentially cause enhanced
generation of ROS if not appropriately assembled within the native complex. Therefore, mitochondrial
ETC complex assembly factors are important to facilitate cofactor insertion and preventing non-
desirable redox reactions as well as stabilizing assembly intermediates (Fernandez-Vizarra et al. 2009;
Diaz et al. 2011). While in plants Complex I, III and IV harbour 49, 10 and 14 subunits, encoded by both
nuclear and mitochondrial genome, SDH is the only ETC component with just eight subunits or four in
other organisms. Despite the simplicity of eight or four subunits, studies throughout the last 10 years
revealed that SDH, like all other ETC complexes, requires assembly factors for its biogenesis.
SDH1 is formed by four different domains: the FAD binding domain, a capping domain, a helical domain
and a C-terminal domain (Sun et al. 2005). Co-crystallization of SDH bound to competitive inhibitor
NPA (3-nitropropionic acid) revealed, that the putative succinate binding site is directly adjacent to
FAD bound protein (Sun et al. 2005). The precise mechanism behind succinate oxidation is not clear
yet, but based on the co-crystal structure it is likely that the nitryl group of NPA interacts with the FMN
group of FAD (Sun et al. 2005). The insertion of FAD into SDH1 is an essential step and depends on
sufficient FAD levels in the mitochondrial matrix, therefore, synthesis and stabilization of free FAD
plays an important role in SDH1 maturation (Kim and Winge 2013). In yeast, riboflavin kinase (Fmn1),
FAD synthetase (Fad1) and a putative mitochondrial transporter protein (Flx1) are involved in FAD
biosynthesis and delivery to mitochondria (Santos et al. 2000). However, unlike some bacterial SDH1
orthologs, eukaryotic SDH1 does not become flavinated by itself, indicating that other proteins must
be involved to insert FAD into SDH1 (Robinson and Lemire 1996; Kounosu 2014). This insight was
validated by the discovery of yeast Sdh5, later in eukaryotes known as SDHAF2 (Hao et al. 2009).
82
SDHAF2 was shown to directly interact with SDH1 and is required for FAD insertion while at the same
time SDH1 protein is needed for SDHAF2 stabilization. Furthermore, knockout of SDH2 resulted in an
increase in SDHAF2 levels, likely due to the accumulating amount of free SDH1, indicating that actions
of SDHAF2 are happening at an early stage of SDH assembly (Hao et al. 2009; Kim et al. 2012). Following
FAD insertion, SDH1 must be assembled to SDH2. Nevertheless, a small portion of free SDH1 remains
in the mitochondrial matrix. It is likely that SDH1 is present in excess to other SDH core subunits within
the matrix as based on studies in yeast, deletion of SDH1 destabilizes remaining subunits while free
SDH1 levels are maintained in a soluble, assembly-competent matter (Van Vranken et al. 2014; Van
Vranken et al. 2015). The assembly factor SDHAF4 was first identified in yeast and was shown to
interact specifically with flavinated SDH1 to promote the assembly of SDH1 to SDH2 (Van Vranken et
al. 2014). While in yeast, deletion of SDHAF4 decreased presence of SDH2 but did not affect abundance
of SDH1, loss of SDHAF4 in Drosophila showed destabilization of SDH1 as well as SDH2, indicating that
in Drosophila SDHAF4 is required for SDH1 stabilization (Van Vranken et al. 2014). Within this thesis,
the SDHAF4 orthologue in Arabidopsis was shown to be required for SDH1 assembly to SDH2 (Chapter
3). Free SDH1 accumulated as soluble protein in SDHAF4 mutants, indicating that SDH1 exists as a free
stable protein even if SDHAF4 is missing. SDHAF2 levels were increased in SDHAF4 knockout lines while
SDH1 levels remained the same. This observation was similar to the results obtained from SDH2
deficient mutants in yeast (Hao et al. 2009; Kim et al. 2012), demonstrating that SDHAF2 likely
promotes stabilization of SDH1 in Arabidopsis (Chapter 3).
SDH2 forms the Fe-S cluster subunit within SDH. Crystal structure of porcine heart SDH revealed two
distinct domains: the N-terminal domain which harbours the [2Fe- 2S] centre and the C-terminal
domain consisting of the [4Fe-4S] and [3Fe-3S] clusters (Sun et al. 2005). The Fe-S centres are required
for electron transfer from FAD to UQ. During maturation of SDH2, these Fe-S clusters need to be
formed and inserted in SDH2. In the mitochondrial matrix a scaffold complex (ISU) is required for Fe-
S cluster assembly (Yoon and Cowan 2003). Isu are scaffold proteins accepting iron and sulphur to form
Fe-S clusters that get transferred to their target apoproteins (Agar et al. 2000). Glutaredoxins (Grxs),
small proteins acting as oxidoreductases with roles in deglutathionylation of proteins, were shown to
be involved in Fe-S assembly in plant mitochondria (Ströher et al. 2016). It is unknown which of the 33
Grxs are required but recent studies demonstrated that GrxS15 binds Fe-S clusters and is potentially
involved in transfer of Fe-S (Moseler et al. 2015; Ströher et al. 2016).
83
SDHAF1 and SDHAF3 have been identified as SDH assembly factors for SDH2 maturation (Ghezzi et al.
2009; Na et al. 2014). A mutation in SDHAF1 (169G>C) was shown to lead to infantile
leukoencephalopathy in humans (Ghezzi et al. 2009). SDHAF1 protein contains a LYR tripeptide motif
at its N-terminus and biochemical studies revealed that the SDHAF1 C-terminus binds to SDH2 while
the N-terminus binds to the Fe-S clusters (Maio et al. 2016). Similar to mutations in SDHAF2, SDHAF1
mutation causes SDH2 to become unstable, which leads to degradation by Lon proteases. This
indicates that biogenesis of SDH subunits are likely regulated by mitochondrial proteases (Bezawork-
Geleta et al. 2014; Maio et al. 2016). SDHAF3 was suggested to be a chaperone like assembly factor
involved in SDH2 maturation (Na et al. 2014) and likely together with SDHAF1 prevents ROS generation
from SDH2 as it has been shown in Drosophila and yeast (Na et al. 2014; Van Vranken et al. 2014; Van
Vranken et al. 2015). The function and existence of potential SDHAF1 and SDHAF3 orthologues in
plants is unknown. Although an ortholog gene for SDHAF1 may exist in Arabidopsis (At2g39725), no
function or involvement in SDH activity or assembly has been proven. SDHAF3, as it appears in yeast
and Drosophila, cannot be identified by sequence comparison in the Arabidopsis genome. This might
mean that either SDHAF3 is not required for SDH assembly in plants or that it exists as a protein with
little similarity to those in other organisms, which will make it very difficult to identify and a challenge
for the future.
Little is known about the assembly and biogenesis of SDH3 and SDH4 in any organism. The function of
the heme group within these subunits still requires further investigation. SDH3/ SDH4 form the
membrane anchoring domain of SDH. Based on structure analysis of mammalian SDH, SDH3 contains
four helices while SDH4 consists of five (Sun et al. 2005). The N-terminal helix of SDH4 interacts with
SDH2 to promote membrane localization of SDH1/ SDH2 hydrophilic dimer (Sun et al. 2005). Two
transmembrane helices within SDH3 and SDH4 contribute to the formation of a four helix bundle,
which builds the core of the membrane anchor while remaining the transmembrane helix of each
subunit flanks the core (Sun et al. 2005). Furthermore, SDH3 and SDH4 carrying a heme b cofactor
which, based in the structure analysis, is located at the interface of the four helix bundle, which interact
with the porphyrin ring (Sun et al. 2005).
Evolutionary studies have shown that SDH3 and SDH4 evolved differently in plants and recent studies
revealed that the plant specific subunits SDH6 and SDH7 potentially form replacements of helices in
SDH3 and SDH4 that are found in other organisms but got lost in plants throughout evolution
(Schikowsky et al. 2017). SDH3/SDH4 domain contains the UQ binding site and therefore the site of
UQ reduction, which enables the transfer of electrons from succinate to other ETC complexes. As a
matter of fact, there exist two distinct UQ binding sites, Qp and QD with different affinities for UQ
84
(Oyedotun and Lemire 2001; Sun et al. 2005). The QP site contains residues from SDH3, SDH4 and SDH2
including the [3Fe-4S] cluster of SDH2 (Sun et al. 2005). The QD site, which lies closer to the IMS side
and shows lower UQ affinity, is composed entirely of residues from SDH2 (Sun et al. 2005). Although
little is known about how SDH3/ SDH4 intermediate is assembled and stabilized before the formation
of the holo-complex or whether or not chaperones are required for the formation of SDH3/SDH4
intermediate, it is known that deletion of either SDH1 or SDH2 causes almost complete loss of SDH3
and SDH4 in yeast (Kim et al. 2012; Na et al. 2014). Therefore, assembly of the membrane anchor
domain is likely somehow connected to the assembly of the hydrophilic domain.
