Vol. 10, No. 12MOLECULAR AND CELLULAR BIOLOGY, Dec. 1990, p. 6306-63150270-7306/90/126306-10$02.00/0Copyright © 1990, American Society for Microbiology

Multiple cis- and trans-Acting Elements Involved inRegulation of the neu GeneTING-CHUNG SUEN AND MIEN-CHIE HUNG*

Department of Tumor Biology, Box 79, The University of Texas M. D. Anderson Cancer Center,1515 Holcombe Boulevard, Houston, Texas 77030

Received 1 June 1990/Accepted 11 September 1990

A 2.4-kb rat neu genomic DNA fragment that hybridized to the 5'-most coding sequence of the rat neu cDNAwas cloned. S1 nuclease mapping identffied multiple transcriptional initiation sites. DNA sequence analysisrevealed that this fragment contained 64 bp of the first intron, 81 bp of the first exon, and the upstreamnoncoding sequence of the neu gene. The sequence immediately upstream of the translation start site was G+Crich (>75%) and contained a consensus CCAAT sequence despite the absence of a TATA box. An Spl-bindingsite was found, in addition to various sequence motifs common to the promoters of the human neu gene (erbB2),the epidermal growth factor receptor gene, and the simian virus 40 enhancer. A 2.2-kb EcoRI-Narl fragmentcontaining sequences upstream from the 3'-most transcriptional start site was fused to the bacterialchloramphenicol acetyltransferase reporter gene and shown to promote transcription efficiently. A series ofpromoter deletion constructs was made, and results from transfection and subsequent chloramphenicolacetyltransferase assays suggested the presence of multiple cis-acting elements that contributed either positivelyor negatively to the transcription activity. Cotransfection competition experiments using subcloned cis-actingelements confirmed the existence of trans-acting factors interacting with these DNA fragments. In addition, a

gel retardation assay was performed to demonstrate the physical binding of nuclear factors to certainfragments. The results complemented those of the deletion studies and led us to conclude that transcriptionalregulation of the neu proto-oncogene involves at least one negative and three positive trans-acting factorsinteracting with different cis-acting elements along the neu gene promoter.

neu was discovered as the transforming oncogene inethylnitrosourea-induced rat neuro/glioblastoma (50). De-tailed comparison with the normal allele (21) revealed asingle point mutation in the transmembrane domain of theoncogene (5, 22), which results in the activation of thetyrosine kinase activity of the protein product (6, 7, 48, 56).The human counterpart, referred to as HER2 or c-erbB2, hasalso been cloned (9, 33, 65). The protein product is a 185-kDamembrane phosphoglycoprotein (p185) (41, 46) closely re-lated to epidermal growth factor receptor (EGF-r) (4, 45, 65)and having intrinsic tyrosine kinase activity (1, 10, 55). TheHER2 or c-erbB2 gene has been found to be amplified oroverexpressed in many human primary tumors, includingsalivary adenocarcinoma (49), gastric cancer (15), adenocar-cinomas from the stomach and colon, breast carcinoma (59),lung carcinoma (47), and colon carcinoma (11). Amplifica-tion or overexpression of c-erbB2 correlates very well withbreast carcinomas (33, 34, 36, 62) and ovarian cancers (53,67). Others have reported a good correlation of c-erbB2amplification with relapse and survival of breast cancerpatients (52, 53) and suggested that the c-erbB2 level may beused as a prognostic factor (8, 64) in breast cancer. Sinceoverexpression ofHER2 or c-erbB2 is able to transform NIH3T3 cells upon transfection (12, 19), the gene is very likely toplay an important role in the tumorigenic process. Differentmechanisms are suggested to contribute to overexpressionof c-erbB2 in breast cancer cell lines (35). Our laboratory hasshown that amplification of the neu gene may facilitateinduction of a single-point mutation, resulting in expressionof the transforming protein (23). Furthermore, mammarycarcinoma develops in transgenic mice that uniformly ex-

* Corresponding author.

press the neu oncogene product (9, 39), while those thatcarry the normal as well as an in vitro-mutated c-erbB2develop different kinds of tumors (57). All these studiesindicate that deregulation of the neu gene may play animportant role in tumorigenesis. To study regulation of theneu gene at the transcriptional level, we cloned and charac-terized the neu gene promoter. Fusion of this promoter tothe bacterial chloramphenicol acetyltransferase (CAT) genedemonstrated functional promoter activity. Deletion studiessuggested that different DNA segments of the neu genepromoter contribute either positively or negatively to tran-scriptional activity. The existence of trans-acting factorsinteracting with these DNA elements was proved by acotransfection competition assay with specific subclonedfragments or by a gel retardation assay. Analysis of thesequence immediately upstream of the 3'-most transcriptioninitiation site revealed similarity to the promoters of theHER2 (24, 58), EGF-r (25, 27), and other growth factor- orreceptor-related genes (2, 26, 32, 60). These similaritiesinclude high G+C content (>75%), absence of a TATA box,existence of an Spl-binding site, and multiple transcriptionalinitiation sites. In addition, this sequence may have certainfactors in common with the simian virus 40 (SV40) enhancer.

MATERIALS AND METHODSPlasmids, bacterial strains, and cloning. All molecular

cloning techniques have been described elsewhere (37).pMT2 is a plasmid vector containing the bacterial CAT gene(61), which was used to construct the series of CAT plas-mids. pRSVCAT is a plasmid containing the CAT geneunder the control of the Rous sarcoma virus long terminalrepeat (16) and was used as a positive control in the CATassays. pRSVlacZ contains the bacterial ,-galactosidasegene driven by the Rous sarcoma virus long terminal repeat

6306

REGULATION OF THE neu GENE 6307

5 kb

A RI

L

BRI

Bm Bm Bm RII

+ +

Xb Xh S

lIl

Xh1 kb

I I

+~~~~~~~~~~~~~~~~~~~~~~~~

+

c RI RV Xb RV StXh SII

+

500 bp

sequence

S 1 probes: * NclI

FIG. 1. Cloning of the extreme 5' sequence of the rat neu gene.(A) The 33-kb EcoRI fragment containing the genomic rat neu gene.Symbols: +, Sequences that hybridized to a 330-bp PstI probelocated at the 5' end of the neu cDNA; -, nonhybridized sequences.Only the relevant BamHI sites are shown, though seven otherBamHI sites were mapped within this region. (B) Enlargement of the5'-end 5.5-kb EcoRI-BamHI fragment, along with restriction sitesand sequences that hybridized to the same PstI probe. (C) Structureof the 2.4-kb EcoRI-SacI fragment, which was subcloned, restric-tion mapped, and hybridized to the PstI probe. Only the 350-bpXhoI-SacI fragment hybridized to the 5' PstI probe, suggesting thelocation of transcriptional start sites within this sequence. *, Probesused for Si nuclease analysis. The 640-bp EcoRV-SacI fragment (O)was subcloned into M13mpl8 or M13mpl9 for sequencing (see Fig.3). Restriction sites: Bm, BamHI; RI, EcoRI; RV, EcoRV; S, SacI;St, StuI; Xb, XbaI; Xh, XhoI. DNA fragments are drwn to scale.

