Proc. Nati. Acad. Sci. USAVol. 89, pp. 8011-8015, September 1992Biochemistry

Primary structure, import, and assembly of the yeast homolog ofsuccinate dehydrogenase flavoprotein

(molecular cloning/mitochondrial biogenesis/Saccharomyces cerevisiae)

NORBERT SCHULKE*, GUNTER BLOBEL, AND DEBKUMAR PAINThe Rockefeller University, Laboratory of Cell Biology, Howard Hughes Medical Institute, New York, NY 10021

Contributed by Gunter Blobel, May 28, 1992

ABSTRACT We have isolated a homolog for the flavopro-tein subunit of succinate dehydrogenase [succinate:(acceptor)oxidoreductase, EC 1.3.99.1] from Saccharomyces cerevisiaeand used the obtained peptide sequences to clone and charac-terize the corresponding gene. It contained an open readingframe of 1923 base pairs and encoded a protein of 640 aminoacids (MA, 70,238) that showed -49% and -28% identity withthe Escherichia coli and Baciflus subtilis enzymes, respectively.AU features of the FAD cofactor binding site were completelyconserved. Comparison of the deduced protein sequence withthe N-terminal sequence determined from the isolated proteinrevealed an N-terminal extension of 28 amino acids thatpresumably represents a mitochondrial signal sequence. Afterin vitro transcription and translation, the preprotein wasefficiently imported into isolated yeast mitochondria, cleaved toits mature form, and assembled into the membrane-boundsuccinate dehydrogenase complex.

Four respiratory complexes in mitochondria transfer elec-trons from a donor substrate to an electron acceptor and theenergy released during the electron transfer is used forsynthesis ofATP (1). One ofthese is complex II or succinate-coenzyme Q reductase. The major component of this com-plex is succinate dehydrogenase [SDH; succinate:(acceptor)oxidoreductase, EC 1.3.99.1]. It catalyzes the oxidation ofsuccinate to fumarate and transfers the released electrons toubiquinone.

In beef heart mitochondria, SDH consists of two polypep-tides. The catalytically active part is formed by two periph-eral membrane proteins (1). The smaller of these two poly-peptides (27 kDa) contains only iron-sulfur clusters and isreferred to as the iron-sulfur protein. The larger component(70 kDa) contains the iron-sulfur clusters and, as the onlysubunit of the complex, covalently bound FAD. It is there-fore referred to as flavoprotein (SDH-Fp). SDH is anchoredto the inner mitochondrial membrane by two integral mem-brane proteins of 13.5 and 15.5 kDa, which are involved intransfer of electrons to ubiquinone (1).The primary structure of two prokaryotic representatives

of the SDH family has been established (2, 3), but only apartial genomic clone of yeast SDH-Fp has been isolated bythe PCR so far (4). In this paper, we describe the isolation andcharacterization of a full-length genomic clone for SDH-Fpfrom Saccharomyces cerevisiae.t The deduced amino acidsequence revealed high similarity with SDH-Fp from pro-karyotic sources (2, 3). The in vitro translated SDH-Fpprecursor was efficiently imported into isolated yeast mito-chondria and processed to its mature form. Like the endog-enous protein, imported SDH-Fp was associated with mito-chondrial membranes.

MATERIALS AND METHODSPurification of SDH-Fp from S. cerevisiae. Isolated mito-

chondria (100 mg of protein) were converted to mitoplasts (at10 mg/ml) in HE buffer [20 mM Hepes-KOH, pH 7.4/5 mMEDTA/1 mM dithiothreitol (DTT)/1 mM phenylmethylsul-fonyl fluoride (PMSF)/50 units of Trasylol per ml/5 pg eachofantipain, chymostatin, leupeptin, and pepstatin per ml] andsubsequently sonicated as described (5, 6). Aliquots (500 .ul)of the sonicated mitoplasts were layered over a 500-,ulcushion of 250 mM sucrose in HE buffer and centrifuged at356,000 x g for 30 min at 4°C in a Beckman TL-100.2 fixedangle rotor. For salt extraction, the pellet fractions containingtotal mitochondrial membranes were resuspended in 4 ml of0.5 M KOAc in HE buffer and incubated for 30 min. Thesamples (500-,l aliquots) were then centrifuged at 356,000 xg for 30 min at 4°C through a 250 mM sucrose cushion (500,ul each) in HE buffer containing 0.5 M KOAc. To extractperipheral membrane proteins, salt-extracted membraneswere resuspended in 2 ml of 0.1 M sodium carbonate, pH11.5/5 mM EDTA/1 mM DTT/1 mM PMSF/5 units ofTrasylol per ml/5 ,Ag each of antipain, chymostatin, leupep-tin, and pepstatin per ml and incubated for 30 min on ice. Thecarbonate extracted membranes (500-,ul aliquots) were cen-trifuged at 356,000 x g for 30 min at 4°C through a 250 mMsucrose cushion (500 ,ul each) containing 0.1 M sodiumcarbonate (pH 11.5), 5 mM EDTA, 1 mM DTT, 1 mM PMSF,5 units of Trasylol per ml, and 5 ,ug each of antipain,chymostatin, leupeptin, and pepstatin per ml. The superna-tant (including the cushion) contained peripheral membraneproteins, including SDH-Fp.CNBr Cleavage and Amino Acid Sequencing. Proteins ofthe

carbonate extract were precipitated in 10% (wt/vol) trichlo-roacetic acid, fractionated by SDS/PAGE, transferred to apoly(vinylidine difluoride) membrane (Immobilon-P PVDF;Millipore), and stained as described (7). The protein bandrepresenting the putative yeast homolog of SDH-Fp wasexcised, destained in 50% (vol/vol) methanol and 10% (vol/vol) acetic acid, air-dried, and subjected to sequencing on agas-phase sequenator (Applied Biosystems).CNBr cleavage was performed as described for 2 h at room

temperature (8). The cleavage products were separated bySDS/PAGE, transferred to a PVDF membrane, and pro-cessed for protein sequencing as described above.PCR and Cloning of the Gene. Degenerate sense [SDH-N1,