Conclusions and Future Directions
Studies within the last recent years showed how SDH has developed into an important regulator in
mitochondrial and cellular metabolism as well as in mitochondrial stress response and signaling. In
human disease, a variety of SDH mutations could be linked to tumor and neurodegeneration diseases
and in plants SDH mutations have been linked to pathogen sensitivity. Despite such progress, further
studies will be necessary in order to understand the full impact of SDH mutations and the regulation
of SDH assembly. In particular in regards to SDH3 and SDH4, where there appears to be a discrepancy
between different species and even between monocotyledous and dicotyledous plants (Huang and
Millar 2013). The complexity of SDH assembly might be best illustrated by the fact that four assembly
factors and potentially more are already involved in assembly and maturation of the two hydrophilic
subunits SDH1 and SDH2, which does not even consider SDH3 and SDH4 formation or the combination
of the two sub-complexes. As the abundance of SDH6 and SDH7 did not significantly changed when
SDH1 maturation was disrupted, the membrane arm is likely assembled independent from the
hydrophilic domain in plants. Once assembled, its function is important for healthy plant development
but we are still just at the beginning of understanding its complexity and many questions remain. We
still need to know:
What is the function of the plant specific subunits SDH5 and SDH8? Analysis of knockout/ knockdown
lines for SDH5 and SDH8 as well as tandem affinity purification could be useful to investigate function
and protein interaction with other subunits of SDH.
How is SDH3 and SDH4 assembled and how many assembly factors are involved? Is it assembled prior
to or after the formation of the SDH1/ SDH2 intermediate? This will be challenging to determine in
plants. In humans, SDH assembly factors are often identified by mutations occurring in patients
suffering from a specific disease, but in plants it will be difficult to screen for a specific phenotype as
SDH mutations affecting a variety of plant functions.
85
Does SDHAF1 and SDHAF3 exist in plants, if not, how is Fe-S insertion into SDH2 regulated in plants?
In humans and yeast SDHAF1 and SDHAF3 are known to regulate Fe-S insertion into SDH2 but this
could not be confirmed for plants yet as no orthologue for SDHAF3 exist and it is unclear if the
orthologue of SDHAF1 is indeed a SDH assembly factor. Using SDHAF1 mutant lines, further analysis
will be necessary to determine the purpose of AtSDHAF1.
Where does SA interact with SDH? While evidence to date suggests its likely at the UQ site, physical
evidence of binding or protein-interaction of SA with either SDH3 or SDH4 is needed to confirm this
hypothesis. To identify SA binding proteins, SA antibodies together with mass spectrometry could be
used on mitochondria extracts to identify those proteins. Alternatively, mitochondrial proteins could
be separated on a SA column and SA binding proteins could be identified in the eluate (Chen and Klessig
1991; Manohar et al. 2014).
Why does SA increase SDH activity at the UQ site in low concentration but act as an inhibitor at higher
concentrations? Assuming SA is able to bind to a UQ site, it is unclear how that interaction would
increase enzyme activity in low but inhibit it at higher concentrations. This phenomenon was not
observed before in any other organism and might be a plant specific interaction with a yet unknown
mechanism. Keeping in mind the existence of two UQ sites and previous studies that showed different
affinities for UQ binding (Sun et al. 2005), it seems plausible that SA might bind with a different affinity
to these sites. This could be an explanation for the increase in activity at low concentrations and the
inhibitory effect at higher levels of SA.
Overall, the work presented in this thesis demonstrated the importance of functional SDH1 in
mitochondrial plant stress signalling and pathogen response. Changes in structure and abundance of
mature SDH1 caused severe decrease of SA dependent stress signaling. By getting a better
understanding of targets involved in stress signalling, plants can be bred in the future to increase
agricultural sustainability and food security.
86
Literature cited
Agar JN, Krebs C, Frazzon J, Huynh BH, Dean DR, Johnson MK (2000) IscU as a Scaffold for Iron−Sulfur Cluster Biosynthesis: Sequential Assembly of [2Fe-2S] and [4Fe-4S] Clusters in IscU. Biochemistry 39 (27):7856-7862. doi:10.1021/bi000931n
Asselbergh B, Achuo AE, Hofte M, Van Gijsegem F (2008) Abscisic acid deficiency leads to rapid activation of tomato defence responses upon infection with Erwinia chrysanthemi. Molecular plant pathology 9 (1):11-24. doi:10.1111/j.1364-3703.2007.00437.x
Bandurska H, Stroi ski A (2005) The effect of salicylic acid on barley response to water deficit. Acta Physiologiae Plantarum 27 (3):379-386. doi:10.1007/s11738-005-0015-5
Belt K, Huang S, Thatcher LF, Casarotto H, Singh K, Van Aken O, Millar AH (2017) Salicylic acid-dependent plant stress signalling via mitochondrial succinate dehydrogenase. Plant Physiol. doi:10.1104/pp.16.00060
Ben Rejeb I, Pastor V, Mauch-Mani B (2014) Plant Responses to Simultaneous Biotic and Abiotic Stress: Molecular Mechanisms. Plants 3 (4):458-475. doi:10.3390/plants3040458
Bezawork-Geleta A, Saiyed T, Dougan DA, Truscott KN (2014) Mitochondrial matrix proteostasis is linked to hereditary paraganglioma: LON-mediated turnover of the human flavinylation factor SDH5 is regulated by its interaction with SDHA. The FASEB Journal 28 (4):1794-1804. doi:10.1096/fj.13-242420
Braidot E, Petrussa E, Vianello A, Macri F (1999) Hydrogen peroxide generation by higher plant mitochondria oxidizing complex I or complex II substrates. FEBS Lett 451 (3):347-350
Carrie C, Kuhn K, Murcha MW, Duncan O, Small ID, O'Toole N, Whelan J (2009) Approaches to defining dual-targeted proteins in Arabidopsis. The Plant journal : for cell and molecular biology 57 (6):1128-1139. doi:10.1111/j.1365-313X.2008.03745.x
Chen Q, Vazquez EJ, Moghaddas S, Hoppel CL, Lesnefsky EJ (2003) Production of Reactive Oxygen Species by Mitochondria: CENTRAL ROLE OF COMPLEX III. J Biol Chem 278 (38):36027-36031. doi:10.1074/jbc.M304854200
Chen Z, Klessig DF (1991) Identification of a Soluble Salicylic Acid-Binding Protein that May Function in Signal Transduction in the Plant Disease-Resistance Response. Proceedings of the National Academy of Sciences of the United States of America 88 (18):8179-8183
Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, Millar AH, Day DA, Whelan J (2005) Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana. Plant Mol Biol 58 (2):193. doi:10.1007/s11103-005-5514-7
Diaz F, Kotarsky H, Fellman V, Moraes CT (2011) Mitochondrial disorders caused by mutations in respiratory chain assembly factors. Seminars in fetal & neonatal medicine 16 (4):197-204. doi:10.1016/j.siny.2011.05.004
Fernandez-Vizarra E, Tiranti V, Zeviani M (2009) Assembly of the oxidative phosphorylation system in humans: what we have learned by studying its defects. Biochimica et biophysica acta 1793 (1):200-211. doi:10.1016/j.bbamcr.2008.05.028
Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y, Yamaguchi-Shinozaki K, Shinozaki K (2006) Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr Opin Plant Biol 9 (4):436-442. doi:10.1016/j.pbi.2006.05.014
Funke T, Han H, Healy-Fried ML, Fischer M, Schönbrunn E (2006) Molecular basis for the herbicide resistance of Roundup Ready crops. Proceedings of the National Academy of Sciences 103 (35):13010-13015. doi:10.1073/pnas.0603638103
Ghezzi D, Goffrini P, Uziel G, Horvath R, Klopstock T, Lochmuller H, D'Adamo P, Gasparini P, Strom TM, Prokisch H, Invernizzi F, Ferrero I, Zeviani M (2009) SDHAF1, encoding a LYR complex-II specific assembly factor, is mutated in SDH-defective infantile leukoencephalopathy. Nature genetics 41 (6):654-656. doi:10.1038/ng.378
Giraud E, Van Aken O, Uggalla V, Whelan J (2012) REDOX regulation of mitochondrial function in plants. Plant, cell & environment 35 (2):271-280. doi:10.1111/j.1365-3040.2011.02293.x
Gleason C, Huang S, Thatcher LF, Foley RC, Anderson CR, Carroll AJ, Millar AH, Singh KB (2011) Mitochondrial complex II has a key role in mitochondrial-derived reactive oxygen species influence on plant stress gene regulation and defense. Proceedings of the National Academy of Sciences of the United States of America 108 (26):10768-10773. doi:10.1073/pnas.1016060108
Gudesblat GE, Iusem ND, Morris PC (2007) Guard cell-specific inhibition of Arabidopsis MPK3 expression causes abnormal stomatal responses to abscisic acid and hydrogen peroxide. The New phytologist 173 (4):713-721. doi:10.1111/j.1469-8137.2006.01953.x
87