(14) and was used to monitor transfection efficiency. pSp64(Promega) and pUC13 were used for subcloning.Enzymes and reagents. Restriction enzymes, Klenow frag-

ment, T4 ligase, T4 kinase, calf intestinal phosphatase, andS1 nuclease were purchase from either Bethesda ResearchLaboratories or Boehringer Mannheim. o-Nitrophenyl-p-D-galactopyranoside (ONPG), acetyl coenzyme A, poly(dI-dC) poly(dI-dC), and other general chemicals were ob-tained from Sigma Chemical Co. [14C]chloramphenicol wasobtained from Amersham. Media and reagents for tissueculture were obtained from either GIBCO or Hazleton.

Sequencing and mapping of transcription initiation sites. ADNA fragment was cloned into M13mpl8 or M13mpl9 andsequenced by the dideoxy-chain termination method (44). S1nuclease mapping (20) was used to locate the transcriptioninitiation sites. Two probes, the 505-bp BclI-EcoRV and the486-bp NcoI-EcoRV fragments, were used for S1 protectionanalysis (Fig. 1C). The two probes were 5' end labeled with[,y-32P]ATP at the BclI and NcoI sites. Total RNA wasisolated either from NIH 3T3 cells for a negative control orfrom DHFR-G8 cells, an NIH 3T3 transfectant that overex-presses the normal rat neu gene. The RNAs were hybridizedto the probe and subjected to S1 digestion. After the S1

reaction was stopped, the protected RNA-DNA hybridswere resolved on a 6% sequencing gel.

Construction of CAT plasmids. Plasmid pMT.IC3 wasderived from pMT2 by inserting a polylinker into the HindIlIsite immediate 5' to the CAT gene (see Fig. 4A and B).pNeu2.4 was restricted with EcoRI, filled in with Klenowfragment, and restricted with Nar. The 2.2-kb EcoRI-NarIfragment was then isolated and ligated to EcoRV- andCiaI-restricted pMT.1C3, and the final construct was namedpNeuEcoRICAT. Similarly, the XbaI-NarI fragment wascloned into the XbaI and ClaI sites of pMT.1C3, and theresulting plasmid was named pNeuXbaICAT. pNeuXbaICAT was then cut with BgIII, blunt ended with Klenowfragment, restricted EcoRV or StuI, and religated to givepNeuEcoRVCAT or pNeuStuICAT, respectively. pNeuXhoICAT was obtained by removing the XhoI-XhoI frag-ment from pNeuXbaICAT, followed by religation.

Construction of pSp64 subclones. The 700-bp EcoRI-XbaIfragment was cut and isolated from pNeu2.4 and was ligatedto the EcoRI- and XbaI-opened pSp64, giving pSp64(EcoRI-XbaI). pNeuXbaICAT was restricted with SstI and EcoRV,and the resulting fragment containing the XbaI-EcoRV se-quence was inserted into the SstI and SmaI sites of pSp64 togive pSp64(XbaI-EcoRV). Another aliquot of pNeuXbal-CAT was restricted with EcoRV and StuI, and the EcoRV-EcoRV and EcoRV-StuI fragments were isolated separatelyand ligated to SmaI-linearized pSp64, yielding pSp64(EcoRV-EcoRV) and pSp64(EcoRV-StuI), respectively.pNeuStuICAT was cut with XhoI, and the resulting fragmentcontaining the StuI-XhoI sequence was cloned into the SalIsite of pSp64 to produce the construct pSp64(Stu-XhoI).pSp64(XhoI-NarI) was obtained by restricting pNeuXhoICAT with XhoI and SalI, isolating the fragment containingthe XhoI-NarI sequence, and inserting it into the SalI site ofpSp64. This set of plasmids was used in a competition assayagainst the CAT plasmids (see Fig. 5A).

Cell culture and transfection. Rat-1, NIH 3T3, andDHFR-G8 cells were grown in a 1.1 mixture of Dulbeccomodified Eagle medium and Ham F12 extract supplementedwith 10% calf serum and penicillin-streptomycin. Cells wereincubated in a humidified 37°C, 5% CO2 incubator. Rat-1 orNIH 3T3 cells were used as the recipient cells for alltransfection experiments. The CaPO4 precipitation methodwas used for transfection (18). Briefly, 5 x 105 cells wereplated in a 100-mm-diameter tissue culture dish overnight; 10,ug of CAT construct and 5 ,ug of pRSVlacZ were coprecip-itated and added to the cells. After 20 min at room temper-ature, the cells were incubated for 4 h at 37°C, followed by aglycerol shock treatment for 3 min. Cells were then washedwith serum-free medium several times before fresh mediumwas added and were incubated at 37°C for 36 to 48 h.CAT assay and (-galactosidase assay. Cells were harvested

with a rubber policeman at 36 to 48 h posttransfection. Theywere washed with phosphate-buffered saline, followed byresuspension in 100 pA of 0.25 M Tris (pH 8). Four cycles offreeze-thaw-vortex alternating between -80 and 37°C wereused to lyse the cells. Cell debris was spun down in amicrocentrifuge, and 100 pLI of cell extract was collected; 10to 20 pl1 of the extract was tested for P-galactosidase activity(40) to monitor transfection efficiency. Cell extract wasadded to a reaction buffer containing 0.65 ml of 0.1 Mphosphate buffer (pH 7.4), 0.05 ml of 30 mM MgCl2, and 0.05ml of 3.36 M ,-mercaptoethanol; 0.75 ml of ONPG (0.13 g in100 ml of phosphate buffer) was then added, and the reactionmixture was incubated at 37°C until a yellow color wasobserved. The reaction was stopped with 0.5 ml of 1 M

VOL. 10, 1990

6308 SUEN AND HUNG

Na2CO3, and the optical density at a wavelength of 410 nmwas measured. Normalized quantities of cell extracts werethen used for the CAT assay (17). The cell extracts wereheated to 65°C for 15 min (54) before they were added to theCAT reaction mixture. Reaction time was adjusted amongexperiments according to the transfection efficiency but wasnever more than 4 h. The reaction mixture was extractedwith ethyl acetate, dried in a Speed-Vac, and redissolved inethyl acetate, and the products were separated by silica gelthin-layer chromatography (TLC) (the TLC plate was pur-chased from Kodak). The TLC plate was then exposed toKodak XAR5 film. The spots corresponding to the positionsof the [14C]chloramphenicol and the acetylated productswere cut from the TLC exposure and counted in a scintilla-tion counter.

Cotransfection competition. The CAT deletion constructswere cotransfected with increasing quantities of the pSp64series of promoter fragment subclones. Correspondingamounts of the control plasmid pSp64 were added such thatthe total quantity of transfected plasmids was the same in all

AG G+Av.

P 1 2 3 4 5

.f,

A$~~~,t .,

£

...