5'-GCGAATTCGAAAC(C/T)CA(A/G)GGITC(A/C/G/T)GT(A/C/G/T)AA(C/T)GG-3'] and antisense [SDH-C1,5'-GCGTCGAC(A/G/T)AT(A/G)TG(A/G)TA(C/T)TT(A/C/G/T)CC(A/G)TC(A/C/G/T)GC-3'; SDH-C2, 5'-GCGTCGACGT(A/C/G/T)GTCAT(A/G)TA(A/G)TG(A/

Abbreviations: PMSF, phenylmethylsulfonyl fluoride; SDH, succi-nate dehydrogenase; SDH-Fp, flavoprotein subunit of SDH; STI,soybean trypsin inhibitor; DTT, dithiothreitol.*To whom reprint requests should be addressed.tThe sequence reported in this paper has been deposited in theGenBank data base (accession no. M94874).

8011

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

8012 Biochemistry: Schiilke et al.

G/T)AT-3'] oligonucleotide primers containing additional re-striction sites were synthesized according to the obtainedamino acid sequences (see Fig. 2) and considering the codonusage for S. cerevisiae (9). PCR was performed as described(10). The amplification products of the expected length wereisolated and subcloned into the EcoRI/Sal I sites of pBlue-script SK(+) (Stratagene); then their sequence was deter-mined (11). A 66-base-pair (bp) insert of one of the clones(pNS1) encoding the N-terminal peptide was used for furtherstudies.The [32P]dCTP-labeled insert of pNS1 was used to screen

a genomic Agtll library of S. cerevisiae (12). The BamHI/Dra I fragment of one of the plaque-purified clones (ANS7)corresponding to the entire coding region for SDH-Fp wassubcloned into the BamHI/EcoRV sites of pBluescriptSK(+) (designated as pNS15) and sequenced (11). DNAsequence analysis was performed by using the DNAstarsoftware programs (DNAstar, Madison, WI).Import of SDH-Fp Precursor into Isolated Yeast Mitochon-

dra. The plasmid pNS15 was linearized with Ava I andtranscribed using the MEGAscript T3 in vitro transcriptionkit (Ambion, Austin, TX) for 4 h at 370C. 35S-labeled precur-sor was synthesized in a nuclease-treated rabbit reticulocytecell-free system (Promega) following the manufacturer's pro-tocol. Import ofthe precursor into isolated mitochondria (100,&g) was performed as described (6). After import, the sam-ples were chilled on ice and incubated with various concen-trations of trypsin in HS buffer (20 mM Hepes-KOH, pH7.4/0.6 M sorbitol) for 30 min on ice. Trypsin digestion wasstopped by addition of-60 1. of a mixture of soybean trypsininhibitor (STI) (20 mg/ml)/Trasylol (100 units/ml)/0.5 mMPMSF in HS buffer. The samples were incubated on ice for10 min and then diluted with 0.9 ml of HS buffer containing0.1 mg of bovine serum albumin per ml and 0.2 mM PMSF.The mitochondria were collected by centrifugation at 16,000x g for 2 min at 4°C. The pellet fractions were processed forSDS/PAGE and fluorography as described (13).

Mitochondrial Subfractlonadon. After protein import andincubation with trypsin (at 0.1 mg/ml) mitochondrial pellets(200 ug for each treatment) were resuspended in 100 t1 df HEbuffer containing 50 pg of STI per ml and 100 units of Trasylolper ml and alternatively subjected to three different treatments.The first sample was used to assess the membrane-bound stateof the imported polypeptide. The resuspended mitochondriawere diluted with 1 ml ofHE buffer containing 50 pg ofSTI perml and 100 units ofTrasylol per ml, incubated on ice for 15 min,and sonicated as described above for isolation of the endoge-nous protein. The second sample was used to assess the saltextractibility of the imported protein from the mitochondrialmembranes. After dilution and sonication (see above), 4 MNaCl was added to a final concentration of 0.5 M, and thesample was incubated for 15 min on ice. The third sample wasused to assess the carbonate extractibility of the importedprotein from the membranes. The resuspended mitochondriawere diluted with 1 ml of 0.1 M sodium carbonate (pH 11.5)(containing 5 mM EDTA, 1 mM DTT, 1 mM PMSF, 5 units ofTrasylol per ml, 50 Mg of STI per ml, and 5 pg each of antipain,chymostatin, leupeptin, and pepstatin per ml) and incubated for15 min on ice. After the appropriate treatment, all samples werecentrifuged at 356,000 x g for 20 min at 40C. The supernatantand pellet fractions were processed for SDS/PAGE and fluo-rography as described above.