Guo J, Lemire BD (2003) The Ubiquinone-binding Site of the Saccharomyces cerevisiae Succinate-Ubiquinone Oxidoreductase Is a Source of Superoxide. J Biol Chem 278 (48):47629-47635. doi:10.1074/jbc.M306312200
Hao HX, Khalimonchuk O, Schraders M, Dephoure N, Bayley JP, Kunst H, Devilee P, Cremers CW, Schiffman JD, Bentz BG, Gygi SP, Winge DR, Kremer H, Rutter J (2009) SDH5, a gene required for flavination of succinate dehydrogenase, is mutated in paraganglioma. Science 325 (5944):1139-1142. doi:10.1126/science.1175689
Hoffmann L, Maury S, Bergdoll M, Thion L, Erard M, Legrand M (2001) Identification of the Enzymatic Active Site of Tobacco Caffeoyl-coenzyme A O-Methyltransferase by Site-directed Mutagenesis. J Biol Chem 276 (39):36831-36838. doi:10.1074/jbc.M104977200
Huang J, Lemire BD (2009) Mutations in the C. elegans succinate dehydrogenase iron-sulfur subunit promote superoxide generation and premature aging. Journal of molecular biology 387 (3):559-569. doi:10.1016/j.jmb.2009.02.028
Huang S, Millar AH (2013) Sequence diversity and conservation in factors influencing succinate dehydrogenase flavinylation. Plant signaling & behavior 8 (2). doi:10.4161/psb.22815
Huang S, Taylor NL, Stroher E, Fenske R, Millar AH (2013) Succinate dehydrogenase assembly factor 2 is needed for assembly and activity of mitochondrial complex II and for normal root elongation in Arabidopsis. The Plant journal : for cell and molecular biology 73 (3):429-441. doi:10.1111/tpj.12041
Huang S, Van Aken O, Schwarzländer M, Belt K, Millar AH (2016) The Roles of Mitochondrial Reactive Oxygen Species in Cellular Signaling and Stress Response in Plants. Plant Physiology 171 (3):1551-1559. doi:10.1104/pp.16.00166
Ichimura K, Mizoguchi T, Yoshida R, Yuasa T, Shinozaki K (2000) Various abiotic stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. The Plant journal : for cell and molecular biology 24 (5):655-665
Jacoby RP, Li L, Huang S, Pong Lee C, Millar AH, Taylor NL (2012) Mitochondrial composition, function and stress response in plants. Journal of integrative plant biology 54 (11):887-906. doi:10.1111/j.1744-7909.2012.01177.x
Jaillais Y, Chory J (2010) Unraveling the paradoxes of plant hormone signaling integration. Nature structural & molecular biology 17 (6):642-645. doi:10.1038/nsmb0610-642
Jardim-Messeder D, Caverzan A, Rauber R, de Souza Ferreira E, Margis-Pinheiro M, Galina A (2015) Succinate dehydrogenase (mitochondrial complex II) is a source of reactive oxygen species in plants and regulates development and stress responses. The New phytologist 208 (3):776-789. doi:10.1111/nph.13515
Kim HJ, Jeong MY, Na U, Winge DR (2012) Flavinylation and assembly of succinate dehydrogenase are dependent on the C-terminal tail of the flavoprotein subunit. The Journal of biological chemistry 287 (48):40670-40679. doi:10.1074/jbc.M112.405704
Kim HJ, Winge DR (2013) Emerging Concepts in the Flavinylation of Succinate Dehydrogenase. Biochimica et biophysica acta 1827 (5):627-636. doi:10.1016/j.bbabio.2013.01.012
Kounosu A (2014) Analysis of covalent flavinylation using thermostable succinate dehydrogenase from Thermus thermophilus and Sulfolobus tokodaii lacking SdhE homologs. FEBS Letters 588 (6):1058-1063. doi:http://dx.doi.org/10.1016/j.febslet.2014.02.022
Lee B-h, Lee H, Xiong L, Zhu J-K (2002) A Mitochondrial Complex I Defect Impairs Cold-Regulated Nuclear Gene Expression. The Plant cell 14 (6):1235-1251. doi:10.1105/tpc.010433
Leon G, Holuigue L, Jordana X (2007) Mitochondrial complex II is essential for gametophyte development in Arabidopsis. Plant Physiology 143 (4):1534-1546. doi:10.1104/pp.106.095158
Liu C, Ruan Y, Lin Z, Wei R, Peng Q, Guan C, Ishii H (2008) Antagonism between acibenzolar-S-methyl-induced systemic acquired resistance and jasmonic acid-induced systemic acquired susceptibility to Colletotrichum orbiculare infection in cucumber. Physiological and Molecular Plant Pathology 72 (4):141-145. doi:http://dx.doi.org/10.1016/j.pmpp.2008.08.001
Liu L, Sonbol FM, Huot B, Gu Y, Withers J, Mwimba M, Yao J, He SY, Dong X (2016) Salicylic acid receptors activate jasmonic acid signalling through a non-canonical pathway to promote effector-triggered immunity. Nature communications 7:13099. doi:10.1038/ncomms13099
Loake G, Grant M (2007) Salicylic acid in plant defence—the players and protagonists. Current Opinion in Plant Biology 10 (5):466-472. doi:http://dx.doi.org/10.1016/j.pbi.2007.08.008
Ma YF, Evans DE, Logue SJ, Langridge P (2001) Mutations of barley beta-amylase that improve substrate-binding affinity and thermostability. Molecular genetics and genomics : MGG 266 (3):345-352. doi:10.1007/s004380100566
88
Maio N, Ghezzi D, Verrigni D, Rizza T, Bertini E, Martinelli D, Zeviani M, Singh A, Carrozzo R, Rouault TA (2016) Disease-Causing SDHAF1 Mutations Impair Transfer of Fe-S Clusters to SDHB. Cell metabolism 23 (2):292-302. doi:10.1016/j.cmet.2015.12.005
Manohar M, Tian M, Moreau M, Park S-W, Choi HW, Fei Z, Friso G, Asif M, Manosalva P, von Dahl CC, Shi K, Ma S, Dinesh-Kumar SP, O'Doherty I, Schroeder FC, van Wijk KJ, Klessig DF (2014) Identification of multiple salicylic acid-binding proteins using two high throughput screens. Frontiers in Plant Science 5:777. doi:10.3389/fpls.2014.00777
Martin MV, Fiol DF, Sundaresan V, Zabaleta EJ, Pagnussat GC (2013) oiwa, a female gametophytic mutant impaired in a mitochondrial manganese-superoxide dismutase, reveals crucial roles for reactive oxygen species during embryo sac development and fertilization in Arabidopsis. The Plant cell 25 (5):1573-1591. doi:10.1105/tpc.113.109306
Maxwell DP, Wang Y, McIntosh L (1999) The alternative oxidase lowers mitochondrial reactive oxygen production in plant cells. Proceedings of the National Academy of Sciences 96 (14):8271-8276. doi:10.1073/pnas.96.14.8271
Messner KR, Imlay JA (1999) The identification of primary sites of superoxide and hydrogen peroxide formation in the aerobic respiratory chain and sulfite reductase complex of Escherichia coli. The Journal of biological chemistry 274 (15):10119-10128
Messner KR, Imlay JA (2002) Mechanism of superoxide and hydrogen peroxide formation by fumarate reductase, succinate dehydrogenase, and aspartate oxidase. The Journal of biological chemistry 277 (45):42563-42571. doi:10.1074/jbc.M204958200
Meyer EH, Tomaz T, Carroll AJ, Estavillo G, Delannoy E, Tanz SK, Small ID, Pogson BJ, Millar AH (2009) Remodeled respiration in ndufs4 with low phosphorylation efficiency suppresses Arabidopsis germination and growth and alters control of metabolism at night. Plant Physiol 151 (2):603-619. doi:10.1104/pp.109.141770
Mittler R, Vanderauwera S, Gollery M, Van Breusegem F (2004) Reactive oxygen gene network of plants. Trends in plant science 9 (10):490-498. doi:10.1016/j.tplants.2004.08.009
Miura K, Tada Y (2014) Regulation of water, salinity, and cold stress responses by salicylic acid. Frontiers in Plant Science 5:4. doi:10.3389/fpls.2014.00004
Moller IM (2001) PLANT MITOCHONDRIA AND OXIDATIVE STRESS: Electron Transport, NADPH Turnover, and Metabolism of Reactive Oxygen Species. Annual review of plant physiology and plant molecular biology 52:561-591. doi:10.1146/annurev.arplant.52.1.561
Moller IM, Jensen PE, Hansson A (2007) Oxidative modifications to cellular components in plants. Annual review of plant biology 58:459-481. doi:10.1146/annurev.arplant.58.032806.103946
Moller IM, Sweetlove LJ (2010) ROS signalling--specificity is required. Trends in plant science 15 (7):370-374. doi:10.1016/j.tplants.2010.04.008
Moseler A, Aller I, Wagner S, Nietzel T, Przybyla-Toscano J, Mühlenhoff U, Lill R, Berndt C, Rouhier N, Schwarzländer M, Meyer AJ (2015) The mitochondrial monothiol glutaredoxin S15 is essential for iron-sulfur protein maturation in Arabidopsis thaliana. Proceedings of the National Academy of Sciences 112 (44):13735-13740. doi:10.1073/pnas.1510835112
Na U, Yu W, Cox J, Bricker DK, Brockmann K, Rutter J, Thummel CS, Winge DR (2014) The LYR factors SDHAF1 and SDHAF3 mediate maturation of the iron-sulfur subunit of succinate dehydrogenase. Cell metabolism 20 (2):253-266. doi:10.1016/j.cmet.2014.05.014
Nie S, Yue H, Zhou J, Xing D (2015) Mitochondrial-Derived Reactive Oxygen Species Play a Vital Role in the Salicylic Acid Signaling Pathway in <italic>Arabidopsis thaliana</italic>. PLoS ONE 10 (3):e0119853. doi:10.1371/journal.pone.0119853
Noctor G, De Paepe R, Foyer CH (2007) Mitochondrial redox biology and homeostasis in plants. Trends in plant science 12 (3):125-134. doi:http://dx.doi.org/10.1016/j.tplants.2007.01.005
Oyedotun KS, Lemire BD (2001) The Quinone-binding sites of the Saccharomyces cerevisiae succinate-ubiquinone oxidoreductase. The Journal of biological chemistry 276 (20):16936-16943. doi:10.1074/jbc.M100184200