N1309

plates. For instance, 2 ,ug of plasmid pNeuEcoRICAT wascotransfected with 0, 8, 16, 24, or 32 jig of pSp64(EcoRI-XbaI), and 32, 24, 16, 8, or 0 ,g of pSp64 was added to therespective plates; 3 ,ug of pRSVIacZ was also cotransfectedin this set of experiments. Likewise, cotransfection was donewith pSp64(XbaI-EcoRV) against pNeuXbaICAT, pSp64(EcoRV-EcoRV) against pNeuXbaICAT, pSp64(EcoRV-StuI) against pNeuEcoRVCAT, and pSp64(StuIXhoI) againstpNeuStuICAT. 1-Galactosidase and CAT assays were againdone 36 to 48 h after transfection as described above.Protein-DNA binding assay. The gel retardation assay was

adopted to demonstrate the actual physical binding of pro-tein factors to DNA fragments. Nuclear extract from Rat-1cells was isolated by homogenization under hypotonic con-ditions as described before (13). The gel-purified DNAfragment was 5' end labeled with [y-32P]ATP and T4 poly-nucleotide kinase. Then 1 ng (20,000 cpm) of the probe wasincubated at room temperature for 20 min with or withoutnuclear extract (10 ,ug) in a final volume of 20 ,u of bindingbuffer (10 mM Tris [pH 7.5], 100 mM NaCl, 1 mM EDTA, 1

BCt 2 3.... .m . .. e F

r e.. .....

......... .... . ... ..

.. ..

,, .*. . ;.leW.0#

t.- . S. . ; .,. .;.

..

r.,' ._ ,'

_ .;: . .- , , .,i. . . :. ... .... ,,. i.s.z

_ Er x :.* .; . . : ...... .? t^ '-

.:

*::. s: ..*: ': t

.- t

_ b

M P 12 3

' 'M

123

'I *t ::LFIG. 2. Si mapping of transcription start sites. DNA fragments were isolated and 5' end labeled with [,y-32P]ATP at either the Bcll (A) or

NcoI (B) site. (A) Lanes: G and G+A, Maxam-Gilbert sequencing of the 506-bp Bcll probe (lane P), used as markers; 1, 20 Fig of yeast tRNAalone; 2 and 3, 2 and 20 ,ug, respectively, of total RNA from NIH 3T3 cells; 4 and 5, 2 and 20 ,ug, respectively, of total RNA from DHFR-G8cells; M, pBR322 restricted with MspI (New England BioLabs), labeled and also used as a marker. , Bands that were also detected withthe NcoI probe (shown in panel B). (B) Lanes: P, 486-bp NcoI probe without S1 treatment; 1 to 3, 20 ,ug each of yeast tRNA (lane 1), totalRNA from NIH 3T3 cells (lane 2), and total RNA from DHFR-G8 cells (lane 3). , Protected bands. (C) Longer exposure of lanes 1 to 3 inpanel B. Arrowheads indicate bands that correspond to the minor bands in panel A, lane 5 (bands not marked with an arrow). These bandsare very faint because of the low specific activity of the probe used.

MOL. CELL. BIOL.

A

REGULATION OF THE neu GENE 6309

EwRY

-5m GATATCAAGA GGGTGATGCA AACGTCCCAG GAGTGTTCAA

-4 GATAAAACCG GAGACTGCAA AGACGGGTAA AGGGATGCTG

-24 TGCTTTTAGG AAGTGGATGA GAACTGCAAG CAAGCAAGCA.......................

-M AGCAAGCAAG CAAGCAAGCA AGCAAGCAAG CAAGCAAGCTa......................T ..................................

MS% AGGCGTCGGG GCACAGGGCA GGCGCACCCA GGCCTGCGCC

-3 GGGAGGGAGA AAGTGAAAGCT GGGAGCAGCC-7

ACTCCCAGTC

-X TTGCTGGAAT GCAGTTGGAG

-224 AGCGCGCGGC

-184 GAGGAGGGCT

-144 GCTGAGATTG

-104 GCCCCTTCCC

-m TGCCCTCGCC

-24 CTGAGCCATG

............

TGCCAA1CAC............

G1TCGAGGAA

CCCGCCGCTG

AGGCGGCCCC

GCGCCCCCCG

GGGCCGGAGC

GGGTGGGGGG

GGGCAGGA

GTGCGGCTGGGACCCGGA

TTCCGGCGCc

CGCCCGCAGCBeil I

CGCAATGATC-1 +1

GCGAGCCGAG

GGAGGTGGAG

AAGTTGTGGAGCCCAGGAGC

GGCCTGTGCC

CTGGTCCAGC

ATCATGGAGC

+17 TGGCGGCCTG

+57 GCCCCCCGGA

+97 GGGAAGGGCTS.G

+137 GCGGAGCT

GTGCCGCTGG

ATCGCGGGCA

CTGGCCGCTG

GGGTTCCTCC TCGCCCTCCT

CCCAAGGTGG GTCTTGGCTT

TGCTGCCCAC GGGCCGGAGC

FIG. 3. Sequence of the rat neu gene promoter. The sequence corresponds to the 640-bp EcoRV-SacI fragment shown in Fig. 1C. The firstnucleotide of the translation start site (bold arrow) is designated + 1; nucleotides 5' to this site are assigned negative numbers. Thin arrowsat positions -143, -147, -158, and -203 represent the major transcription initiation sites detected in the S1 protection experiments. Arepetitive sequence between -399 and -357 consisting of the motif GCAA is underlined with a broken line. The solid-underlined sequencerepresents another repetitive sequence containing the GGA motif (nucleotides -200 to -180). A palindromic sequence is underlined with apair of inverted arrows (nucleotides -286 to -267). A CCAAT box and a Spl-binding site are boxed in broken and solid lines, respectively.The sequence is high in G+C content (75%). Nucleotides + 1 to +81 encompass the first exon; nucleotides +82 to + 146 encompass the firstintron. Important restriction sites used in making probes and subcloning are also shown.

mM P-mercaptoethanol, 4% glycerol). The specificity of theprotein-DNA complex was determined by competition as-says in which an excess quantity of unlabeled DNA wasincubated with the nuclear extract for 10 min before theaddition of labeled fragment. The reaction was stopped withgel running dye (0.25% bromophenol blue in 30%o glycerol),and the sample was loaded onto a native 4% polyacrylamidegel. After electrophoresis, the gel was dried and then ex-posed to Kodak XAR film.

RESULTSIdentification and subcloning of the extreme 5' neu gene

sequence. The 33-kb EcoRI fragment containing the genomicneu sequence has been described before (21). Nine BamHIfragments (7.0, 5.5, 5.0, 4.5, 4.2, 1.7, 1.3, 1.2, and 1.2 kb)were mapped within this EcoRI fragment, of which only the5.5-kb EcoRI-BamHI and 7.0-kb BamHI-BamHI fragmentshybridized to a 330-bp PstI probe located at the extreme 5'end of the neu coding sequence (Fig. 1A). The 5.5-kbEcoRI-BamHI fragment was then subcloned into pUC13 and

restriction mapped (Fig. 1B). Both the 2.2-kb XhoI-XhoI and2.4-kb EcoRI-SacI fragments hybridized to the 5' probe,suggesting that the overlapping 350-bp XhoI-SacI fragmentmight contain the immediate 5' upstream transcriptionalsequence. This was confirmed by further subcloning andhybridization (Fig. 1C). The 640-bp EcoRV-SacI fragmentwas subcloned into M13 for sequencing and mapping oftranscription initiation sites.Mapping of transcription start sites and sequence analysis.