RESULTSIsolation of SDH-Fp and Partial Peptide Sequences. Isola-

tion of the yeast homolog of SDH-Fp was based on theobservation that SDH-Fp is -aperipheral membrane protein ofcomplex II in the mitochondrial inner membrane (14). Thesize of the yeast SDH-Fp was expected to be 65-70 kDa byanalogy to SDH-Fp from Escherichia coli, Bacillus subtilis,

97.466.242.7

I i 4 -1 I

31.0

21 .514.4 vow

FIG. 1. Proteins of mitochondria and subfractions separated bySDS/PAGE and stained with Coomassie blue. Fractionation was doneas described. Lanes: 1, size standards (kDa); 2, total mitochondria (20Ag); 3, matrix and intermembrane space proteins (equivalent to 40 pgof mitochondria); 4, peripheral membrane proteins extracted by highsalt (equivalent to 100 pg of mitochondria); 5, integral membraneproteins (equivalent to 40 pg of mitochondria); 6, carbonate extractedmembrane proteins (equivalent to 100 pg of mitochondria). Arrowpoints to the yeast homolog of SDH-Fp in the carbonate extractablemembrane protein fraction used for further study.

and beef heart mitochondria (1). Yeast mitochondrial mem-branes were subjected to sequential extractions with high saltand carbonate at pH 11.5. A subset of about 15 major proteinswas extracted by carbonate (Fig. 1, lane 6) with one majorprotein in the 66-kDa region. Further fractionation by differ-ent chromatographic methods (ion-exchange, hydrophobic,and reversed-phase chromatography) showed no apparentcontaminating proteins in this region as judged by SDS/PAGE (data not shown). The N-terminal sequence (25 resi-dues) of the 66-kDa polypeptide (see Fig. 2) showed nohomology to known yeast proteins. However, peptide se-quences obtained from CNBr-derived fragments (Fig. 2) werealmost identical to positions 69-85 and 387-403 of SDH-Fpfrom E. coli. This suggested that the isolated protein indeedrepresented the yeast homolog of SDH-Fp.

Sequencing of a Genotnic Clone for SDH-Fp. Two sets ofPCR amplifications were performed with yeast genomic DNAas the template, SDH-N1 as the sense primer, and eitherSDH-C1 or SDH-C2 as the antisense primer (Fig. 2). Eachreaction resulted in a single product of 66 and -400 bp,respectively (data not shown), suggesting that the peptidesequence corresponding to all three primers was containedwithin a single polypeptide. A yeast genomic Agtll library wasscreened for SDH-Fp using the 32P-labeled 66-bp probe. ABamHI/Dra I fragment (2923 bp) of the insert of one of theclones (ANS7) was sequenced (Fig. 3). Between the laterassigned nucleotides 1 and 1923, it contained the entire codingregion of the yeast homolog of SDH-Fp. In addition, a search

N-terminus

CNBr 1

E. coli

CNBr 2

E. coli

ZTQGSVNGSASRSADGICYNIIDNZYSDH-N1 SDH-C1

SDH-C2

(X) ?DTVKGSDLGDQDSI1111111 1111 11

M YDTVKGSDYIGDQDAIEYMCKT

(M) ??GEAA?VSVHGANRLGANH1 1111111111

F AVGEIACVSVHGANRLGGN

FIG. 2. Partial sequences of the N terminus and of two CNBrfragments of the isolated yeast SDH-Fp homolog. Arrows denotelocation and direction of primers used in the PCR. Question marksindicate residues that could not be identified. Corresponding homol-ogous sequences from E. coli are shown for comparison.

Proc. Nad. Acad. Sci. USA 89 (1992)

Biochemistry: Schulke et al. Proc. Natl. Acad. Sci. USA 89 (1992) 8013

-272 GGATCCGGGCCTCTTCTATTGGTTGTTTGTTTGCTCAAACCCGTTATATA-2 22 TTCAGGCATCCTCGACTCTAACCTTTTGCCACGTCGAGGCGGCTTGAAGCTTAAATAGCACE 3Z~TAGTAGACACP CTAACCAGTAGTATACTTTGCACTT-111 TCGATATTCTTTTCACTAATCTCCTCCCCAACCCCTTATTGAAGATAAAAAGAAAGAAAGAAAGAAAGAAAAAATCCAATTTCATAGTACGAAGAAGAACGAGAATAAAG

1 ATG CTA TCG CTA AAA AAA TCA GCG CTC TCC AAG TTG ACT TTG CTC AGA AAC ACA AGA ACA TTT ACA TCG TCA GCT TTG GTG CGC-28 met leu ser leu lys lys ser ala leu ser lys leu thr leu leu arg asn thr arg thr phe thr ser ser ala leu val arg

85 VCAA ACG CAG GGC TCT GTA AAC GGT TCC GCG TCC AGA TCT GCA GAC GGG AAG TAC CAC ATA ATA GAT CAC GAG TAT GAC TGT GTG1 gin thr gin gly ser val asn gly ser ala ser arg ser ala asp gly lys tyr his ile ile asp his glu tyr asp cys val

169 GTA ATC GGT GCC GGT GGT GCC GGC CTT AGA GCG GCC TTT GGT CTT GCC GAG GCG GGC TAC AAG ACT GCT TGT ATA TCC AAG CTT29 val ile gly ala gly gly ala gly leu arg ala ala phe gly leu ala glu ala gly tyr lys thr ala cys ile ser lys leu

253 TTC CCC ACC AGA TCC CAC ACT GTT GCT GCT CAG GGT GGT ATC AAT GCC GCT CTG GGA AAT ATG CAC AAG GAT AAC TGG AAA TGG57 phe pro thr arg ser his thr val ala ala gin gly gly ile asn ala ala leu gly asn met his lys asp asn trp lys trp