Panov A, Dikalov S, Shalbuyeva N, Hemendinger R, Greenamyre JT, Rosenfeld J (2007) Species- and tissue-specific relationships between mitochondrial permeability transition and generation of ROS in brain and liver mitochondria of rats and mice. American journal of physiology Cell physiology 292 (2):C708-718. doi:10.1152/ajpcell.00202.2006
Panov A, Dikalov S, Shalbuyeva N, Taylor G, Sherer T, Greenamyre JT (2005) Rotenone model of Parkinson disease: multiple brain mitochondria dysfunctions after short term systemic rotenone intoxication. The Journal of biological chemistry 280 (51):42026-42035. doi:10.1074/jbc.M508628200
89
Purvis AC (1997) Role of the alternative oxidase in limiting superoxide production by plant mitochondria. Physiologia plantarum 100 (1):165-170. doi:10.1111/j.1399-3054.1997.tb03468.x
Purvis AC, Shewfelt RL, Gegogeine JW (1995) Superoxide production by mitochondria isolated from green bell pepper fruit. Physiologia plantarum 94 (4):743-749. doi:10.1111/j.1399-3054.1995.tb00993.x
Quinlan CL, Orr AL, Perevoshchikova IV, Treberg JR, Ackrell BA, Brand MD (2012) Mitochondrial complex II can generate reactive oxygen species at high rates in both the forward and reverse reactions. The Journal of biological chemistry 287 (32):27255-27264. doi:10.1074/jbc.M112.374629
Robinson KM, Lemire BD (1996) Covalent attachment of FAD to the yeast succinate dehydrogenase flavoprotein requires import into mitochondria, presequence removal, and folding. The Journal of biological chemistry 271 (8):4055-4060
Santos MaA, Jiménez A, Revuelta J (2000) Molecular Characterization of FMN1, the Structural Gene for the Monofunctional Flavokinase of Saccharomyces cerevisiae. J Biol Chem 275 (37):28618-28624. doi:10.1074/jbc.M004621200
Schikowsky C, Senkler J, Braun H-P (2017) SDH6 and SDH7 Contribute to Anchoring Succinate Dehydrogenase to the Inner Mitochondrial Membrane in Arabidopsis thaliana. Plant Physiology 173 (2):1094-1108. doi:10.1104/pp.16.01675
Sewelam N, Kazan K, Schenk PM (2016) Global Plant Stress Signaling: Reactive Oxygen Species at the Cross-Road. Frontiers in Plant Science 7:187. doi:10.3389/fpls.2016.00187
Shaul YD, Seger R (2007) The MEK/ERK cascade: from signaling specificity to diverse functions. Biochimica et biophysica acta 1773 (8):1213-1226. doi:10.1016/j.bbamcr.2006.10.005
Sinha AK, Jaggi M, Raghuram B, Tuteja N (2011) Mitogen-activated protein kinase signaling in plants under abiotic stress. Plant signaling & behavior 6 (2):196-203. doi:10.4161/psb.6.2.14701
Ströher E, Grassl J, Carrie C, Fenske R, Whelan J, Millar AH (2016) Glutaredoxin S15 Is Involved in Fe-S Cluster Transfer in Mitochondria Influencing Lipoic Acid-Dependent Enzymes, Plant Growth, and Arsenic Tolerance in Arabidopsis. Plant Physiology 170 (3):1284-1299. doi:10.1104/pp.15.01308
Sun F, Huo X, Zhai Y, Wang A, Xu J, Su D, Bartlam M, Rao Z (2005) Crystal structure of mitochondrial respiratory membrane protein complex II. Cell 121 (7):1043-1057. doi:10.1016/j.cell.2005.05.025
Tamaoki D, Seo S, Yamada S, Kano A, Miyamoto A, Shishido H, Miyoshi S, Taniguchi S, Akimitsu K, Gomi K (2013) Jasmonic acid and salicylic acid activate a common defense system in rice. Plant signaling & behavior 8 (6):e24260. doi:10.4161/psb.24260
Taylor NL, Tan Y-F, Jacoby RP, Millar AH (2009) Abiotic environmental stress induced changes in the Arabidopsis thaliana chloroplast, mitochondria and peroxisome proteomes. Journal of Proteomics 72 (3):367-378. doi:http://dx.doi.org/10.1016/j.jprot.2008.11.006
Van Aken O, Zhang B, Carrie C, Uggalla V, Paynter E, Giraud E, Whelan J (2009) Defining the Mitochondrial Stress Response in <em>Arabidopsis thaliana</em>. Molecular plant 2 (6):1310-1324. doi:10.1093/mp/ssp053
Van Vranken JG, Bricker DK, Dephoure N, Gygi SP, Cox JE, Thummel CS, Rutter J (2014) SDHAF4 promotes mitochondrial succinate dehydrogenase activity and prevents neurodegeneration. Cell metabolism 20 (2):241-252. doi:10.1016/j.cmet.2014.05.012
Van Vranken JG, Na U, Winge DR, Rutter J (2015) Protein-mediated assembly of succinate dehydrogenase and its cofactors. Critical Reviews in Biochemistry and Molecular Biology 50 (2):168-180. doi:10.3109/10409238.2014.990556
Xiong L, Yang Y (2003) Disease Resistance and Abiotic Stress Tolerance in Rice Are Inversely Modulated by an Abscisic Acid–Inducible Mitogen-Activated Protein Kinase. The Plant cell 15 (3):745-759. doi:10.1105/tpc.008714
Yasuda M, Ishikawa A, Jikumaru Y, Seki M, Umezawa T, Asami T, Maruyama-Nakashita A, Kudo T, Shinozaki K, Yoshida S, Nakashita H (2008) Antagonistic interaction between systemic acquired resistance and the abscisic acid-mediated abiotic stress response in Arabidopsis. The Plant cell 20 (6):1678-1692. doi:10.1105/tpc.107.054296
Yoon S, Seger R (2006) The extracellular signal-regulated kinase: multiple substrates regulate diverse cellular functions. Growth factors (Chur, Switzerland) 24 (1):21-44. doi:10.1080/02699050500284218
Yoon T, Cowan JA (2003) Iron-sulfur cluster biosynthesis. Characterization of frataxin as an iron donor for assembly of [2Fe-2S] clusters in ISU-type proteins. Journal of the American Chemical Society 125 (20):6078-6084. doi:10.1021/ja027967i
Zhang B, Van Aken O, Thatcher L, De Clercq I, Duncan O, Law SR, Murcha MW, van der Merwe M, Seifi HS, Carrie C, Cazzonelli C, Radomiljac J, Hofte M, Singh KB, Van Breusegem F, Whelan J (2014) The mitochondrial outer membrane AAA ATPase AtOM66 affects cell death and pathogen resistance in Arabidopsis thaliana. The Plant journal : for cell and molecular biology 80 (4):709-727. doi:10.1111/tpj.12665
90
Appendix
Supplemental Material
Supplemental Material for Chapter Two
Supplemental Figure 1: GSTF8:LUC induction in the presence of 1 mM SA or H2O2 Average of total fluorescence signal generated by each seedling (n= 37) per hour after treatment of 1 mM SA or H2O2. Error bars: standard error (SEM), Two-factor ANOVA for interaction (genotypes x treatment), p< 0.0001 for
SA treatment, p= 0.2 for H2O2 treatment.
Supplemental Figure 2: Inhibition of competitive inhibitor malonate in the presence of 5 mM succinate. SDH inhibition was measured using malonate concentrations from 0 to 1 mM in the presence of 5 mM succinate. (A) SDH activity measured with different concentrations of malonate. (B) Calculated IC50 of malonate (Brooks Kinetic Software). Standard error (SEM) of 3 biological differences; post-hoc Tukey test comparing differences amongst genotype and treatment (A), p≤ 0.05; Single-factor ANOVA comparing IC50 between genotypes (B), p≤ 0.07; different letters indicate significant differences
91
Supplemental Fig 3: Significant differences in SQR activity and oxygen consumption between genotypes and SA treatment. (A) SQR activity measured at UQ binding site (Q1 (80 µM) +DCPIP) in the presence of SA in the three genotypes. As a negative control, activity was measured in the absence of Q1 in WT mitochondria (yellow). (B) Succinate dependent oxygen consumption was measured using a Clark type oxygen electrode in the presence of 5 mM succinate and SA concentrations ranging from 0.01 to 1 mM. Standard error (SEM); Fisher Least Significant Difference (LSD) test was used to determine differences (different letters indicate significant differences), p≤ 0.05
Supplemental Figure 4: Complex III activity in the presence of SA Complex III activity in isolated mitochondria was measured spectrophotometrically at 550 nm in the presence of the substrates cytochrome c and ubiquinol-10. SA concentrations ranging from 0.01 to 1 mM were added. Standard error (SEM) of 4 biological replicates.
92
Supplemental Figure 5: TTFA (A) and carboxin (B) increase SQR activity at low concentrations. SQR (succinate:quinone reductase) activity was measured in µmol DCPIP/ min/ mg Mit. in the presence of 5 mM succinate and a range of SA concentrations. 80 µM of Coenzyme Q1 was used together with DCPIP. As a negative control activity was measured in the absence of Q1 in WT mitochondria (yellow). Standard error (SEM) of 4 biological replicates; student’s t-test comparing activity within genotype, different letters indicate significant differences, p≤ 0.05.
Supplemental Figure 6. Complex I and alternative NADH dehydrogenase dependent ROS and oxygen uptake measurements in the presence of SA (A) Oxygen consumption was measured using a Clark type oxygen electrode in the presence of 1 mM NADH (left) and 10 mM malate/ glutamate (right). SA concentrations ranging from 0.01 to 1 mM were added to the assay. (B) mtH2O2 production was measured using DCFDA with an excitation/ emission wavelength of 490/ 520 nm. 1 mM NADH (left) or 10 mM malate/ glutamate (right) together with 0.5 mM ATP/ ADP and 0.03 mM SA were added to freshly isolated mitochondria immediately before the measurement. Fluorescence intensity was measured over 10 min and the rate of fluorescence/ min was calculated. Standard error (SEM) of 4 biological replicates.