When the 505-bp BclI-EcoRV probe was used, multiple Sinuclease-resistant bands were detected, only in the cell linethat overexpresses the neu gene (Fig. 2A, lanes 4 and 5).These bands were likely authentic protected RNAs, sincethey were not detected with tRNA alone (Fig. 2A, lane 1) orRNA from NIH 3T3 cells (Fig. 2A, lanes 2 and 3), and theprotection was apparently concentration dependent (Fig.2A, lanes 4 and 5). To confirm this result, the 486-bpNcoI-EcoRV probe was used. A similar pattern of protectedbands resulted, all corresponding to those detected with theBcII probe and each 20 bp smaller, as expected (Fig. 2A and

VOL. 10, 1990

6310 SUEN AND HUNG

Aeu cene upstrerum trenscr- on9l sequence

EcoRi EcoRV !k3bal

- 300 - 400 -1 00;0

EcoRV' Stut Xhol Narl

I 00 190 140 94

B

EccRI EccV'Y' )ba; Eco-Y Stu. XhoI riarC a

u EcRICAT 1 1X b aG

~ICAT CAT

EcoRV

3 - 'Ecoror,T:CAT

. rrz

t- re roaIf

__ CAT

Xno- CAT |

ICAT |

Hiindi'J S.A Ecu! EcoRV EccRi B rnH. Psti

i Nru Xho. XbaI Cial Sma: Sa, Hinra,jII

pojl inker

L~~~~~~~

AmprEc;. , n

I PMT.1C3.

on,3g h ll S< arAhal11

C Relative

CAT activity

545

50 466

l

MTIC Xhcl S.u. Ec -;

FIG. 4. Construction of NeuCAT plasmids and CAT activities. (A) Structures of plasmids pNeu2.4 and pMT.IC3. Plasmid pNeu2.4contains the neu gene upstream transcriptional sequence; approximate sizes between the restriction sites are indicated. The 2.2-kbEcoRI-NarI fragment was isolated and subcloned into the polylinker of pMT.IC3 immediately upstream of the CAT gene. Various deletionCAT constructs were then made (see Materials and Methods) and named according to the restriction site at the 5' end (B). The set of deletionCAT constructs was transfected into Rat-i fibroblasts by the calcium phosphate precipitation method, and CAT activities were measured (C).Deletion constructs are abbreviated according to the 5' restriction sites shown in panel B. The activity of the longest construct(pNeuEcoRICAT) was chosen as a reference and assigned an activity of 100. Activities of all deletion constructs are expressed relative to thatof pNeuEcoRICAT. All CAT activities have been normalized against transfection efficiency, which was calculated by cotransfection ofplasmid pRSVlacZ, and subsequent ,B-galactosidase assay. Results represent the means of at least five experiments, and the standarddeviation is less than 10%.

B, bands indicated by arrows). The bands detected with bothprobes were mapped to the -143, -147, -158, and -203positions with respect to the translation initiation codon(+1). Other protected bands detected with the Bcll probe(Fig. 2A) most likely represented minor transcriptional ini-tiation sites (these bands were also detected in the NcoIprobe in a long exposure [Fig. 2C]). This conclusion is alsoreasonable in light of the sequence of this promoter (Fig. 3).Sequence analysis revealed a high G+C content (>75%),absence of a TATA box despite the presence of a CAATbox, and presence of an Spl site. A GCAA motif, which hasnot been found in either the HER2 or EGF-r gene promoter,is repeated 13 times between nucleotides -399 and -347. Onthe other hand, two GGAGGAGGA sequences, which ex-tend from -203 to -177, have also been detected in theHER2 promoter. The complementary sequence TCCTCCTCC is also present in the EGF-r gene promoter. Thefeatures of high G+C content, multiple transcription startsites, and absence of a TATA or CCAAT box are common tothe promoters of many other growth factor- or growth factorreceptor-related genes. Thus, sequence analysis and com-parison suggested that we have isolated the promoter se-

quence of the neu gene. We next wanted to show that thissequence is functional in promoting transcription.

Localization of cis-acting elements on the neu gene pro-moter. To demonstrate that the mapped region contained afunctional promoter, the 2.2-kb EcoRI-NarI fragment wasfused to the CAT gene, and functional promoter activity wasdemonstrated. A series of deletion constructs was then madeto examine the contributions of the different regions of thepromoter to transcriptional activity (Fig. 4A and B). Trans-fection of this set of plasmids into Rat-i fibroblasts showeda reproducible fluctuation of CAT activities with respect tothe deletions. The positive control pRSVCAT showed veryhigh activity, while the negative control vector pMT.IC3showed only low background activity (Fig. 4C). The activityof the longest promoter construct, pNeuEcoRICAT, waschosen as a reference (activity designated 100), and theactivities of all other constructs were expressed relative tothe activity of this plasmid. The smallest construct, pNeu-XhoICAT, which contains only a 97-bp sequence between-173 and -76, was able to promote transcription quiteefficiently (45% of the activity of pNeuEcoRICAT). A burstof CAT activity was observed when the promoter was

A

MOL. CELL. BIOL.

. --

REGULATION OF THE neu GENE 6311

EcoRI EcoRV Xbal

s,I

ECoRV Stul Xhol Marl/Clal

LL1 1LLLtt| CAT IEceoRI - XbaI

subcloned IntopSp64

/

Xbal-E..RVEseRVEo.RV

EcoRV- StuI

StuD- XholXol- Karl

cotransfection competition

C D

go.

a I 16 24 0 I 16 32

pUpS4[IEeRwxbeI (tw) pSpStXba8-E..RuV (us)

pNsuEcoRVCAT

0 I 16 24pSpU[Ee.RV41tIj (ug)

FIG. 5. Subcloning of the promoter fragments and results of cotransfection competition experiments. (A) Structures of fragments used.Fragments from the neu gene promoter were subcloned into pSp64 (see Materials and Methods for details) and named according to thebounding restriction sites [pSp64(EcoRI-XbaI), pSp64(XbaI-EcoRV), etc.]. (B to D) Results of cotransfection competition experimentsperformed as described in Materials and Methods. (B) pSp64(EcoRI-XbaI) competed against pNeuEcoRICAT; (C) pSp64(XbaI-EcoRV)competed against pNeuXbaICAT; (D) pSp64(EcoRV-StuI) competed against pNeuEcoRVCAT. The quantity of the competitor is shown onthe x axis. Results represent the means of three or four experiments, and the standard deviation is less than 10%.

deleted up to the EcoRV site at -504 (compare CAT activitybetween XbaI and EcoRV in Fig. 4C). This finding suggeststhat the XbaI-EcoRV fragment has a strong suppressiveeffect on transcription. The same profile of activities wasobserved in NIH 3T3 cells (data not shown). Analysis of theresults suggest that at least one negative and three positivecis-acting elements are involved in transcriptional regulationof the neu gene.