337 CAT ATG TAC GAT ACT GTG AAA GGA TCT GAT TGG CTA GGT GAC CAG GAC TCC ATC CAT TAC ATG ACC AGG GAA GCG CCC AAA TCG85 his met tyr asp thr val lys gly ser asp trp leu gly asp gin asp ser ile his tyr met thr arg glu ala pro lys ser

421 ATC ATT GAA CTG GAA CAC TAT GGT GTT CCT TTT TCA AGA ACT GAA AAC GGT AAG ATC TAC CAA AGA GCC TTT GGT GGT CAG ACC113 ile ile glu leu glu his tyr gly val pro phe ser arg thr glu asn gly lys ile tyr gin arg ala phe gly gly gin thr

505 AAG GAG TAC GGT AAG GGT GCT CAG GCC TAT AGA ACA TGC GCT GTC GCA GAC AGG ACA GGA CAT GCT CTT TTA CAC ACG CTT TAT141 lys glu tyr gly lys gly ala gin ala tyr arg thr cys ala val ala asp arg thr gly his ala leu leu his thr leu tyr

589 GGC CAA GCT TTA AGA CAT GAC ACA CAT TTC TTT ATT GAG TAC TTT GCC CTC GAT CTG TTG ACC CAT AAT GGC GAG GTC GTT GGT169 gly gin ala leu arg his asp thr his phe phe ile glu tyr phe ala leu asp leu leu thr his asn gly glu val val gly

673 GTC ATC GCT TAT AAT CAG GAA GAC GGT ACC ATC CAC AGA TTC AGA GCA CAC AAG ACC ATT ATT GCC ACT GGT GGC TAT GGT AGA197 val ile ala tyr asn gin glu asp gly thr ile his arg phe arg ala his lys thr ile ile ala thr gly gly tyr gly arg

757 GCA TAC TTC TCT TGT ACC TCT GCT CAC ACA TGT ACG GGT GAC GGT AAT GCC ATG GTT TCG CGT GCT GGT TTC CCC TTG CAA GAT225 ala tyr phe ser cys thr ser ala his thr cys thr gly asp gly asn ala met val ser arg ala gly phe pro leu gin asp

841 TTA GAG TTT GTT CAA TTC CAT CCT TCA GGT ATA TAT GGG TCT GGT TGC TTA ATC ACT GAA GGT GCT CGT GGT GAA GGT GGT TTT253 leu glu phe val gin phe his pro ser gly ile tyr gly ser gly cys leu ile thr glu gly ala arg gly glu gly gly phe

925 TTG GTT AAT TCT GAA GGT GAA AGA TTC ATG GAA CGT TAC GCT CCT ACG GCC AAG GAT CTA GCT TGT AGA GAT GTC GTT TCC AGA281 leu val asn ser glu gly glu arg phe met glu arg tyr ala pro thr ala lys asp leu ala cys arg asp val val ser arg

1009 GCA ATC ACC ATG GAG ATC AGA GAA GGC AGA GGT GTT GGT AAG AAA AAG GAC CAC ATG TAC TTA CAA TTG AGC CAT CTA CCT CCG309 ala ile thr met glu ile arg glu gly arg gly val gly lys lys lys asp his met tyr leu gin leu ser his leu pro pro

1093 GAA GTT CTA AAG GAA AGA TTG CCA GGT ATC TCT GAA ACA GCA GCC ATT TTT GCT GGT GTA GAC GTC ACC AAG GAA CCT ATT CCC337 glu val leu lys glu arg leu pro gly ile ser glu thr ala ala ile phe ala gly val asp val thr lys glu pro ile pro

1177 ATT ATT CCT ACC GTC CAC TAT AAC ATG GGT GGT ATT CCC ACG AAG TGG AAT GGT GAG GCA TTA ACC ATT GAT GAA GAA ACT GGC365 ile ile pro thr val his tyr asn met gly gly ile pro thr lys trp asn gly glu ala leu thr ile asp glu glu thr gly

1261 GAA GAC AAG GTT ATT CCC GGT TTA ATG GCT TGT GGT GAA GCC GCT TGT GTT TCT GTC CAT GGT GCC AAT AGA TTA GGT GCC AAT393 glu asp lys val ile pro gly leu met ala cys gly glu ala ala cys val ser val his gly ala asn arg leu gly ala asn

1345 TCC TTG TTG GAT CTT GTT GTC TTT GGT CGT GCT GTT GCC CAT ACG GTT GCT GAC ACT TTA CAG CCT GGG TTG CCA CAC AAA CCA421 ser leu leu asp leu val val phe gly arg ala val ala his thr val ala asp thr leu gin pro gly leu pro his lys pro

1429 CTA CCT TCT GAT TTG GGT AAA GAA TCC ATC GCA AAC TTG GAT AAA CTA AGA AAT GCT AAT GGT TCA AGA TCT ACG GCA GAA ATT449 leu pro ser asp leu gly lys glu ser ile ala asn leu asp lys leu arg asn ala asn gly ser arg ser thr ala glu ile

1513 AGA ATG AAT ATG AAA CAA ACT ATG CAA AAG GAT GTT TCC GTC TTT AGA ACA CAA TCA TCT TTA GAT GAA GGT GTT CGG AAC ATT477 arg met asn met lys gin thr met gin lys asp val ser val phe arg thr gin ser ser leu asp glu gly val arg asn ile