93
Supplemental Figure 7: Measured background signals for mitochondrial H2O2 production in the absence of substrates and effectors. The average of mitochondrial H2O2 production (n=8) was measured in the absence of any substrates in freshly isolated mitochondria (A, the 3 boxed set of histograms). These measurements were considered as background signals and were subtracted from the samples including the substrate (succinate, non-boxed set of histograms in A). The result of this subtraction is presented in (B). Background signal was subtracted from the fluorescence signal measured in the presence of the substrate succinate. DCFDA was used as the fluorescence dye for measurements.
Supplemental Figure 8: Comparison of structures for TTFA, Carboxin, SA and ubiquinone-1. The ‘SMILE’ sequence of TTFA, SA, carboxin and UQ-1 were used to create chemical structures in Molview (molview.org). Atoms are coloured as shown in the legend
94
Supplemental Table 1 : p-values of statistical comparisons between genotypes and treatment (Fisher Least Significant Difference (LSD) test) P-values of individual experiments are listed separately. The interaction between genotypes and treatment (SA) is given in column 2 of each dataset as: 1st genotype_SA concentration_2nd genotype_SA concentration. Significant p- values are highlighted.
interaction_GT_SA p-value
experiment (Figure) interaction_GT_SA
p-value experiment (Figure) interaction_GT_SA
p-value
sdhaf2_0 - sdhaf2_0.01 0.002 low_SA_resp (Fig. 5C) sdhaf2_0 - sdhaf2_0.01 0.715
high_SA_resp (Fig. 5D)
sdhaf2_0 - sdhaf2_0.05 0.908
sdhaf2_0 - sdhaf2_0.02 0.000 low_SA_resp (Fig. 5C) sdhaf2_0 - sdhaf2_0.02 0.602
high_SA_resp (Fig. 5D) sdhaf2_0 - sdhaf2_0.1 0.513
sdhaf2_0 - sdhaf2_0.04 0.000 low_SA_resp (Fig. 5C) sdhaf2_0 - sdhaf2_0.03 0.514
high_SA_resp (Fig. 5D) sdhaf2_0 - sdhaf2_0.2 0.352
sdhaf2_0 - sdhaf2_0.05 0.000 low_SA_resp (Fig. 5C) sdhaf2_0 - dsr1_0 0.217
high_SA_resp (Fig. 5D) sdhaf2_0 - sdhaf2_0.3 0.080
sdhaf2_0 - dsr1_0 0.334 low_SA_resp (Fig. 5C) sdhaf2_0 - dsr1_0.01 0.640
high_SA_resp (Fig. 5D) sdhaf2_0 - sdhaf2_0.5 0.020
sdhaf2_0 - dsr1_0.01 0.368 low_SA_resp (Fig. 5C) sdhaf2_0 - dsr1_0.02 0.294
high_SA_resp (Fig. 5D) sdhaf2_0 - sdhaf2_1 0.003
sdhaf2_0 - dsr1_0.02 0.193 low_SA_resp (Fig. 5C) sdhaf2_0 - dsr1_0.03 0.378
high_SA_resp (Fig. 5D) sdhaf2_0 - dsr1_0 0.078
sdhaf2_0 - dsr1_0.04 0.181 low_SA_resp (Fig. 5C) sdhaf2_0 - WT_0 0.090
high_SA_resp (Fig. 5D) sdhaf2_0 - dsr1_0.05 0.032
sdhaf2_0 - dsr1_0.05 0.194 low_SA_resp (Fig. 5C) sdhaf2_0 - WT_0.01 0.030
high_SA_resp (Fig. 5D) sdhaf2_0 - dsr1_0.1 0.008
sdhaf2_0 - no_Q1_0 0.001 low_SA_resp (Fig. 5C) sdhaf2_0 - WT_0.02 0.114
high_SA_resp (Fig. 5D) sdhaf2_0 - dsr1_0.2 0.005
sdhaf2_0 - no_Q1_0.01 0.001 low_SA_resp (Fig. 5C) sdhaf2_0 - WT_0.03 0.184
high_SA_resp (Fig. 5D) sdhaf2_0 - dsr1_0.3 0.002
sdhaf2_0 - no_Q1_0.02 0.001 low_SA_resp (Fig. 5C)
sdhaf2_0.01 - sdhaf2_0.02 0.889
high_SA_resp (Fig. 5D) sdhaf2_0 - dsr1_0.5 0.001
sdhaf2_0 - no_Q1_0.04 0.000 low_SA_resp (Fig. 5C)
sdhaf2_0.01 - sdhaf2_0.03 0.798
high_SA_resp (Fig. 5D) sdhaf2_0 - dsr1_1 0.000
sdhaf2_0 - no_Q1_0.05 0.033 low_SA_resp (Fig. 5C) sdhaf2_0.01 - dsr1_0 0.488
high_SA_resp (Fig. 5D) sdhaf2_0 - WT_0 0.016
sdhaf2_0 - WT_0 0.033 low_SA_resp (Fig. 5C)
sdhaf2_0.01 - dsr1_0.01 0.928
high_SA_resp (Fig. 5D) sdhaf2_0 - WT_0.05 0.235
sdhaf2_0 - WT_0.01 0.000 low_SA_resp (Fig. 5C)
sdhaf2_0.01 - dsr1_0.02 0.542
high_SA_resp (Fig. 5D) sdhaf2_0 - WT_0.1 0.561
sdhaf2_0 - WT_0.02 0.000 low_SA_resp (Fig. 5C)
sdhaf2_0.01 - dsr1_0.03 0.646
high_SA_resp (Fig. 5D) sdhaf2_0 - WT_0.2 0.940
sdhaf2_0 - WT_0.04 0.000 low_SA_resp (Fig. 5C) sdhaf2_0.01 - WT_0 0.072
high_SA_resp (Fig. 5D) sdhaf2_0 - WT_0.3 0.703
sdhaf2_0 - WT_0.05 0.000 low_SA_resp (Fig. 5C) sdhaf2_0.01 - WT_0.01 0.026
high_SA_resp (Fig. 5D) sdhaf2_0 - WT_0.5 0.341
sdhaf2_0.01 - sdhaf2_0.02 0.295
low_SA_resp (Fig. 5C) sdhaf2_0.01 - WT_0.02 0.086
high_SA_resp (Fig. 5D) sdhaf2_0 - WT_1 0.036
sdhaf2_0.01 - sdhaf2_0.04 0.308
low_SA_resp (Fig. 5C) sdhaf2_0.01 - WT_0.03 0.135
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - sdhaf2_0.1 0.516
sdhaf2_0.01 - sdhaf2_0.05 0.567
low_SA_resp (Fig. 5C)
sdhaf2_0.02 - sdhaf2_0.03 0.907
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - sdhaf2_0.2 0.376
sdhaf2_0.01 - dsr1_0 0.000 low_SA_resp (Fig. 5C) sdhaf2_0.02 - dsr1_0 0.591
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - sdhaf2_0.3 0.114
sdhaf2_0.01 - dsr1_0.01 0.039
low_SA_resp (Fig. 5C)
sdhaf2_0.02 - dsr1_0.01 0.961
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - sdhaf2_0.5 0.038
sdhaf2_0.01 - dsr1_0.02 0.096
low_SA_resp (Fig. 5C)
sdhaf2_0.02 - dsr1_0.02 0.637
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - sdhaf2_1 0.008
sdhaf2_0.01 - dsr1_0.04 0.103
low_SA_resp (Fig. 5C)
sdhaf2_0.02 - dsr1_0.03 0.748
high_SA_resp (Fig. 5D) sdhaf2_0.05 - dsr1_0 0.138
sdhaf2_0.01 - dsr1_0.05 0.137
low_SA_resp (Fig. 5C) sdhaf2_0.02 - WT_0 0.051
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - dsr1_0.05 0.055
sdhaf2_0.01 - no_Q1_0 0.000 low_SA_resp (Fig. 5C) sdhaf2_0.02 - WT_0.01 0.018
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - dsr1_0.1 0.018
sdhaf2_0.01 - no_Q1_0.01 0.000
low_SA_resp (Fig. 5C) sdhaf2_0.02 - WT_0.02 0.064
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - dsr1_0.2 0.013
sdhaf2_0.01 - no_Q1_0.02 0.000
low_SA_resp (Fig. 5C) sdhaf2_0.02 - WT_0.03 0.103
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - dsr1_0.3 0.006
sdhaf2_0.01 - no_Q1_0.04 0.000
low_SA_resp (Fig. 5C) sdhaf2_0.03 - dsr1_0 0.684
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - dsr1_0.5 0.005
sdhaf2_0.01 - no_Q1_0.05 0.000
low_SA_resp (Fig. 5C)
sdhaf2_0.03 - dsr1_0.01 0.869
high_SA_resp (Fig. 5D) sdhaf2_0.05 - dsr1_1 0.002
sdhaf2_0.01 - WT_0 0.278 low_SA_resp (Fig. 5C)
sdhaf2_0.03 - dsr1_0.02 0.722
high_SA_resp (Fig. 5D) sdhaf2_0.05 - WT_0 0.077
sdhaf2_0.01 - WT_0.01 0.000 low_SA_resp (Fig. 5C)
sdhaf2_0.03 - dsr1_0.03 0.838
high_SA_resp (Fig. 5D)
sdhaf2_0.05 - WT_0.05 0.364
95
sdhaf2_0.01 - WT_0.02 0.000 low_SA_resp (Fig. 5C) sdhaf2_0.03 - WT_0 0.038
high_SA_resp (Fig. 5D) sdhaf2_0.05 - WT_0.1 0.693
sdhaf2_0.01 - WT_0.04 0.000 low_SA_resp (Fig. 5C) sdhaf2_0.03 - WT_0.01 0.014
high_SA_resp (Fig. 5D) sdhaf2_0.05 - WT_0.2 0.972
sdhaf2_0.01 - WT_0.05 0.000 low_SA_resp (Fig. 5C) sdhaf2_0.03 - WT_0.02 0.050
high_SA_resp (Fig. 5D) sdhaf2_0.05 - WT_0.3 0.674