trans-Acting factors interact with the cis-acting elements. Todetermine whether trans-acting protein factors exist and

interact with the identified cis-acting elements, each restric-tion fragment was cloned into pSp64 (Fig. SA) and a cotrans-fection competition assay was performed (see Materials andMethods). When pNeuXbaICAT was cotransfected withincreasing concentrations of pSp64(XbaI-EcoRV), a pro-gressive increase in CAT activity was observed (Fig. SC),suggesting that the effect of a negative factor(s) was abol-ished. When pNeuEcoRICAT and pNeuEcoRVCAT werecotransfected with pSp64(EcoRI-XbaI) and pSp64 (EcoRV-StuI), respectively, a decrease in CAT activity was seen

A

B

100

S

A-go.

o

0

-Na

4

4

4j-

VOL. 10, 1990

6312 SUEN AND HUNG

1 2 3 4 5 6 7

--Cl

Free

FIG. 6. Protein-DNA binding assay. The 139-bp StuI-XhoI(-313 to -174) fragment was 5' end labeled with [y-32P]ATP, and20,000 cpm of the probe was incubated with nuclear extract isolatedfrom Rat-1 cells (lanes 2 to 7). Lane 1, Probe alone; lanes 2 and 3,probe plus 10 ,ug of nuclear extract; two slower-migrating bandswere detected (Cl and C2). The specificity of the complexes wasdetermined by competition with the same unlabeled fragment (lanes4 and 5) but not with a nonspecific competitor, pSp64 (lanes 6 and 7).

(Fig. 5B and D), suggesting that a positive factor(s) wasprevented from interacting with these fragments. Theseresults complement those of the deletion studies very well.On the other hand, no significant changes in CAT activitieswere observed when similar experiments were done with theEcoRV-EcoRV or StuI-XhoI fragment (data not shown).

Since these fragments are small enough to be used asprobes for direct protein-DNA binding in a gel retardationassay, nuclear extract was isolated from cells to examine theexistence of a protein factor(s) that might interact with someof the fragments but may have escaped detection by thecotransfection competition assay. Purified EcoRV-EcoRV,StuI-XhoI, and XhoI-NarI fragments were 5' end labeledwith [y-32P]ATP and incubated with crude nuclear extractfrom Rat-1 cells. No protein-DNA complex was detectedwith either the EcoRV-EcoRV or XhoI-NarI fragment (datanot shown). On the other hand, protein-DNA complexeswere observed when the StuI-XhoI fragment was used (Fig.6, lanes 2 and 3; Cl and C2). The specificity of the complexeswas confirmed by the competitive effect of preincubation ofthe nuclear extract with an excess quantity of unlabeledStuI-XhoI fragment (Fig. 6, lanes 4 and 5), while formationof the complexes was not affected by the addition of a

nonspecific competitor (Fig. 6, lanes 6 and 7). Although C2seemed to exist even in the absence of nuclear extract (Fig.6, lane 1), it is probably a structural conformation of theprobe itself which just happened to migrate at the same levelof C2. This explanation is obvious, since the intensity of thisband was similar before the addition of nuclear extract (Fig.6, lane 1) and preincubation of nuclear extract with thespecific competitor (Fig. 6, lanes 4 and 5) but not a nonspe-cific competitor (Fig. 6, lanes 6 and 7).

DISCUSSIONAmplification or overexpression of the human neu gene

has been found frequently in various primary human tumors.This observation combined with transfection studies in cellculture (12, 19) and transgenic mice (9, 39, 57), makes ithighly likely that the neu gene plays an important role in theprocess of tumorigenesis. However, in contrast to theclosely related EGF-r gene, few studies on regulation of theneu gene have been reported (24, 58). We report here theisolation and characterization of the promoter of the rat neugene. This study may provide some insight into the tran-scriptional regulation of this gene, which in turn would allowus to study the possible defects at the transcription level thatmay lead to overexpression.Using the extreme 5' sequence of the rat neu gene cDNA

as a probe, we identified the sequence immediate 5' to thetranslation start site. The 2.4-kb EcoRI-SacI fragment wassubcloned; the 3' portion of this fragment contains both thefirst exon and the first intron. The 2.2-kb EcoRI-NarIfragment, which contains sequences upstream from nucleo-tide -76 (the translation start site was assigned +1), wasligated to a CAT reporter gene vector. Transfection intoRat-1 and NIH 3T3 cells followed by CAT assay showedfunctional promoter activity. Examination of the activity ofa series of deletion CAT constructs (Fig. 4B) showed that thefragment containing sequences between -173 (XhoI) and-76 (NarI) was able to promote transcription quite effi-ciently (45% of the activity of the whole 2.2-kb promoter)(Fig. 4C). From one deletion to another, we observed anaverage twofold difference in CAT activity except for com-parisons between pNeuXbaICAT and pNeuEcoRVCAT,which showed a fivefold difference. This finding suggests thepresence of a suppressing activity within this 1.1-kb XbaI-EcoRV fragment. Since the promoter and enhancer arethought to function by interacting with various nuclearprotein factors (3, 29, 42, 43, 63), the results of the deletionstudies lead us to the proposed model shown in Fig. 7, whichsuggests the existence of both positive and negative factorsinteracting with the corresponding fragment. To provideevidence for the existence of protein factors, pSp64 sub-clones of the individual fragments along the promoter (Fig.5A) were used in a functional cotransfection competition

EcoRU EcoRV Xbal

I L IEcoRV Stul Xhol Marl

I 1 1 1fI-+ ~*.4

FIG. 7. Model of transcription of the rat neu gene in Rat-1 cells. Multiple cis-acting elements are shown simply as fragments bounded byrestriction sites. The trans-acting factors that interact with a particular region are drawn only to represent their net effect on transcription.Only one gross factor is assigned to a particular fragment, although it is likely to represent a complicated interaction of many different factors.Only one arrow is drawn to indicate the approximate position of the transcription start sites, which actually represents four major and severalminor initiation sites. The same model may apply to NIH 3T3 cells and some breast cancer cell lines, since the same profiles of activities withrespect to the deletion constructs have been observed.

neu..: I I I

-

I-

I ElI

MOL. CELL. BIOL.