1597 ACT GCA GTA GAG AAG ACC TTT GAT GAT GTG AAG ACG ACC GAT AGA TCA ATG ATC TGG AAT TCT GAC TTG GTT GAA ACT CTG GAG505 thr ala val glu lys thr phe asp asp val lys thr thr asp arg ser met ile trp asn ser asp leu val glu thr leu glu

1681 CTA CAG AAC TTA TTA ACC TGT GCC TCC CAA ACA GCT GTT TCC GCT GCT AAT AGA AAG GAA TCC CGT GGT GCT CAT GCA AGA GAG533 leu gin asn leu leu thr cys ala ser gin thr ala val ser ala ala asn arg lys glu ser arg gly ala his ala arg glu

1765 GAT TAT CCA AAT AGA GAT GAC GAA CAT TGG ATG AAG CAT ACA TTA TCC TGG CAA AAG GAC GTC GCT GCC CCA GTG ACT TTG AAA561 asp tyr pro asn arg asp asp glu his trp met lys his thr leu ser trp gin lys asp val ala ala pro val thr leu lys

1849 TAC AGA AGG GTT ATC GAT CAC ACT TTG GAC GAA AAG GAA TGT CCT TCC GTA CCT CCA ACT GTA AGA GCC TAC TAA TTTGAACCTCA589 tyr arg arg val ile asp his thr leu asp glu lys glu cys pro ser val pro pro thr val arg ala tyr *

1935 TTGTATTTTACGGAAAAGAATATCATACTCTTCTTTAATTGCACTTTTTTTGTGCGTTTGCACTTTTTTACCACTGACTCACTAATTTGTATATATACCTATTAATATACA2046 TTTACATAAAGTTTCTTCTTATACATACTCTATTTATTTAGTTATTTATTAACTTACTATTTATTTATTTATTTATTTATTTATTTATTACTTTCAATTTTTTATCGAGGC2157 ATTTCCTTAGTTCTCCAATTTTTTTTCTCATTAGCCAGATGTGTGTTTTTCTGGCCCTCACAAAA AATCACCACAACGTCATGGCGAACGTAAATATGTAACTAAA2268 AATTAAGATGGGCAGACATTTATCATTTTGCTTATGACTAAATTGCGAATTGCTGTACAAGGGTGCTGTCATGGTCAGCTAAACCAAATTTATAAAGAAGTGTCACGAATC2379 CATGCGAAGACTCCCATCGATCTATTAATTATTCTTGGAGATTTTCAAAGTATTCGTGATGGTCAGGATTTTAAGTCAATAGCCATACCACCAAAATATCAAAGACTCGGT2490 GATTTCATATCATACTACAATAATGAGATTGAAGCCCCAGTCCCTACTATTTTTATTGGCGGTAATCATGAATCGATGAGACATTTAATGCTTCTGCCACATGGTGGTTAT2601 GTAGCAAAGAACATTTTTTATATGGGATACTCTAACGTTATATGGTTTMA

FIG. 3. Nucleotide sequence of the gene coding for the yeast homolog of SDH-Fp and its deduced amino acid sequence. The first nucleotideand the first amino acid residue of the mature protein are designated as position 1. Amino acid residues of the signal peptide are given by negativenumbers. Stop codon is indicated by an asterisk. Arrowhead denotes the cleavage site for mitochondrial signal peptidase. TATA-like sequences(15) at positions -137 to -141 and -155 to -161 are boxed. Residues corresponding to peptide sequences obtained from isolated protein byEdman degradation (Fig. 2) are underlined (broken lines indicate unidentified residues). Open reading frame coding for the N-terminal part ofthe "debranching" enzyme (16) starts at position 2300.

of the GenBank data base (17) for homologous sequences at ison of the deduced N-terminal amino acid sequence (Fig. 3)the 3' end of the insert revealed an open reading frame (from to the N-terminal sequence obtained by amino acid sequenc-nucleotides 2300-2651) coding for part of the recently identi- ing (Fig. 2) revealed an N-terminal extension of 28 aminofied "debranching" enzyme (16). This indicates a side-by-side acids in the predicted gene product. This presequence rep-location of the two genes on the chromosome. resents a typical mitochondrial signal sequence with a pre-

Analysis of the Amino Acid Sequence of SDH-Fp. The ponderance of basic (arginine and lysine) and hydroxylated1923-bp open reading frame encoded a protein of 640 amino (serine and threonine) residues and a lack of acidic residuesacids with a calculated molecular weight of 70,238. Compar- (glutamic and aspartic acids). After translocation into the

8014 Biochemistry: Schulke et al.

S. cere :- L. T..{ AL FL-.r7 Y-'. LLR R ' '-r.1HEYDVVIGAG-AGLPAA:--E. co/ I FDAVVi GAGGGA; -AB. subt

S. ceroe E-A:G: A'-' SZ K] FPTRSHV AVAQGG GINA A;ATvL N Y G T_ v_'iWkW7W .^<yDrKG -> Jt / T ,3QD. ';v L.,E. col f ISG:. AL-.....S:KVFPTRSHTVSAQGGI': VALGNfT -E- DN -WEWHMYDTVKGSD':r-QDB. subt Vc; A:1 L'VPS KRSH;.ZHV2AQ(GT N(';AV7-.iY''7 HEH'D--F'TVG'QDI 1--WE .T. r