sdhaf2_0.02 - sdhaf2_0.04 0.983
low_SA_resp (Fig. 5C) sdhaf2_0.03 - WT_0.03 0.082
high_SA_resp (Fig. 5D) sdhaf2_0.05 - WT_0.5 0.367
sdhaf2_0.02 - sdhaf2_0.05 0.634
low_SA_resp (Fig. 5C) dsr1_0 - dsr1_0.01 0.554
high_SA_resp (Fig. 5D) sdhaf2_0.05 - WT_1 0.060
sdhaf2_0.02 - dsr1_0 0.000 low_SA_resp (Fig. 5C) dsr1_0 - dsr1_0.02 0.996
high_SA_resp (Fig. 5D)
sdhaf2_0.1 - sdhaf2_0.2 0.813
sdhaf2_0.02 - dsr1_0.01 0.003
low_SA_resp (Fig. 5C) dsr1_0 - dsr1_0.03 0.860
high_SA_resp (Fig. 5D)
sdhaf2_0.1 - sdhaf2_0.3 0.346
sdhaf2_0.02 - dsr1_0.02 0.008
low_SA_resp (Fig. 5C) dsr1_0 - WT_0 0.005
high_SA_resp (Fig. 5D)
sdhaf2_0.1 - sdhaf2_0.5 0.148
sdhaf2_0.02 - dsr1_0.04 0.009
low_SA_resp (Fig. 5C) dsr1_0 - WT_0.01 0.002
high_SA_resp (Fig. 5D) sdhaf2_0.1 - sdhaf2_1 0.040
sdhaf2_0.02 - dsr1_0.05 0.016
low_SA_resp (Fig. 5C) dsr1_0 - WT_0.02 0.010
high_SA_resp (Fig. 5D) sdhaf2_0.1 - dsr1_0 0.467
sdhaf2_0.02 - no_Q1_0 0.000 low_SA_resp (Fig. 5C) dsr1_0 - WT_0.03 0.020
high_SA_resp (Fig. 5D)
sdhaf2_0.1 - dsr1_0.05 0.196
sdhaf2_0.02 - no_Q1_0.01 0.000
low_SA_resp (Fig. 5C) dsr1_0.01 - dsr1_0.02 0.603
high_SA_resp (Fig. 5D) sdhaf2_0.1 - dsr1_0.1 0.078
sdhaf2_0.02 - no_Q1_0.02 0.000
low_SA_resp (Fig. 5C) dsr1_0.01 - dsr1_0.03 0.712
high_SA_resp (Fig. 5D) sdhaf2_0.1 - dsr1_0.2 0.060
sdhaf2_0.02 - no_Q1_0.04 0.000
low_SA_resp (Fig. 5C) dsr1_0.01 - WT_0 0.058
high_SA_resp (Fig. 5D) sdhaf2_0.1 - dsr1_0.3 0.030
sdhaf2_0.02 - no_Q1_0.05 0.000
low_SA_resp (Fig. 5C) dsr1_0.01 - WT_0.01 0.021
high_SA_resp (Fig. 5D) sdhaf2_0.1 - dsr1_0.5 0.026
sdhaf2_0.02 - WT_0 0.031 low_SA_resp (Fig. 5C) dsr1_0.01 - WT_0.02 0.072
high_SA_resp (Fig. 5D) sdhaf2_0.1 - dsr1_1 0.011
sdhaf2_0.02 - WT_0.01 0.014 low_SA_resp (Fig. 5C) dsr1_0.01 - WT_0.03 0.114
high_SA_resp (Fig. 5D) sdhaf2_0.1 - WT_0 0.013
sdhaf2_0.02 - WT_0.02 0.001 low_SA_resp (Fig. 5C) dsr1_0.02 - dsr1_0.03 0.880
high_SA_resp (Fig. 5D) sdhaf2_0.1 - WT_0.05 0.122
sdhaf2_0.02 - WT_0.04 0.000 low_SA_resp (Fig. 5C) dsr1_0.02 - WT_0 0.015
high_SA_resp (Fig. 5D) sdhaf2_0.1 - WT_0.1 0.298
sdhaf2_0.02 - WT_0.05 0.001 low_SA_resp (Fig. 5C) dsr1_0.02 - WT_0.01 0.005
high_SA_resp (Fig. 5D) sdhaf2_0.1 - WT_0.2 0.538
sdhaf2_0.04 - sdhaf2_0.05 0.634
low_SA_resp (Fig. 5C) dsr1_0.02 - WT_0.02 0.022
high_SA_resp (Fig. 5D) sdhaf2_0.1 - WT_0.3 0.817
sdhaf2_0.04 - dsr1_0 0.000 low_SA_resp (Fig. 5C) dsr1_0.02 - WT_0.03 0.038
high_SA_resp (Fig. 5D) sdhaf2_0.1 - WT_0.5 0.799
sdhaf2_0.04 - dsr1_0.01 0.004
low_SA_resp (Fig. 5C) dsr1_0.03 - WT_0 0.022
high_SA_resp (Fig. 5D) sdhaf2_0.1 - WT_1 0.212
sdhaf2_0.04 - dsr1_0.02 0.011
low_SA_resp (Fig. 5C) dsr1_0.03 - WT_0.01 0.008
high_SA_resp (Fig. 5D)
sdhaf2_0.2 - sdhaf2_0.3 0.478
sdhaf2_0.04 - dsr1_0.04 0.012
low_SA_resp (Fig. 5C) dsr1_0.03 - WT_0.02 0.032
high_SA_resp (Fig. 5D)
sdhaf2_0.2 - sdhaf2_0.5 0.224
sdhaf2_0.04 - dsr1_0.05 0.020
low_SA_resp (Fig. 5C) dsr1_0.03 - WT_0.03 0.053
high_SA_resp (Fig. 5D) sdhaf2_0.2 - sdhaf2_1 0.068
sdhaf2_0.04 - no_Q1_0 0.000 low_SA_resp (Fig. 5C) WT_0 - WT_0.01 0.451
high_SA_resp (Fig. 5D) sdhaf2_0.2 - dsr1_0 0.654
sdhaf2_0.04 - no_Q1_0.01 0.000
low_SA_resp (Fig. 5C) WT_0 - WT_0.02 0.892
high_SA_resp (Fig. 5D)
sdhaf2_0.2 - dsr1_0.05 0.289
sdhaf2_0.04 - no_Q1_0.02 0.000
low_SA_resp (Fig. 5C) WT_0 - WT_0.03 0.901
high_SA_resp (Fig. 5D) sdhaf2_0.2 - dsr1_0.1 0.126
sdhaf2_0.04 - no_Q1_0.04 0.000
low_SA_resp (Fig. 5C) WT_0.01 - WT_0.02 0.583
high_SA_resp (Fig. 5D) sdhaf2_0.2 - dsr1_0.2 0.098
sdhaf2_0.04 - no_Q1_0.05 0.000
low_SA_resp (Fig. 5C) WT_0.01 - WT_0.03 0.436
high_SA_resp (Fig. 5D) sdhaf2_0.2 - dsr1_0.3 0.052
sdhaf2_0.04 - WT_0 0.039 low_SA_resp (Fig. 5C) WT_0.02 - WT_0.03 0.818
high_SA_resp (Fig. 5D) sdhaf2_0.2 - dsr1_0.5 0.045
sdhaf2_0.04 - WT_0.01 0.021
high_SA_resp (Fig. 5D) sdhaf2_0.2 - dsr1_1 0.021
sdhaf2_0.04 - WT_0.02 0.002
high_SA_resp (Fig. 5D) sdhaf2_0.2 - WT_0 0.006
sdhaf2_0.04 - WT_0.04 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.2 - WT_0.05 0.076
sdhaf2_0.04 - WT_0.05 0.001
high_SA_resp (Fig. 5D) sdhaf2_0.2 - WT_0.1 0.203
sdhaf2_0.05 - dsr1_0 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.2 - WT_0.2 0.395
sdhaf2_0.05 - dsr1_0.01 0.010
high_SA_resp (Fig. 5D) sdhaf2_0.2 - WT_0.3 0.640
sdhaf2_0.05 - dsr1_0.02 0.028
high_SA_resp (Fig. 5D) sdhaf2_0.2 - WT_0.5 0.986
sdhaf2_0.05 - dsr1_0.04 0.031
high_SA_resp (Fig. 5D) sdhaf2_0.2 - WT_1 0.310
sdhaf2_0.05 - dsr1_0.05 0.047
high_SA_resp (Fig. 5D)
sdhaf2_0.3 - sdhaf2_0.5 0.608
96
sdhaf2_0.05 - no_Q1_0 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.3 - sdhaf2_1 0.255
sdhaf2_0.05 - no_Q1_0.01 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.3 - dsr1_0 0.695
sdhaf2_0.05 - no_Q1_0.02 0.000
high_SA_resp (Fig. 5D)
sdhaf2_0.3 - dsr1_0.05 0.723
sdhaf2_0.05 - no_Q1_0.04 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.3 - dsr1_0.1 0.403
sdhaf2_0.05 - no_Q1_0.05 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.3 - dsr1_0.2 0.338
sdhaf2_0.05 - WT_0 0.095
high_SA_resp (Fig. 5D) sdhaf2_0.3 - dsr1_0.3 0.208
sdhaf2_0.05 - WT_0.01 0.004
high_SA_resp (Fig. 5D) sdhaf2_0.3 - dsr1_0.5 0.187
sdhaf2_0.05 - WT_0.02 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.3 - dsr1_1 0.100
sdhaf2_0.05 - WT_0.04 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.3 - WT_0 0.000
sdhaf2_0.05 - WT_0.05 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.3 - WT_0.05 0.015
dsr1_0 - dsr1_0.01 0.076
high_SA_resp (Fig. 5D) sdhaf2_0.3 - WT_0.1 0.050
dsr1_0 - dsr1_0.02 0.031
high_SA_resp (Fig. 5D) sdhaf2_0.3 - WT_0.2 0.122
dsr1_0 - dsr1_0.04 0.029
high_SA_resp (Fig. 5D) sdhaf2_0.3 - WT_0.3 0.242
dsr1_0 - dsr1_0.05 0.035
high_SA_resp (Fig. 5D) sdhaf2_0.3 - WT_0.5 0.490
dsr1_0 - no_Q1_0 0.029
high_SA_resp (Fig. 5D) sdhaf2_0.3 - WT_1 0.757
dsr1_0 - no_Q1_0.01 0.028
high_SA_resp (Fig. 5D) sdhaf2_0.5 - sdhaf2_1 0.528
dsr1_0 - no_Q1_0.02 0.036
high_SA_resp (Fig. 5D) sdhaf2_0.5 - dsr1_0 0.320
dsr1_0 - no_Q1_0.04 0.018
high_SA_resp (Fig. 5D)
sdhaf2_0.5 - dsr1_0.05 0.875
dsr1_0 - no_Q1_0.05 0.295
high_SA_resp (Fig. 5D) sdhaf2_0.5 - dsr1_0.1 0.745
dsr1_0 - WT_0 0.003
high_SA_resp (Fig. 5D) sdhaf2_0.5 - dsr1_0.2 0.653
dsr1_0 - WT_0.01 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.5 - dsr1_0.3 0.452
dsr1_0 - WT_0.02 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.5 - dsr1_0.5 0.415
dsr1_0 - WT_0.04 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.5 - dsr1_1 0.253
dsr1_0 - WT_0.05 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.5 - WT_0 0.000