I

REGULATION OF THE neu GENE 6313

assay (see Materials and Methods). As expected from theproposed model, a gradual increase in CAT activity wasobserved when the subcloned plasmid containing the XbaI-EcoRV fragment was used to compete against pNeuXbaICAT (Fig. 5C), indicating the prevention of a negativefactor(s) from binding to this region of the CAT construct,thereby eliminating the effect of this factor on transcription.Similarly, but in the opposite sense, decreases in CATactivities were detected when pSp64(EcoRI-XbaI) andpSp64(EcoRV-StuI) were used to compete with pNeuEcoRlCAT and pNeuEcoRVCAT, respectively (Fig. 5B and D).This finding indicates the prevention of a positive factor(s)from binding to these regions and removal of the positiveeffect on transcription. It is possible that the maximalamount of competitor may still not be enough to abolish allof the factors interacting with a particular fragment, so thata total inhibitory effect on CAT activity was not observed.For those subcloned fragments that did not show competi-tion, we could not distinguish between whether interactingfactors were absent or whether insufficient competitor waspresent as a result of factors present in abundance. Wetherefore subjected these EcoRV-EcoRV, StuI-XhoI, andXhoI-NarI fragments to a gel retardation assay, which wouldyield evidence of the physical binding of factor(s) to thefragment of interest. Among these three fragments, only thelabeled StuI-XhoI fragment formed protein-DNA complexeswhen incubated with nuclear extract from Rat-1 cells. Thespecificity of the complex was demonstrated by its compe-tition with the same unlabeled fragment and its lack ofcompetition with linearized pSp64. Specific protein-DNAcomplexes were also detected with this StuI-XhoI fragmentwhen nuclear extracts isolated from HeLa cells and somebreast cancer cell lines were used (data not shown). Al-though a protein-DNA complex was not detected with theXhoI-NarI fragment, nuclear factors were found to bind tothis fragment when nuclear extracts from Swiss Webster 3T3cells and a liver cell line were used (D.-H. Yan and M.-C.Hung, unpublished observation). The results from this set ofexperiments along with those of the deletion and cotransfec-tion competition assays generally conform with our pro-posed model of transcriptional regulation of the neu gene.When the sequence between nucleotides -504 (the 3'

EcoRV site) and + 145 (Sacl) was analyzed, several interest-ing features, including multiple transcription initiation sites,high G+C content, absence of a TATA or CCAAT box, andmultiple Spl-binding sites, were observed. These character-istics have been described in the promoters of many growthfactor- or growth factor receptor-related genes, such as theEGF-r (25, 27), insulin receptor (2, 60), and transforminggrowth factor a (26) and P1 (32) genes. In the neu genepromoter, four major transcription start sites are mapped tonucleotides -143, - 147, -158, and -203 by the S1 nucleaseprotection method (Fig. 2). The promoter has 75% G+Ccontent and does not have a TATA box despite the presenceof a CCAAT box, whereas both are found in the human neu(HER2) promoter (24, 58). Only one consensus Spl-bindingsite was found. Two interesting repetitive sequences arefound in the neu gene promoter. One of them contains therepeated motif ofGCAAGCAA between -399 and -347 andis found neither in its human counterpart, HER2 nor in theEGF-r gene. A second repetitive sequence consisting of themotif GGAGGAGGA, located between -203 and -187, isalso found in HER2 (24, 58). The complementary sequenceTCCTCCTCC is found in the EGF-r gene (25, 27). ThisGGA-repetitive sequence is reported to be S1 nucleasesensitive and is found in some other housekeeping genes

(reference 28 and references therein). In the case of theEGF-r gene, both Spl and a TC factor have been shown tobind to this TCCTCCTCC sequence and stimulate transcrip-tion (28, 30, 31). Since there is high homology between theneu and EGF-r genes, it would be interesting to see whetherthe two genes have a common regulatory factor. However,neither EGF-r gene promoter region containing both theTCCTCCTCC sequence and several Spl-binding sites nor anSV40 promoter fragment containing six GC boxes inhibitsthe formation of protein-DNA complexes with the StuI-XhoIfragment (which contains the GGAGGAGGA repeats) in gelretardation assays. This finding suggests that Spl and thefactor that binds to the TCC repeats in the EGR-r genepromoter do not bind to this complementary repeat in theneu gene. On the other hand, a concentration-dependentcompetition of specific complexes was observed when theSV40 enhancer sequence was used in the same experiment(T.-C. Suen and M.-C. Hung, submitted for publication). Inaddition, a palindromic sequence is found between -286 and-267, half of which resembles the TC-I or TC-II motif in theSV40 enhancer (66). An AP2 homologous sequence (38) isalso detected at -318, while a sequence similar to theoctamer-binding site (51) is observed at -489.

In conclusion, we have identified the promoter region ofthe neu gene, which seems to have many features in commonwith other growth factor- or growth factor receptor-relatedgenes. Functional promoter activity has been demonstrated,and multiple protein factors are present in the cells interact-ing with the different DNA elements on the promoter,contributing either positively and negatively to transcrip-tional activity. Some of these factors may be common to theSV40 enhancer. This study represents our initial character-ization of the rat neu gene promoter. Not only does itprovide basic information on transcriptional regulation of theneu gene, but the CAT constructs described herein providetools for studying the molecular mechanisms of overexpres-sion of the neu gene in some breast cancer and ovarian celllines, studies that are now under way.

ACKNOWLEDGMENTS

This work was supported by Public Health Service grant CA-45265 from the National Institutes of Health.We thank Lakshmi Narayana for technical help and Tania Busch

for excellent photographic work.

LITERATURE CITED1. Akiyama, T., C. Sudo, H. Ogawara, K. Toyoshima, and T.

Yamamoto. 1986. The product of the human c-erbB-2 gene: a185 kilodalton glycoprotein with tyrosine kinase activity. Sci-ence 232:1644-1646.

2. Araki, E., F. Shimada, H. Uzawa, M. Mori, and Y. Ebina. 1987.Characterization of the promoter region of the human insulinreceptor gene. Evidence for promoter activity. J. Biol. Chem.262:16186-16191.

3. Atchison, M. L. 1988. Enhancers: mechanisms of action and cellspecificity. Annu. Rev. Cell Biol. 4:127-153.

4. Bargann, C. I., M.-C. Hung, and R. A. Weinberg. 1986. Theneu oncogene encodes an epidermal growth factor receptor-related protein. Nature (London) 319:226-230.

5. Bargmann, C. I., M.-C. Hung, and R. A. Weinberg. 1986.Multiple independent activations of the neu oncogene by a pointmutation altering the transmembrane domain of p185. Cell45:649-657.

6. Bargmann, C. I., and R. A. Weinberg. 1988. Oncogenic activa-tion of the neu encoded receptor protein by point mutation anddeletion. EMBO J. 7:2043-2052.

7. Bargmann, C. I., and R. A. Weinberg. 1988. Increased tyrosinekinase activity associated with the protein encoded by the

VOL. 10, 1990

6314 SUEN AND HUNG

activated neu oncogene. Proc. Natl. Acad. Sci. USA 85:5394-5398.

8. Berger, M. S., G. W. Locher, S. Saurer, W. J. Gullick, M. D.Waterfield, B. Gorner, and N. E. Hynes. 1988. Correlation ofc-erbB-2 gene amplification and protein expression in humanbreast carcinoma with nodal status and nuclear grading. CancerRes. 48:1238-1243.

9. Bouchard, L., L. Lamarre, P. J. Tremblay, and P. Jolicouer.1989. Stochastic appearance of mammary tumors in transgenicmice carrying the MMTV/c-neu. Cell 57:931-936.