S. cere rLL-IvP KSRTE IY F K-GK QA'-rR -iADRTAC HA L HT,L -̀E. co/ i .:EL1,IiHMYGLPFSRL:L.EITYQRFCG.,Qs.'K1i r; --.", QAARTAAADRTGHALL ! '

B. subt A.,AVMR1:-QC; . RxFG;--------- '\7TCCQLLY7L:

S. cere YAYILYI" 1 iNG WG~,77AYNC.E I F RhiI: I A G Y R S.1E. col i WYALDLVKNQDGAVVGCTI'AL C E G.YF ARAVrLATGGAGRiYcsNAEINT.GDG*:: i*l IA...B. subt WFi/ ;AvL[)DrRrCRGTVAQN1T~rlQT :;Fy/--hvTMATG-PC~ii.&;TNi G .; ,-

S. cere r!E lQi Pb~-IYG---c-L7- EGAP-GEUG'--- N^ GE"FMERvA- ---2-AKS}A< SRE coil ,IEMWQFH KDPT-zAG--AG-VTECRGEGG- >,^ r- NKHGERFMERYA--p iAK7LA.-RD; ,I;'R, \we -, .bi ,

B. subt En-H/ TATP_-Gr:KLRLM7:Ec5.AFRGEGC;.T.. Y ....GI - -

S. cere - H.HMYYIGQLSHLPEVL-RLPGI :.7AIFAG-VD7KEP-PTTPk INMGG-(-TK FIG. 4. Algmnt of SDH-FpE. co/i G. WG P: HPKT KLDH G VLFSRLP GI E. T:. `VDP VKEP I PV IPTCH .IT homologs from S. cerevisiae, E.B. subt VYLZ';LSHK?`Pkr_! 'T--YE7'G-T ----'[-' coli (2), and B. subtilis (3). Num-

bers on the right indicate aminoS. cere r; PGD:J"J CpSLMACGEAACVSVS.ANRLGANlSLLDLVV;FGRAVbrA v'*- w acid residue of each protein start-E. coi P:-C3WhFAl.7PGLFAVGEIACVSVTHANRLGGNSLLDLFWEGRAA- :- S; S: "A'B.subtGLFAAGECD-YS14HG(~~~~~~~NELETS~~~bS77Y7OMVA Z~ing either with the iiitn eB. subt - ''|vrwIPGLFAAGECE"-S.Hf-yC-,NRL, -~SLLc',"-,' \'''.sE~s.vf+AGa i ;'r S -'.A .S~'-

thionine (E. coli, B. subtilis) orS. cere - 4;L!: :1S L RINAING c HS:A" Te MSqQR;Is'a>-,' P4L;.CK/.I-;`^. .M V VSVFR-; L: I - L- ;S.cereNAN(SP.~~~~~3?AIIRYUMKQTMQKLVSVFR~~~~~with thefirst residue of the matureE. col - T WI. Nc:E:ARK L.....SFFWDAAB. subt j -->.. .->.-|Vsgs|Ra ;F-swr.HKvL2w:;, Vt-0lFS~gREI7.-KgLL.K p ,-,- - -rortetin (S. cerevisiae). Arrow-

head denotes signal peptidaseS. cere ETLELQL`L.ALS-;!'AVSAANREsJRGAMARX^9;D;YRD.DEIIWMKHTlI,-..r:.- .:: cleavage site. Identical residuesE. co I i ECLEL NL:-IL. -' L'AYATAVSAliF'RT'ESRRAHSR D F'P RDRDDEMaWLCH'':R.: S - RR. - are shaded. Dashed lines indicateB.subtubt' FTP QFI.53-NML;TNfASRVY2L7AyYNP.NLE-S lGAHYKPDYP ND:..........L...T......KH........>.......: . . gaps...to -maximize identity.idpstmtdPoly-oyS. cere ECR:.,'__'VPP:V_IRAY peptide sequences were aligned byE. coil I.PTPAF'PKIrIy using the AALIGN program ofB. subt S -.ilP-RYS-,i:vA' DNAstar software.

organelle, the presequence is cleaved off, generating themature protein of612 amino acids with a calculated molecularweight of 67,119.The amino acid sequence determined by N-terminal pep-

tide sequencing differed at position 1 from the deducedmature sequence (glutamic acid instead of glutamine) of themature protein. This may be due to strain differences of theyeasts used for isolation of the SDH-Fp protein and forconstructing the Agtll library or to deamidation during sam-ple preparation for peptide sequencing. The amino acidsequences for the two CNBr fragments (Fig. 2) derived fromthe isolated protein were found to be identical to the deducedsequence and correspond to residues 86-108 and 401-420 ofthe mature protein, respectively (Fig. 3).Comparison of the Yeast Homolog with SDH-Fp from Other

Organisms. Sequence comparison ofthe yeast protein with thehomologs inE. coli (2) andB. subtilis (3) revealed49% and 28%identity, respectively. The FAD binding sites assigned to theN terminus of the prokaryotic enzymes (positions 10-66 in E.coli and positions 6-64 in B. subtilis) and to an internalsegment (positions 358-387 in E. coli and positions 356-375 inB. subtilis) are well conserved in yeast (positions 27-83 and374-404, respectively; Fig. 4).

Histidine residues in SDH-Fp have been postulated toperform a proton donor-acceptor function in the electrontransfer reaction (18). A- total of six histidines have beenconserved in the three homologs of SDH-Fp. These includeHis-62 in yeast (Fig. 4), which is presumably involved in thecovalent attachment of flavin (2, 3, 19), and His-259 in thetripeptide His-Pro-Ser (positions 259-261 in yeast; Fig. 4),which is very similar to the tentatively assigned active siteHis-Pro-Thr found in disulfide oxidoreductases (20).