dsr1_0.01 - dsr1_0.02 0.699
high_SA_resp (Fig. 5D) sdhaf2_0.5 - WT_0.05 0.004
dsr1_0.01 - dsr1_0.04 0.674
high_SA_resp (Fig. 5D) sdhaf2_0.5 - WT_0.1 0.015
dsr1_0.01 - dsr1_0.05 0.660
high_SA_resp (Fig. 5D) sdhaf2_0.5 - WT_0.2 0.042
dsr1_0.01 - no_Q1_0 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.5 - WT_0.3 0.095
dsr1_0.01 - no_Q1_0.01 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.5 - WT_0.5 0.231
dsr1_0.01 - no_Q1_0.02 0.000
high_SA_resp (Fig. 5D) sdhaf2_0.5 - WT_1 0.839
dsr1_0.01 - no_Q1_0.04 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - dsr1_0 0.085
dsr1_0.01 - no_Q1_0.05 0.004
high_SA_resp (Fig. 5D) sdhaf2_1 - dsr1_0.05 0.431
dsr1_0.01 - WT_0 0.265
high_SA_resp (Fig. 5D) sdhaf2_1 - dsr1_0.1 0.760
dsr1_0.01 - WT_0.01 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - dsr1_0.2 0.856
dsr1_0.01 - WT_0.02 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - dsr1_0.3 0.903
dsr1_0.01 - WT_0.04 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - dsr1_0.5 0.853
dsr1_0.01 - WT_0.05 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - dsr1_1 0.604
dsr1_0.02 - dsr1_0.04 0.972
high_SA_resp (Fig. 5D) sdhaf2_1 - WT_0 0.000
dsr1_0.02 - dsr1_0.05 0.940
high_SA_resp (Fig. 5D) sdhaf2_1 - WT_0.05 0.001
dsr1_0.02 - no_Q1_0 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - WT_0.1 0.003
dsr1_0.02 - no_Q1_0.01 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - WT_0.2 0.009
97
dsr1_0.02 - no_Q1_0.02 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - WT_0.3 0.023
dsr1_0.02 - no_Q1_0.04 0.000
high_SA_resp (Fig. 5D) sdhaf2_1 - WT_0.5 0.070
dsr1_0.02 - no_Q1_0.05 0.001
high_SA_resp (Fig. 5D) sdhaf2_1 - WT_1 0.405
dsr1_0.02 - WT_0 0.484
high_SA_resp (Fig. 5D) dsr1_0 - dsr1_0.05 0.418
dsr1_0.02 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0 - dsr1_0.1 0.170
dsr1_0.02 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0 - dsr1_0.2 0.130
dsr1_0.02 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0 - dsr1_0.3 0.063
dsr1_0.02 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0 - dsr1_0.5 0.053
dsr1_0.04 - dsr1_0.05 0.966
high_SA_resp (Fig. 5D) dsr1_0 - dsr1_1 0.021
dsr1_0.04 - no_Q1_0 0.000
high_SA_resp (Fig. 5D) dsr1_0 - WT_0 0.000
dsr1_0.04 - no_Q1_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0 - WT_0.05 0.012
dsr1_0.04 - no_Q1_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0 - WT_0.1 0.053
dsr1_0.04 - no_Q1_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0 - WT_0.2 0.149
dsr1_0.04 - no_Q1_0.05 0.001
high_SA_resp (Fig. 5D) dsr1_0 - WT_0.3 0.319
dsr1_0.04 - WT_0 0.507
high_SA_resp (Fig. 5D) dsr1_0 - WT_0.5 0.669
dsr1_0.04 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0 - WT_1 0.449
dsr1_0.04 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - dsr1_0.1 0.629
dsr1_0.04 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - dsr1_0.2 0.544
dsr1_0.04 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - dsr1_0.3 0.364
dsr1_0.05 - no_Q1_0 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - dsr1_0.5 0.332
dsr1_0.05 - no_Q1_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - dsr1_1 0.194
dsr1_0.05 - no_Q1_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - WT_0 0.000
dsr1_0.05 - no_Q1_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - WT_0.05 0.006
dsr1_0.05 - no_Q1_0.05 0.002
high_SA_resp (Fig. 5D) dsr1_0.05 - WT_0.1 0.022
dsr1_0.05 - WT_0 0.566
high_SA_resp (Fig. 5D) dsr1_0.05 - WT_0.2 0.059
dsr1_0.05 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - WT_0.3 0.129
dsr1_0.05 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - WT_0.5 0.297
dsr1_0.05 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.05 - WT_1 0.964
dsr1_0.05 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0.1 - dsr1_0.2 0.901
no_Q1_0 - no_Q1_0.01 0.984
high_SA_resp (Fig. 5D) dsr1_0.1 - dsr1_0.3 0.669
no_Q1_0 - no_Q1_0.02 0.925
high_SA_resp (Fig. 5D) dsr1_0.1 - dsr1_0.5 0.624
no_Q1_0 - no_Q1_0.04 0.828
high_SA_resp (Fig. 5D) dsr1_0.1 - dsr1_1 0.411
no_Q1_0 - no_Q1_0.05 0.206
high_SA_resp (Fig. 5D) dsr1_0.1 - WT_0 0.000
no_Q1_0 - WT_0 0.000
high_SA_resp (Fig. 5D) dsr1_0.1 - WT_0.05 0.001
no_Q1_0 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.1 - WT_0.1 0.006
no_Q1_0 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.1 - WT_0.2 0.019
no_Q1_0 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.1 - WT_0.3 0.048
no_Q1_0 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0.1 - WT_0.5 0.130
no_Q1_0.01 - no_Q1_0.02 0.909
high_SA_resp (Fig. 5D) dsr1_0.1 - WT_1 0.597
no_Q1_0.01 - no_Q1_0.04 0.844
high_SA_resp (Fig. 5D) dsr1_0.2 - dsr1_0.3 0.761
no_Q1_0.01 - no_Q1_0.05 0.200
high_SA_resp (Fig. 5D) dsr1_0.2 - dsr1_0.5 0.714
98
no_Q1_0.01 - WT_0 0.000
high_SA_resp (Fig. 5D) dsr1_0.2 - dsr1_1 0.485
no_Q1_0.01 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.2 - WT_0 0.000
no_Q1_0.01 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.2 - WT_0.05 0.001
no_Q1_0.01 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.2 - WT_0.1 0.004
no_Q1_0.01 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0.2 - WT_0.2 0.014
no_Q1_0.02 - no_Q1_0.04 0.756
high_SA_resp (Fig. 5D) dsr1_0.2 - WT_0.3 0.036
no_Q1_0.02 - no_Q1_0.05 0.242
high_SA_resp (Fig. 5D) dsr1_0.2 - WT_0.5 0.102
no_Q1_0.02 - WT_0 0.000
high_SA_resp (Fig. 5D) dsr1_0.2 - WT_1 0.514
no_Q1_0.02 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - dsr1_0.5 0.950
no_Q1_0.02 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - dsr1_1 0.692
no_Q1_0.02 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - WT_0 0.000
no_Q1_0.02 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - WT_0.05 0.000
no_Q1_0.04 - no_Q1_0.05 0.140
high_SA_resp (Fig. 5D) dsr1_0.3 - WT_0.1 0.002
no_Q1_0.04 - WT_0 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - WT_0.2 0.006
no_Q1_0.04 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - WT_0.3 0.017
no_Q1_0.04 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - WT_0.5 0.054
no_Q1_0.04 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.3 - WT_1 0.341
no_Q1_0.04 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - dsr1_1 0.739
no_Q1_0.05 - WT_0 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - WT_0 0.000
no_Q1_0.05 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - WT_0.05 0.000
no_Q1_0.05 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - WT_0.1 0.002