10. Coussens, L., T. L. Yang-Feng, Y.-C. Liao, E. Chen, A. Gray, J.McGrath, P. H. Seeburg, T. A. Libermann, J. Schiessinger, U.Francke, A. Levinson, and A. Ullrich. 1985. Tyrosine kinasereceptor with extensive homology to EGF receptor shareschromosomal location with neu oncogene. Science 230:1132-1139.

11. D'Emilia, J., K. Bulovas, K. D'Ercole, B. Wolf, G. Steele, Jr.,and I. C. Summerhayes. 1989. Expression of the c-erbB-2 geneproduct (p185) at different stages of neoplastic progression inthe colon. Oncogene 4:1233-1239.

12. Di Fiore, P. P., J. H. Pierce, M. H. Kraus, 0. Segatto, C. R.King, and S. A. Aaronson. 1987. erbB-2 is a potent oncogenewhen overexpressed in NIH3T3 cells. Science 237:178-182.

13. Dignam, J. D., R. M. Leibovitz, and R. G. Roeder. 1983.Accurate transcription initiation by RNA polymerase II in asoluble extract from isolated mammalian nuclei. Nucleic AcidsRes. 11:1475-1489.

14. Edlund, T., M. D. Walker, B. J. Barr, and W. J. Ratter. 1985.Cell specific expression of the rat insulin gene: evidence for roleof two distinct 5' flanking elements. Science 230:912-916.

15. Fukushige, S.-I., K.-I. Matsubara, M. Yoshida, M. Sasaki, T.Suzuki, K. Semba, K. Toyoshima, and T. Yamamoto. 1986.Localization of a novel v-erbB-related gene, c-erbB-2, on chro-mosome 17 and its amplification in a gastric cancer cell line.Mol. Cell. Biol. 6:955-958.

16. Gorman, C. M., G. T. Merlino, M. C. William, I. Pastan, andB. H. Howard. 1982. The Rous sarcoma virus long terminalrepeat is a strong promoter when introduced into a variety ofeukaroytic cells by DNA mediated transfection. Proc. Natl.Acad. Sci. USA 79:6777-6781.

17. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase. Mol. Cell. Biol. 2:1044-1051.

18. Graham, F. L., and A. J. van der Eb. 1973. A new technique forthe assay of infectivity of human adenovirus 5 DNA. Virology52:456-467.

19. Hudziak, R. M., J. Schiessinger, and A. Ulirich. 1987. Increasedexpression of the putative growth factor receptor p185 HER2causes transformation and tumorigenesis of NIH3T3 cells. Proc.Natl. Acad. Sci. USA 84:7159-7163.

20. Hung, M.-C., T. Barnett, C. Woolford, and P. C. Wensink. 1982.Transcript maps of Drosophila yolk protein genes. J. Mol. Biol.154:581-602.

21. Hung, M.-C., A. L. Schechter, P.-Y. Chevray, D. Stern, andR. A. Weinberg. 1986. Molecular cloning of the neu gene:absence of gross structural alteration in oncogenic alleles. Proc.Natl. Acad. Sci. USA 83:261-264.

22. Hung, M.-C., A. L. Schechter, L. Vaidyanathan, D. Stern, andR. A. Weinberg. 1986. Isolation of the molecular clone of theneu oncogene from the B103 rat neuro/glioblastoma cell line.Biochem. Mol. Epidemiol. Cancer 40:391-395.

23. Hung, M.-C., D.-H. Yan, and X. Y. Zhao. 1989. Amplification ofthe proto-neu oncogene facilitates oncogenic activation by a

single point mutation. Proc. Natl. Acad. Sci. USA 86:2545-2548.

24. Ishii, S., F. Imamoto, Y. Yamanashi, K. Toyoshima, and T.Yamamoto. 1987. Characterization of the promoter region of thehuman c-erbB-2 protooncogene. Proc. Natl. Acad. Sci. USA82:43744378.

25. Ishii, S., Y.-H. Su, R. H. Stratton, B. A. Roe, G. T. Merlino, andI. Pastan. 1985. Characterization and sequence of the promoterregion of the human epidermal growth factor receptor gene.Proc. Natl. Acad. Sci. USA 82:49204924.

26. Jakobovitis, E. B., U. Schlokat, J. L. Vannice, R. Derynck, andA. Levinson. 1988. The human transforming growth factor alphapromoter directs transcription initiation from a single site in theabsence of a TATA sequence. Mol. Cell. Biol. 8:5549-5554.

27. Johnson, A. C., S. Ishii, Y. Jinno, I. Pastan, and G. T. Merlino.1988. Epidermal growth factor receptor gene promoter. Dele-tion analysis and identification of nuclear protein binding sites.J. Biol. Chem. 263:5693-5699.

28. Johnson, A. C., Y. Jinno, and G. T. Merlino. 1988. Modulationof epidermal growth factor receptor proto-oncogene transcrip-tion by a promoter site sensitive to S1 nuclease. Mol. Cell. Biol.8:4174-4184.

29. Jones, N. C., P. W. J. Rigby, and E. B. Ziff. 1988. Trans-actingfactors and the regulation of eukaryotic transcription: lessonsfrom studies on DNA tumor viruses. Genes Dev. 2:267-281.

30. Kageyama, R., G. T. Merlino, and I. Pastan. 1988. Epidermalgrowth factor receptor gene transcription. Requirement for Spland an EGF receptor-specific factor. J. Biol. Chem. 263:6329-6336.

31. Kageyama, R., G. T. Merlino, and I. Pastan. 1988. A transcrip-tion factor active on the epidermal growth factor receptor gene.Proc. Natl. Acad. Sci. USA 85:5016-5020.

32. Kim, S. J., A. Glick, M. B. Sporn, and A. B. Roberts. 1989.Characterization of the promoter region of the transforminggrowth factor-,81 gene. J. Biol. Chem. 264:402-408.

33. King, C. R., M. H. Kraus, and S. A. Aaronson. 1985. Amplifi-cation of a novel v-erbB-related gene in a human mammarycarcinoma. Science 229:974-976.

34. King, C. R., S. M. Swain, L. Porter, S. M. Steinberg, M. E.Lippman, and P. E. Gelman. 1989. Heterogenous expression oferbB-2 messenger RNA in human breast cancer. Cancer Res.49:4185-4191.

35. Kraus, M. H., N. C. Popescu, S. C. Amsbaugh, and C. R. King.1987. Overexpression of the EGF-receptor-related proto-onco-gene erbB-2 in human mammary tumor cell lines by differentmolecular mechanisms. EMBO J. 6:605-610.

36. Lacroix, H., J. D. Iglehart, M. A. Skinner, and M. H. Kraus.1989. Overexpression of erbB-2 or EGF-receptor proteinspresent in early stage mammary carcinoma is detected simulta-neously in matched primary tumors and regional metastases.Oncogene 4:145-151.

37. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

38. Mitchell, P. J., C. Wang, and R. Tjian. 1987. Positive andnegative regulation of transcription in vitro: enhancer-bindingprotein AP2 is inhibited by SV40 T antigen. Cell 50:847-861.