It has also been suggested that a thiol group is essential forSDH-Fp activity, substrate binding, or both (21). However,none of the cysteine residues is conserved in the three ho-mologs. Cys-257 in SDH-Fp and Cys-248 in fumarate reduc-tase (an enzyme that catalyzes the reverse reaction in vivo) ofE. coli have been proposed to be essential for activity (2).

However, this cysteine is replaced by alanine, in both yeast(position 274) and B. subtilis (position 253).

It is noteworthy that a striking difference is found only inthe N termini of the SDH-Fp homologs (Fig. 4). The yeasthomolog is synthesized as a precursor on cytoplasmic ribo-somes and has to be imported specifically into mitochondria.The N-terminal extension presumably serves as a mitochon-drial signal sequence that is not present in the prokaryoticSDH-Fp (Fig. 4).In Vitro Import and Mtohdria 35S-

labeled SDH-Fp precursor was synthesized in a reticulocytecell-free translation system (Fig. 5, lane 2). When incubatedwith isolated mitochondria, the precursor was efficiently im-ported and processed to its mature form (lane 3). The matureform, but not the precursor, sedimenting with the mitochon-dria was resistant to externally added trypsin (lanes 4-8). Onlyin the presence of detergent was the mature form degraded(lane 9). Like endogenous SDH-Fp, most of the imported

___ mg/ml Trypsin --

Xu o

E ur o o c: c -

p S B H - i pmSUH-Fp

1 2 3 4 5 6 7 8 9

FIG. 5. Import of pSDH-Fp into isolated yeast mitochondria.Mitochondria were incubated with rabbit reticulocyte lysate con-taining the newly synthesized pSDH-Fp, sedimented, and subse-quently treated with the indicated concentrations of trypsin. Lanes:1, 14C-labeled bovine serum albumin as size standard (kDa); 2, 50%ofpSDH-Fp used for each import experiment; 3, mitochondrial pelletafter import; 4-8, mitochondrial pellets after postimport treatmentwith the indicated concentration of trypsin; 9, mitochondrial pelletafter postimport treatment with trypsin (1 mg/mi) in the presence of0.5% Triton X-100. pSDH-Fp, precursor form of SDH-Fp; mSDH-Fp, mature form of SDH-Fp.

Proc. Nad. Acad. Sci. USA 89 (1992)

Proc. Natl. Acad. Sci. USA 89 (1992) 8015

-a 0.1 mg/ml Trypsin .

la _0 x__,°

U,q

pSOH-Fp

mSDH-Fp

m~fw..--.s..

:.

1 2 3 4 5 6 7 8 9

FIG. 6. Submitochondrial localization of imported SDH-Fp. Af-ter protein import and trypsin treatment (at 0.1 mg/ml), mitochondriawere sonicated and incubated, in the absence of salt, in the presence

of 0.5 M NaCl, or in the presence of 0.1 M sodium carbonate (pH11.5). Incubation mixtures were sedimented to yield supernatant (S)and pellet (P) fractions. Lanes: 1, 50%o of the pSDH-Fp used for eachimport experiment; 2, mitochondrial pellet after import; 3, mitochon-drial pellet after postimport treatment with trypsin; 4-9, supernatant(S) and pellet (P) fractions of mitochondrial membranes. pSDH-Fp,precursor form of SDH-Fp; mSDH-Fp, mature form of SDH-Fp.

protein was associated with mitochondrial membranes (Fig. 6,compare lanes 4 and 5). The imported membrane-associatedprotein could be extracted from the membranes at alkaline pH(lanes 8 and 9) but not by high salt (compare lanes 4 and 5 withlanes 6 and 7), suggesting that the imported protein wasassembled as a peripheral membrane protein.

DISCUSSIONThe primary structure of SDH-Fp has previously been de-termined from two prokaryotes, E. coli (2) and B. subtilis (3).Here we report the primary structure of yeast mitochondrialSDH-Fp deduced from the DNA sequence of a genomicclone. The yeast mitochondrial SDH-Fp contains a typicalN-terminal signal sequence that is cleaved after import intomitochondria. The primary structure of the resulting "ma-ture" form of the protein is 49% and 28% identical whencompared to E. coli and B. subtilis, respectively. The pro-karyotic proteins are only 32% identical to each other.Maximum identity was found at the N terminus of the matureproteins that contain the flavin attachment site. All thecomponents of the FAD-binding fold were highly conserved.Comparison of different FAD-binding proteins revealed astructural motif ((-sheet/a-helix/p-sheet) to be involved inthe interaction with the AMP portion of the FAD cofactor(22). Amino acids present in the yeast homolog at positions27-54 are capable of forming such a (3a,8 motif (Fig. 4). Thesecond region presumably interacting with the AMP portionof FAD was located in yeast at positions 374-404 (Fig. 4).The covalent attachment site for the flavin cofactor in

SDH-Fp of beef heart mitochondria was identified to be ahistidine at the N terminus (19). Such a histidine residue isfound in the yeast protein at position 62 (Fig. 4). In addition toHis-62, other conserved histidine residues of SDH-Fp mightbe involved in a proton donor-acceptor function (18, 23). Forexample, the tripeptide His-Pro-Thr of the bacterial SDH-Fpis thought to be present in or near the active site by analogyto another flavin-containing enzyme disulfide oxidoreductase(2, 3, 20). Such a tripeptide is also present in the yeast protein(His-Pro-Ser at positions 259-261), the only difference beingthe conservative replacement of threonine by serine (Fig. 4).The enzymatic activity of several Fp homologs from differ-

ent species is sensitive toward thiol-modifying reagents (2, 21).Inactivation ofthe enzymes can be prevented by malonate andother substrate analogs. Cys-257 in theE. coli protein has beententatively assigned to be essential for activity (2). In contrast,the B. subtilis enzyme is insensitive toward thiol-modifyingreagents and this particular cysteine is replaced by alanine (3).