no_Q1_0.05 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - WT_0.2 0.005
no_Q1_0.05 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - WT_0.3 0.015
WT_0 - WT_0.01 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - WT_0.5 0.047
WT_0 - WT_0.02 0.000
high_SA_resp (Fig. 5D) dsr1_0.5 - WT_1 0.310
WT_0 - WT_0.04 0.000
high_SA_resp (Fig. 5D) dsr1_1 - WT_0 0.000
WT_0 - WT_0.05 0.000
high_SA_resp (Fig. 5D) dsr1_1 - WT_0.05 0.000
WT_0.01 - WT_0.02 0.328
high_SA_resp (Fig. 5D) dsr1_1 - WT_0.1 0.001
WT_0.01 - WT_0.04 0.044
high_SA_resp (Fig. 5D) dsr1_1 - WT_0.2 0.002
WT_0.01 - WT_0.05 0.309
high_SA_resp (Fig. 5D) dsr1_1 - WT_0.3 0.006
WT_0.02 - WT_0.04 0.292
high_SA_resp (Fig. 5D) dsr1_1 - WT_0.5 0.022
WT_0.02 - WT_0.05 0.970
high_SA_resp (Fig. 5D) dsr1_1 - WT_1 0.180
WT_0.04 - WT_0.05 0.309
high_SA_resp (Fig. 5D) WT_0 - WT_0.05 0.474
high_SA_resp (Fig. 5D) WT_0 - WT_0.1 0.187
high_SA_resp (Fig. 5D) WT_0 - WT_0.2 0.070
high_SA_resp (Fig. 5D) WT_0 - WT_0.3 0.025
high_SA_resp (Fig. 5D) WT_0 - WT_0.5 0.006
high_SA_resp (Fig. 5D) WT_0 - WT_1 0.000
high_SA_resp (Fig. 5D) WT_0.05 - WT_0.1 0.606
high_SA_resp (Fig. 5D) WT_0.05 - WT_0.2 0.346
high_SA_resp (Fig. 5D) WT_0.05 - WT_0.3 0.186
99
high_SA_resp (Fig. 5D) WT_0.05 - WT_0.5 0.073
high_SA_resp (Fig. 5D) WT_0.05 - WT_1 0.006
high_SA_resp (Fig. 5D) WT_0.1 - WT_0.2 0.668
high_SA_resp (Fig. 5D) WT_0.1 - WT_0.3 0.416
high_SA_resp (Fig. 5D) WT_0.1 - WT_0.5 0.197
high_SA_resp (Fig. 5D) WT_0.1 - WT_1 0.024
high_SA_resp (Fig. 5D) WT_0.2 - WT_0.3 0.700
high_SA_resp (Fig. 5D) WT_0.2 - WT_0.5 0.385
high_SA_resp (Fig. 5D) WT_0.2 - WT_1 0.065
high_SA_resp (Fig. 5D) WT_0.3 - WT_0.5 0.628
high_SA_resp (Fig. 5D) WT_0.3 - WT_1 0.141
high_SA_resp (Fig. 5D) WT_0.5 - WT_1 0.318
100
Supplemental Material for Chapter Three
Supplemental Figure 1: Genotyping of T-DNA insertion line of At5g67490 Homozygous T-DNA insertion lines from 2 week old GT_5_75821 plants were determined by PCR using the following primer sequences: Forward primer (RP) 5’ to 3’ (AAATGCATGATGATGCCAATC) reverse primer (LP) 3’ to 5’ (TGGGCCTAGATACTACTGGGC) and left border primer of T-DNA insertion (LBP) (ATTTTGCCGATTTCGGAAC) RP + LP has an expected product of about 1000 kDa. RP + LPB has an expected result of 500 to 800 kDa. Plant lines 3-2, 3-3, 6-3, 6-4 and 6-5 showed bands of the expected size for T-DNA (left) and did not show WT amplification (right). These lines were considered homozygous for the T-DNA insertion and were used in all following experiments.
101
Supplemental Figure 2: plant growth and development not altered in sdhaf4 A) sdhaf4 and Ler plants were grown on soil under long day conditions and plant growth and development was observed and compared in 4 week old plants (left) and fully grown 10 week old plants (right). B) Analysis of root growth of sdhaf4 and sdhaf2 after 9, 12 and 15 days after germination at a pH of 5.8. Plants were grown on half strength MS media under long day conditions. Shown is the average root length (n=12) of Arabidopsis seedlings at different time points. t-test was performed to determine significant differences between genotypes. *p≤ 0.05; ***p≤ 0.001
102
Supplemental Figure 3: Michaelis- Menten curve shows no difference for Km in sdhaf4 and Ler Plot shows SDH velocity (µmol DCPIP/min/mg Mit.) against succinate concentration of 4 biological replicates. Km value of succinate can be measured at half maximum velocity (1/2 Vmax). SE, standard error
103
Supplemental Figure 4: R script that was used to determine Km and Vmax of Ler and sdhaf4 replicates R version 3.3.1 was used for calculation of Km and Vmax. 4 replicates of velocity of Ler and sdhaf4 were used.
104
Supplemental Figure 5: FAD bound protein is not altered in sdhaf4 FAD binding assay was performed on SDS PAGE of whole mitochondria samples. Image J was used to calculate band area for Ler and sdhaf4 (N=3). SE, standard error
Supplemental Figure 6: SDS PAGE of FAD bound protein for soluble and mitochondria protein fraction SDS PAGE of mitochondrial protein separated in soluble and membrane fraction showing FAD bound protein before and after 10% acetic acid treatment (FAD band indicated with black arrow). Coomassie stained SDS PAGE shows separation of mitochondrial protein and FAD band at about 66kDa.
Supplemental Figure 7: SDH activity and ROS production are not increased in soluble mitochondria fraction in sdhaf4 A, SDH activity was measured spectrophotometrically as DCPIP reduction at 600 nm in soluble and membrane mitochondrial protein fractions (N=4). SDH activity was calculated as µmol DCPIP/ min/ mg Mit. based on total protein amount. B, ROS production was measured using DCFDA and isolated mitochondria (15 µg) of soluble and membrane fraction. ROS was measured over 10 min and the slope was calculated as Fluorescence/ min based on total protein amount.
105
Supplemental Table 1: Metabolomic data analyses from sdhaf4 and Ler whole plant tissue calculated in metabolome express (www.metabolome-express.org) 31 known classified metabolites were identified. Given is the ratio of sdhaf4 to Ler regarding amounts of chemical metabolites in whole plant tissue (N=4) and the corresponding p-value. Significant differences are highlighted in the table.
Chemical Class Metabolite Name sdhaf4/Ler p-value
Amino Acids
L-Serine 0.86 0.70
L-Threonine 0.84 0.63
Glycine 2.39 0.07
L-Aspartic acid 0.64 0.39
Pyroglutamic acid 1.16 0.71
L-Proline 0.49 0.30
Gamma-Aminobutyric acid
0.98 0.96
L-Glutamic acid 0.52 0.38
L-Alanine 0.71 0.54
L-Asparagine 0.26 0.20
Dicarboxylic Acids
Succinic acid 5.01 0.02
Fumaric acid 1.11 0.76
L-Malic acid 0.62 0.29
Hydroxy Acids Threonic acid 0.91 0.79
Alcohols and Polyols
Ribitol 1.24 0.28
Sorbitol 1.82 0.45
Tricarboxylic Acids
Citric acid 0.86 0.72
Carbohydrates
D-Fructose 1.95 0.28
D-Glucose 2 0.28
D-Mannose 1.91 0.28
D-Galactose 2.08 0.26
Sucrose 0.97 0.89
Trehalose 1.29 0.28
Fatty Acids Palmitic acid 0.92 0.72
Sugar Phosphates
Mannose 6-phosphate 1.22 0.39
Glucose 6-phosphate 1.26 0.34
Fructose 6-phosphate 1.09 0.72
Polyamines Putrescine 0.82 0.62
Not Available L-Iditol 1.55 0.42
Cyclic Amines Agmatine 0.72 0.48
Acyl Phosphates 3-Phosphoglyceric acid 0.57 0.45
106
Supplemental Table 2: Primer sequence used for RT-PCR analysis given in 5’ 3’ orientation
Transcript Primer Forward Primer Reverse
SDHAF4 TGTTAGGCCTAGCTCCTGATG ACTGGAATAACAAGATCACCAG Aktin2 GAAGATCAAGATCATTGCTCCT TACTCTGCTTGCTGATCCA