39. Muller, W. J., E. Sinn, P. K. Pattengale, R. Wallace, and P.Leder. 1988. Single-step induction of mammary adenocarci-noma in transgenic mice bearing the activated c-neu oncogene.Cell 54:105-115.

40. Norton, P. A., and J. M. Coffin. 1985. Bacterial ,-galactosidaseas a marker gene of Rous sarcoma virus gene expression andreplication. Mol. Cell. Biol. 5:281-290.

41. Padhy, L. C., C. Shih, D. Cowing, R. Finkelstein, and R. A.Weinberg. 1982. Identification of a phosphoprotein specificallyinduced by the transforming DNA of rat neuroblastomas. Cell28:865-871.

42. Peter, F. J., and S. L. McKnight. 1989. Eukaryotic transcrip-tional regulatory proteins. Annu. Rev. Biochem. 58:799-839.

43. Ptashne, M. 1988. How eukaryotic transcriptional activatorswork. Nature (London) 33:683-689.

44. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. RNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

45. Schechter, A. L., M.-C. Hung, L. Vaidyanathan, R. A. Wein-berg, T.-L. Yang-Feng, U. Francke, A. Ulirich, and L. Coussens.1985. The neu gene: an erbB-homologous gene distinct from andunlinked to the gene encoding the EGF receptor. Science229:976-978.

46. Schechter, A. L., D. F. Stern, L. Vaidyanathan, S. J. Decker,J. A. Drebin, M. I. Greene, and R. A. Weinberg. The neu

oncogene: an erbB-related gene encoding a 185,000 Mr tumor

MOL. CELL. BIOL.

REGULATION OF THE neu GENE 6315

antigen. Nature (London) 312:513-516.47. Schneider, P. M., M.-C. Hung, S. M. Chiocca, J. Manning, X. Y.

Zhao, K. Fang, and J. A. Roth. 1989. Differential expression ofthe c-erbB-2 gene in human small cell lung cancer. Cancer Res.49:4968-4971.

48. Segatto, O., C. R. King, J. H. Pierce, P. P. Di Fiore, and S. A.Aaronson. 1988. Different structural alterations upregulate invitro tyrosine kinase activity and transforming potency of theerbB-2 gene. Mol. Cell. Biol. 8:5570-5574.

49. Semba, K., N. Kamata, K. Toyoshima, and T. Yamamoto. 1985.A v-erbB-related protooncogene, c-erbB-2, is distinct from thec-erbB-1/epidermal growth factor receptor gene and is amplifiedin human salivary gland adenocarcinoma. Proc. Natl. Acad. Sci.USA 82:6497-6501.

50. Shib, C., L. C. Padhy, M. Wurray, and R. A. Weinberg. 1981.Transforming gene of carcinomas and neuroblastomas intro-duced into mouse fibroblasts. Nature (London) 290:261-264.

51. Singh, H., R. Sen, D. Baltimore, and P. A. Sharp. 1986. Anuclear factor that binds to a conserved sequence motif intranscriptional control elements of immunoglobulin genes. Na-ture (London) 319:154-158.

52. Slamon, D. J., G. M. Clark, S. G. Wong, W. J. Levin, A. Ullrich,and W. McGuire. 1987. Human breast cancer: correlation ofrelapse and survival with amplification of the HER-2/neu onco-gene. Science 235:177-182.

53. Slamon, D. J., W. Godolphin, L. A. Jones, J. A. Holt, S. G.Wong, D. E. Keith, W. J. Levin, S. G. Stuart, J. Udove, A.Ullrich, and M. F. Press. 1989. Studies of the HER-2/neuproto-oncogene in human breast and ovarian cancer. Science244:707-712.

54. Sleigh, M. 1986. A non chromatographic assay for expression ofthe chloranmphenicol acetyltransferase gene in eucaroytic cells.Anal. Biochem. 156:251-256.

55. Stern, D. F., P. A. Heffernan, and R. A. Weinberg. 1986. p185,product of the neu proto-oncogene, is a receptorlike proteinassociated with tyrosine kinase activity. Mol. Cell. Biol. 6:1729-1740.

56. Stern, D. F., M. P. Kamps, and H. Cao. 1988. Oncogenicactivation of p185"sU stimulates tyrosine phosphorylation invitro. Mol. Cell. Biol. 8:3969-3973.

57. Suda, Y., S. Aizawa, Y. Furuta, T. Yagi, Y. Ikawa, K. Saitoh, Y.Yamada, K. Toyoshima, and T. Yamamoto. 1990. Induction of avariety of tumors by c-erB2 and clonal nature of lymphomaseven with the mutated gene (Val659--Glu659). EMBO J. 9:181-190.

58. Tal, M., R. C. King, M. H. Kraus, A. Ulirich, J. Schlessinger,and D. Givol. 1987. Human HER2 (neu) promoter: evidence formultiple mechanisms for transcriptional initiation. Mol. Cell.Biol. 7:2597-2601.

59. Tal, M., M. Wetzler, Z. Josefberg, A. Deutch, M. Gutman, D.Assaf, R. Kris, Y. Shiloh, and J. Schlessinger. 1988. Sporadicamplification of the HER21neu protooncogene in adenocarcino-mas of various tissues. Cancer Res. 48:1517-1520.

60. Tewari, A. S., D. M. Cook, and R. Taub. 1989. Characterizationof the promoter region and 3' end of the human insulin receptorgene. J. Biol. Chem. 264:16238-16245.

61. Toohey, M. G., K. L. Morley, and D. 0. Peterson. 1986. Multiplehormone-inducible enhancers as mediators of differential tran-scription. Mol. Cell. Biol. 6:4526-4538.

62. van de Viver, M. J., W. J. Mooi, P. Wisman, J. L. Peterse, andR. Nusse. 1988. Immunohistochemical detection of the neuprotein in tissue sections of human breast tumors with amplifiedneu DNA. Oncogene 2:175-178.

63. Wasylyk, B. 1988. Enhancers and transcription factors in thecontrol of gene expression. Biochim. Biophys. Acta 951:17-35.

64. Wright, C., B. Angus, S. Nicholson, J. R. C. Sainsbury, J.Cairns, W. J. Guflick, P. Kelly, A. L. Harris, and C. H. W.Horne. 1989. Expression of c-erbB-2 oncoprotein: a prognosticindicator in human breast cancer. Cancer Res. 49:2087-2090.

65. Yamamoto, T., S. Ikawa, T. Akiyama, K. Semba, N. Nomura, N.Miyajima, T. Saito, and K. Toyoshima. 1986. Similarity ofprotein encoded by the human c-erbB-2 gene to the epidermalgrowth factor receptor. Nature (London) 319:230-234.

66. Zenke, M., T. Grundstrom, H. Matthews, M. Wintzerith, C.Shatz, A. Wilderman, and P. Chambon. 1986. Multiple sequencemotifs are involved in SV40 enhancer function. EMBO J.5:387-397.

67. Zhang, X., E. Silvia, D. Gershenson, and M.-C. Hung. 1989.Amplification and rearrangement of c-erb B proto-oncogenes incancer of human female genital tract. Oncogene 4:985-989.

VOL. 10, 1990