Such a Cys-Ala replacement is also found in the yeast protein(Fig. 4), suggesting a comparable insensitivity toward thiolmodification. This remains to be shown. Another possibility isthat the observed inhibition of activity of the E. coli enzymeby thiol-modifying reagents results from a secondary effect-e.g., blocking accessibility ofthe substrate to the nearby activesite by steric hindrance. Consistent with this possibility is theobservation that the arginine following the cysteine (in E. coli)or the alanine (in B. subtilis) cannot be replaced by any otheramino acid without loss of enzymatic activity (24).The cloned yeast gene is an additional useful tool to

address questions like posttranslational modification (cofac-tor attachment), import into mitochondria, and subsequentassembly into a functionally active complex. As a first steptoward these goals, we have tested the import of SDH-Fpprecursor into isolated yeast mitochondria. The protein wasefficiently imported, processed to its mature form, and as-sembled into a peripheral membrane-bound state, consistentwith its proper location as a member ofcomplex II at the innermitochondrial membrane.Note Added in Proof. Robinson and Lemire (25) have recentlypublished the sequence for the yeast SDH-Fp gene. This sequencehas an identical open reading frame to that given in this paper.However, the following discrepancies were noted in the 3' noncodingregion: insertion of C at position 1997 in our sequence and replace-ment of CC by TT in our sequence at positions 2310 and 2311.

We thank R. Young (Whitehead Institute, Cambridge, MA) for hisyeast Agtl1 library; S. Mische and The Rockefeller UniversityProtein Sequencing Facility for carrying out the protein sequencedeterminations and synthesis of oligonucleotides; and Drs. K. Bauer,R. Erdmann, H. Murakami, C. Nicchitta, and D. Schnell for theirhelp on PCR, molecular cloning, fruitful discussions, and criticalreading of the manuscript. N.S. was supported by a postdoctoralfellowship of the Deutsche Forschungsgemeinschaft.1. Hatefi, Y. (1985) Annu. Rev. Biochem. 54, 1015-1069.2. Wood, D., Darlinson, M. G., Wilde, R. J. & Guest, J. R. (1984)

Biochem. J. 222, 519-534.3. Phillips, M. K., Hederstedt, L., Hasnain, S., Rutberg, L. & Guest,

J. R. (1987) J. Bacteriol. 169, 864-873.4. Robinson, K. M., von Kieckebusch-Guck, A. & Lemire, B. D.

(1991) J. Biol. Chem. 266, 21347-21350.5. Murakami, H., Pain, D. & Blobel, G. (1988) J. Cell Biol. 107,

2051-2057.6. Pain, D., Murakami, H. & Blobel, G. (1990) Nature (London) 347,

444 449.7. Schnell, D., Blobel, G. & Pain, D. (1990) J. Cell Biol. 111, 1825-1838.8. Nikodem, V. & Fresco, R. (1979) Anal. Biochem. 97, 382-386.9. Maruyama, T., Gojobori, T., Aota, S. & Ikemura, T. (1986) Nucleic

Acids Res. 14, rlSl-r197.10. Murakami, H., Blobel, G. & Pain, D. (1990) Nature (London) 347,

488-491.11. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. Acad.

Sci. USA 74, 5463-5467.12. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY), 2nd Ed.

13. Waters, M. G. & Blobel, G. (1986) J. Cell Biol. 102, 1543-1550.14. DePierre, J. W. & Ernster, L. (1977) Annu. Rev. Biochem. 46,

201-262.15. Struhl, K. (1987) Cell 49, 295-297.16. Chapman, K. B. & Boeke, J. D. (1991) Cell 65, 483-492.17. Bilofsky, H. S. & Burks, C. (1988) Nucleic Acids Res. 16, 1861-1864.18. Vik, S. B. & Hatefi, Y. (1981) Proc. Natl. Acad. Sci. USA 78,

6749-6753.19. Kenney, W. C., Walker, W. H. & Singer, T. P. (1972) J. Biol.

Chem. 247, 4510-4513.20. Rice, D. W., Schultz, G. E. & Guest, J. R. (1984) J. Mol. Biol. 174,

483-496.21. Kenney, W. C., Mowery, P. C., Seng, L. R. & Singer, T. P. (1976)

J. Biol. Chem. 251, 2369-2373.22. Wierenga, R. K., Terpstra, P. & Hol, W. G. J. (1986) J. Mol. Biol.

187, 101-107.23. Hederstedt, L. & Hatefi, Y. (1986) Arch. Biophys. Biochem. 247,

346-354.24. Hederstedt, L. & Heddn, L.-. (1989) Biochem. J. 260, 491-497.25. Robinson, K. M. & Lemire, B. D. (1992) J. Biol. Chem. 267,

10101-10107.

Biochemistry: Schfilke et al.